Your browser is old and dusty. Try Google Chrome!

Details for sll6076

ORF sll6076
Accession NP_942519.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -330 -316 -1.67204 0.269
NP_440795.1_7 Forward -23 -16 14.6904 0.0123
NP_440795.1_7 Reverse -16 -23 14.6904 0.0123
NP_442100.1_1 Forward -246 -227 8.45061 0.24
NP_441418.1_1 Reverse -215 -234 7.49569 0.275
NP_442538.1_6 Reverse -372 -391 13.1758 0.269
NP_442272.1_2 Forward -206 -187 11.5064 0.232
NP_441453.1_4 Reverse -15 -23 16.539 0.00633
NP_441453.1_4 Forward -24 -16 16.539 0.00633
NP_442151.1_6 Reverse -15 -29 17.8958 0.00866
NP_442151.1_6 Forward -24 -10 6.3911 0.236
NP_441818.1_1 Forward -23 -12 16.7744 0.0118
NP_441818.1_9 Forward -392 -373 -10.3253 0.292
NP_440226.1_1 Reverse -15 -34 17.7974 0.0175
NP_440226.1_1 Forward -24 -5 8.45592 0.0871
NP_441465.1_2 Reverse -374 -393 16.0616 0.256
NP_441098.1_3 Forward -199 -180 -0.0896902 0.25
NP_440150.1_2 Reverse -272 -291 4.32522 0.281
NP_442173.1_1 Forward -23 -15 15.4574 0.00633
NP_442173.1_1 Reverse -16 -24 15.4574 0.00633
NP_442173.1_3 Reverse -63 -73 15.8113 0.251
NP_442752.1_4 Forward -24 -17 13.8055 0.0199
NP_442752.1_4 Reverse -15 -22 13.8055 0.0199
NP_441675.1_4 Forward -205 -186 5.89931 0.236
NP_440784.1_7 Forward -23 -16 15.9687 0.0123
NP_440784.1_7 Reverse -16 -23 15.9687 0.0123
NP_441250.1_3 Forward -362 -343 9.93088 0.197
NP_440061.1_9 Forward -26 -12 13.4703 0.0811
NP_441054.1_4 Reverse -5 -23 2.37909 0.169
NP_441054.1_4 Forward -34 -16 0.0191479 0.177
NP_439979.1_3 Forward -341 -322 17.0844 0.237
NP_442062.1_3 Reverse -180 -199 1.17943 0.23
NP_442062.1_8 Forward -24 -14 17.6796 0.00193
NP_442062.1_8 Reverse -15 -25 17.3846 0.00193
NP_442062.1_8 Reverse -141 -151 5.09324 0.184
NP_440761.1_4 Reverse -10 -29 -13.4719 0.257
NP_441859.1_3 Forward -25 -6 9.63507 0.127
NP_440304.1_4 Reverse -13 -23 9.91146 0.051
NP_440304.1_4 Reverse -50 -60 3.42162 0.299
NP_440304.1_4 Forward -26 -16 1.84832 0.299
NP_442242.1_4 Forward -23 -16 14.3954 0.0124
NP_442242.1_4 Reverse -16 -23 14.3954 0.0124
NP_442242.1_4 Forward -149 -142 9.77388 0.213
NP_441619.1_8 Forward -30 -16 6.48882 0.295
NP_440769.1_8 Reverse -230 -249 14.5524 0.15
NP_440769.1_8 Forward -202 -183 11.4058 0.171
NP_441083.1_5 Reverse -15 -25 20.3345 0.00053
NP_441083.1_5 Forward -24 -14 19.3512 0.000718
NP_441738.1_2 Forward -22 -15 15.28 0.0102
NP_441738.1_2 Reverse -17 -24 15.28 0.0102
NP_441738.1_2 Forward -148 -141 13.3134 0.0335
NP_441558.1_5 Reverse -13 -32 11.7992 0.0766
NP_441558.1_5 Forward -152 -133 5.50599 0.247
NP_440209.1_1 Reverse -15 -23 18.1123 0.00295
NP_440209.1_1 Forward -24 -16 18.1123 0.00295
NP_442136.1_4 Forward -316 -297 6.98015 0.295
NP_442889.1_8 Reverse -12 -26 21.6317 0.0025
NP_442889.1_8 Reverse -287 -301 6.29216 0.196
NP_440447.1_6 Reverse -7 -25 6.11567 0.145
NP_441713.1_1 Reverse -9 -28 -12.2919 0.244
NP_440178.1_7 Reverse -14 -33 -2.95047 0.0423
NP_442570.1_3 Forward -78 -59 0.196116 0.208
NP_441716.1_1 Reverse -109 -123 4.71948 0.252
NP_441716.1_2 Reverse -354 -373 3.54706 0.229
NP_441327.1_1 Forward -203 -184 6.61611 0.25
NP_442111.1_4 Forward -25 -11 4.22782 0.216
NP_440906.1_5 Forward -23 -16 15.8704 0.0124
NP_440906.1_5 Reverse -16 -23 15.8704 0.0124
NP_440747.1_10 Forward -27 -15 14.887 0.00223
NP_440747.1_10 Reverse -12 -24 7.4138 0.00422
NP_441130.1_10 Forward -26 -12 8.84938 0.131
NP_441486.1_1 Reverse -12 -26 6.19444 0.0344
NP_441486.1_1 Forward -27 -13 6.19444 0.0344
NP_442145.1_4 Reverse -179 -198 3.96249 0.283
NP_442634.1_4 Reverse -13 -27 -3.147 0.161
NP_441265.1_3 Forward -112 -98 7.17775 0.181
NP_441265.1_6 Reverse -285 -304 15.6332 0.172
NP_440842.1_10 Reverse -288 -302 0.88457 0.296
NP_441014.1_8 Forward -89 -70 -7.76869 0.281
NP_443018.1_3 Forward -23 -16 14.8871 0.0123
NP_443018.1_3 Reverse -16 -23 14.8871 0.0123
NP_441634.1_8 Forward -26 -12 -4.62196 0.295
NP_440376.1_1 Forward -24 -15 19.4693 0.000692
NP_440376.1_1 Reverse -15 -24 19.4693 0.000692
NP_441588.1_4 Reverse -17 -27 15.9097 0.0369
NP_442687.1_1 Forward -193 -180 11.5234 0.273
NP_442687.1_7 Reverse -14 -24 18.5646 0.0028
NP_442687.1_7 Forward -25 -15 8.92815 0.0994
NP_441077.1_6 Reverse -297 -313 3.18749 0.271
NP_440642.1_10 Forward -301 -287 8.65209 0.198
NP_441388.1_3 Forward -121 -102 14.2566 0.142
NP_442766.1_9 Forward -392 -373 14.4541 0.241
NP_440741.1_7 Reverse -50 -69 18.4781 0.136
NP_442658.1_1 Reverse -13 -23 16.0075 0.00966
NP_442658.1_1 Forward -26 -16 6.76441 0.214
NP_442198.1_3 Forward -33 -14 2.65439 0.297
NP_442782.1_2 Forward -75 -61 5.99778 0.234
NP_441414.1_9 Reverse -15 -34 16.9124 0.00979
NP_441414.1_9 Forward -24 -5 -10.227 0.279
NP_440184.1_1 Forward -196 -177 10.4367 0.0985
NP_442321.1_4 Reverse -318 -337 3.53937 0.255
NP_441958.1_5 Reverse -14 -24 20.5312 0.000966
NP_441958.1_5 Forward -25 -15 12.2714 0.00183
NP_441958.1_5 Reverse -140 -150 0.668351 0.134
NP_442685.1_2 Forward -205 -195 14.828 0.231
NP_440203.1_5 Forward -147 -137 10.206 0.235
NP_439905.1_1 Forward -23 -10 9.36073 0.221
NP_439905.1_1 Reverse -16 -29 9.16406 0.221
NP_440984.1_7 Forward -29 -15 20.7474 0.00322
NP_440984.1_7 Reverse -10 -24 8.65272 0.139
NP_439990.1_5 Reverse -10 -23 9.36073 0.145
NP_439990.1_5 Forward -29 -16 7.59077 0.19
NP_442690.1_1 Forward -250 -231 -7.37537 0.174
NP_442690.1_1 Reverse -181 -200 -10.9153 0.22
NP_442911.1_2 Forward -34 -15 10.3242 0.0151
NP_442911.1_2 Reverse -5 -24 2.75272 0.0485
NP_440496.1_5 Forward -359 -340 12.5568 0.224
NP_441099.1_5 Reverse -5 -24 -11.1119 0.271
NP_442002.1_9 Reverse -14 -21 14.1004 0.074
NP_441654.1_5 Reverse -153 -172 15.2693 0.239
NP_440809.1_9 Reverse -6 -24 -8.04399 0.225
NP_441294.1_7 Reverse -11 -25 11.1704 0.153
NP_441000.1_6 Forward -25 -11 -3.44199 0.221
NP_440147.1_4 Forward -26 -13 19.2922 0.00305
NP_440147.1_4 Reverse -13 -26 10.639 0.0355
NP_440147.1_4 Reverse -139 -152 8.18076 0.0546
NP_440147.1_4 Forward -320 -307 2.77255 0.202
NP_441175.1_7 Reverse -15 -34 21.0423 0.0195
NP_441550.1_8 Reverse -13 -23 18.1707 0.00754
NP_441550.1_8 Forward -26 -16 14.6309 0.0132
NP_441916.1_7 Forward -24 -14 16.893 0.00407
NP_441916.1_7 Reverse -15 -25 10.3048 0.0261
NP_441916.1_7 Forward -150 -140 6.66654 0.0875
NP_441916.1_10 Forward -332 -313 3.24438 0.236
NP_440206.1_9 Reverse -60 -79 9.14423 0.272
NP_441041.1_7 Reverse -12 -24 20.245 0.00277
NP_442396.1_5 Forward -28 -15 21.1604 0.00421
NP_441725.1_5 Forward -23 -13 11.7798 0.0247
NP_441725.1_5 Reverse -16 -26 2.04498 0.115
NP_441406.1_5 Forward -350 -331 9.63589 0.221
NP_439966.1_7 Reverse -13 -23 8.63269 0.132
NP_439966.1_7 Forward -26 -16 7.25606 0.15
NP_442941.1_3 Reverse -16 -26 11.0914 0.0116
NP_442941.1_3 Forward -23 -13 10.6981 0.0116
NP_440289.1_2 Reverse -12 -25 21.9471 0.00262
NP_440289.1_2 Forward -27 -14 -2.144 0.251
NP_440260.1_8 Reverse -73 -91 3.75572 0.16
NP_442281.1_1 Reverse -10 -24 11.2087 0.0497
NP_442281.1_1 Forward -29 -15 8.25877 0.0832
NP_442281.1_1 Forward -323 -309 2.26061 0.272
NP_441079.1_7 Forward -202 -183 -1.67294 0.206
NP_441079.1_7 Reverse -162 -181 -5.99948 0.269
NP_440177.1_9 Forward -32 -13 10.7175 0.299
NP_442256.1_2 Reverse -13 -31 2.28076 0.107
NP_440647.1_9 Reverse -13 -31 5.42735 0.23
NP_442012.1_2 Forward -26 -7 3.93269 0.218
NP_442982.1_5 Reverse -42 -61 3.44104 0.209
NP_441644.1_6 Reverse -15 -25 17.3841 0.00127
NP_441644.1_6 Forward -24 -14 15.7125 0.0048
NP_442215.1_2 Forward -26 -10 6.64671 0.0702
NP_442215.1_2 Reverse -13 -29 -3.57971 0.218
NP_442247.1_8 Reverse -139 -153 13.0776 0.247
NP_440253.1_2 Forward -24 -6 2.37909 0.139
NP_440929.1_8 Forward -24 -15 19.2726 0.000701
NP_440929.1_8 Reverse -15 -24 19.2726 0.000701
NP_442933.1_6 Forward -246 -227 12.9387 0.287
NP_442933.1_10 Forward -24 -15 17.601 0.00325
NP_442933.1_10 Reverse -15 -24 17.601 0.00325
NP_442933.1_10 Forward -150 -141 5.50626 0.181
NP_441751.2_8 Forward -23 -9 9.14437 0.0325
NP_439922.1_3 Reverse -190 -209 15.135 0.124
NP_442554.1_8 Reverse -16 -26 15.3197 0.00882
NP_442554.1_8 Forward -23 -13 15.123 0.00944
NP_442554.1_8 Forward -149 -139 3.91327 0.203
NP_442970.1_3 Reverse -185 -203 14.7486 0.168
NP_442970.1_3 Reverse -187 -205 13.9956 0.186
NP_441762.1_7 Reverse -14 -26 8.9871 0.0142
NP_441762.1_7 Forward -25 -13 -6.84419 0.284
NP_442142.1_4 Reverse -12 -25 11.9167 0.0504
NP_442292.1_1 Reverse -16 -25 18.486 0.00229
NP_442292.1_1 Forward -23 -14 9.53783 0.0183
NP_442292.1_1 Forward -149 -140 5.60459 0.14
NP_441024.1_6 Forward -208 -189 10.6469 0.219
NP_442476.1_2 Reverse -166 -184 24.1681 0.00669
NP_442476.1_6 Reverse -16 -30 10.7177 0.0635
NP_442476.1_6 Forward -23 -9 3.93283 0.153
NP_443009.1_2 Reverse -17 -36 -0.000545616 0.216
NP_443009.1_5 Forward -25 -14 15.7911 0.0107
NP_443009.1_5 Reverse -14 -25 11.1696 0.066
NP_440125.1_1 Forward -235 -216 9.14423 0.168
NP_442301.1_1 Forward -197 -178 3.93269 0.297
NP_442092.1_6 Forward -53 -34 14.4533 0.195
NP_441715.1_4 Forward -23 -13 9.81313 0.097
NP_441715.1_4 Reverse -16 -26 7.94484 0.107
NP_440464.1_10 Reverse -16 -26 13.0082 0.169
NP_441468.1_1 Forward -23 -16 15.8704 0.0124
NP_441468.1_1 Reverse -16 -23 15.8704 0.0124
NP_441673.1_1 Forward -24 -15 20.8459 0.000698
NP_441673.1_1 Reverse -15 -24 20.8459 0.000698
NP_440286.1_1 Forward -328 -310 15.7521 0.107
NP_441826.1_2 Forward -30 -16 -3.34366 0.284
NP_441330.1_9 Forward -324 -305 14.4541 0.199
NP_442868.1_6 Reverse -13 -23 18.5646 0.0104
NP_442868.1_6 Forward -26 -16 9.81313 0.038
NP_441612.1_2 Reverse -15 -25 8.54929 0.21
NP_442427.1_8 Reverse -6 -25 22.4189 0.012
NP_442427.1_8 Forward -33 -14 14.8474 0.104
NP_442808.1_1 Reverse -14 -24 8.73102 0.0481
NP_442808.1_1 Forward -25 -15 8.63269 0.0481
NP_442775.1_6 Forward -392 -373 10.2259 0.277
NP_440145.1_3 Forward -34 -15 -5.70374 0.275
NP_442542.1_2 Reverse -13 -26 10.049 0.131
NP_442050.1_5 Reverse -13 -23 13.6475 0.0295
NP_442050.1_5 Forward -26 -16 7.64939 0.243
NP_442050.1_5 Forward -152 -142 7.45273 0.256
NP_440558.1_2 Reverse -48 -67 -2.45882 0.227
NP_440558.1_2 Reverse -306 -325 -3.44213 0.236
NP_441878.1_6 Reverse -14 -24 20.2362 0.0046
NP_441878.1_6 Forward -25 -15 10.4031 0.0176
NP_441036.1_8 Reverse -14 -24 8.4365 0.174
NP_441036.1_8 Forward -25 -15 8.33817 0.174
NP_441557.1_5 Forward -24 -15 19.9609 0.000699
NP_441557.1_5 Reverse -15 -24 19.9609 0.000699
NP_441557.1_5 Reverse -141 -150 -0.885252 0.26
NP_441445.1_1 Reverse -6 -25 8.45592 0.121
NP_442066.2_9 Forward -28 -15 11.1307 0.154
NP_442066.2_9 Reverse -11 -24 10.934 0.154
NP_441739.1_2 Reverse -53 -69 3.89277 0.248
NP_441819.1_5 Forward -205 -186 10.4559 0.261
NP_442444.1_6 Reverse -301 -319 15.3388 0.208
NP_442347.1_2 Reverse -16 -25 12.4878 0.056
NP_442347.1_2 Forward -23 -14 3.34298 0.284
NP_442645.1_2 Forward -32 -13 -3.24547 0.0487
NP_441037.1_4 Reverse -13 -23 9.55921 0.21
NP_441037.1_4 Forward -26 -16 7.9999 0.237
NP_441633.1_3 Forward -26 -13 10.639 0.0286
NP_441633.1_3 Forward -142 -129 -3.22564 0.177
NP_441633.1_3 Reverse -13 -26 -3.71729 0.177
NP_440136.1_2 Forward -23 -16 15.9687 0.0123
NP_440136.1_2 Reverse -16 -23 15.9687 0.0123
NP_441728.2_4 Forward -200 -181 12.0793 0.273
NP_442998.1_5 Forward -153 -143 9.12481 0.252
NP_442998.1_10 Forward -22 -15 15.5754 0.0102
NP_442998.1_10 Reverse -17 -24 15.5754 0.0102
NP_442998.1_10 Forward -148 -141 12.3305 0.0564
NP_440299.1_1 Forward -28 -15 12.9984 0.0319
NP_441799.1_1 Reverse -11 -25 14.5519 0.0228
NP_441799.1_1 Forward -28 -14 9.24208 0.0966
NP_441007.1_10 Forward -29 -16 8.57408 0.112
NP_441007.1_10 Reverse -10 -23 3.16588 0.182
NP_441559.1_8 Reverse -10 -24 -5.70361 0.27
NP_441559.1_8 Reverse -322 -336 -5.9986 0.271
NP_441559.1_8 Forward -66 -52 -7.17857 0.287
NP_440915.1_6 Reverse -11 -25 3.53951 0.101
NP_440915.1_6 Forward -28 -14 1.57289 0.134
NP_441464.1_8 Forward -24 -10 7.86607 0.205
NP_441464.1_8 Reverse -375 -389 4.91614 0.26
NP_442993.1_1 Forward -24 -8 -9.5779 0.188
NP_442386.1_9 Forward -25 -16 13.8639 0.0289
NP_442386.1_9 Reverse -14 -23 6.39082 0.219
NP_440570.1_5 Forward -334 -315 0.0977854 0.258
NP_441340.1_5 Forward -23 -16 15.6737 0.0124
NP_441340.1_5 Reverse -16 -23 15.6737 0.0124
NP_442186.1_9 Reverse -13 -32 3.73603 0.294
NP_442484.1_2 Forward -35 -16 4.62101 0.184
NP_442714.1_7 Reverse -16 -35 -1.96717 0.292
NP_440586.1_8 Forward -23 -16 13.2151 0.026
NP_440586.1_8 Reverse -16 -23 13.2151 0.026
NP_440586.1_8 Forward -105 -98 10.7568 0.128
NP_442251.1_6 Forward -23 -16 15.2804 0.0124
NP_442251.1_6 Reverse -16 -23 15.2804 0.0124
NP_442251.1_6 Forward -149 -142 9.77388 0.162
NP_441262.1_3 Reverse -15 -22 14.7888 0.0223
NP_441262.1_3 Forward -24 -17 14.7888 0.0223
NP_443051.1_1 Reverse -14 -23 18.0926 0.00402
NP_443051.1_1 Forward -25 -16 10.4228 0.00754
NP_443051.1_1 Reverse -140 -149 0.196389 0.213
NP_439984.1_3 Forward -31 -17 15.1419 0.158
NP_439937.1_9 Forward -25 -8 -5.37003 0.157
NP_440836.1_1 Forward -55 -36 6.58763 0.262
NP_440836.1_6 Forward -64 -50 11.406 0.227
NP_440372.1_2 Forward -23 -16 16.3621 0.0124
NP_440372.1_2 Reverse -16 -23 16.3621 0.0124
NP_439977.1_5 Forward -342 -323 0.491109 0.208
NP_441572.1_7 Reverse -9 -28 -6.1954 0.284
NP_442384.1_10 Reverse -15 -28 15.8506 0.00946
NP_442384.1_10 Forward -24 -11 12.2123 0.0296
NP_442262.1_10 Forward -23 -16 14.1988 0.0123
NP_442262.1_10 Reverse -16 -23 14.1988 0.0123
NP_441689.1_5 Forward -26 -16 5.78111 0.197
NP_440344.1_10 Reverse -8 -25 10.4619 0.00708
NP_440531.1_6 Reverse -7 -26 5.70265 0.112
NP_441965.1_10 Reverse -12 -28 8.41667 0.125
NP_440297.1_9 Forward -23 -13 9.61647 0.0917
NP_440297.1_9 Reverse -16 -26 -0.118297 0.282
NP_440350.1_5 Forward -394 -375 -7.08038 0.299
NP_441896.1_3 Reverse -6 -25 -0.590531 0.241
NP_440999.1_9 Reverse -11 -25 8.16106 0.0788
NP_440999.1_9 Forward -319 -305 -0.000409212 0.195
NP_440888.1_2 Reverse -15 -29 9.73373 0.116
NP_440888.1_2 Forward -61 -47 9.34041 0.13
NP_440888.1_2 Forward -24 -10 5.99717 0.254
NP_440237.1_5 Forward -255 -241 16.6169 0.149
NP_442277.1_4 Reverse -57 -76 3.44025 0.224
NP_442033.1_10 Forward -63 -44 -9.14533 0.212
NP_442077.1_9 Forward -380 -361 -5.99873 0.288
NP_441543.1_2 Reverse -16 -25 16.9127 0.00359
NP_441543.1_2 Forward -23 -14 9.34117 0.0818
NP_442845.1_2 Forward -30 -16 7.76774 0.195
NP_442710.1_7 Reverse -184 -203 -5.97332 0.294
NP_442710.1_7 Reverse -219 -238 -8.18384 0.299
NP_441469.1_8 Reverse -14 -23 13.3727 0.073
NP_441469.1_8 Forward -25 -16 6.48957 0.227
NP_443064.1_6 Forward -24 -14 13.8273 0.0796
NP_443064.1_6 Reverse -15 -25 12.5669 0.0796
NP_443064.1_6 Reverse -109 -119 11.7912 0.119
NP_442578.1_7 Forward -23 -16 14.5921 0.026
NP_442578.1_7 Reverse -16 -23 14.5921 0.026
NP_442578.1_7 Reverse -142 -149 5.25066 0.251
NP_441462.1_2 Forward -24 -14 20.1379 0.000967
NP_441462.1_2 Reverse -15 -25 11.5831 0.00406
NP_441462.1_2 Reverse -141 -151 -0.0199663 0.177
NP_443062.1_6 Reverse -7 -26 5.60432 0.201
NP_442204.1_2 Reverse -5 -24 6.98095 0.287
NP_442780.1_3 Forward -172 -153 9.97848 0.221
NP_440516.1_2 Reverse -9 -27 3.06741 0.158
NP_440516.1_8 Forward -24 -15 16.9127 0.00442
NP_440516.1_8 Reverse -15 -24 16.9127 0.00442
NP_441785.1_1 Forward -273 -259 11.8657 0.281
NP_442428.1_5 Forward -23 -16 15.8704 0.0124
NP_442428.1_5 Reverse -16 -23 15.8704 0.0124
NP_442859.1_6 Forward -323 -304 2.85027 0.253
NP_440673.1_3 Forward -22 -15 12.4288 0.0426
NP_440673.1_3 Reverse -17 -24 12.4288 0.0426
NP_440673.1_3 Reverse -311 -318 8.29892 0.221
NP_440673.1_7 Reverse -17 -36 2.65439 0.222
NP_441052.1_2 Reverse -15 -25 19.9412 0.00106
NP_441052.1_2 Forward -24 -14 10.4031 0.0285
NP_442219.1_9 Reverse -16 -25 17.7976 0.00718
NP_442219.1_9 Forward -23 -14 8.25953 0.0681
NP_440436.1_4 Reverse -16 -25 17.2072 0.00233
NP_440436.1_4 Forward -23 -14 15.9289 0.00508
NP_441884.1_9 Reverse -12 -31 -16.0285 0.138
NP_440314.1_9 Reverse -16 -35 -1.86883 0.14
NP_440314.1_9 Forward -23 -4 -8.85033 0.254
NP_441719.1_4 Forward -23 -16 16.3621 0.0124
NP_441719.1_4 Reverse -16 -23 16.3621 0.0124
NP_441733.1_10 Forward -27 -14 5.32916 0.218
NP_441004.1_4 Forward -294 -284 13.5497 0.216
NP_442366.1_3 Reverse -308 -326 -3.91409 0.26
NP_442366.1_5 Forward -27 -17 15.4175 0.0374
NP_440328.1_4 Forward -30 -11 0.294447 0.256
NP_443054.1_2 Reverse -13 -27 1.47456 0.245
NP_443054.1_2 Forward -26 -12 1.08123 0.251
NP_441966.1_7 Reverse -317 -336 2.9486 0.197
NP_441851.1_6 Forward -199 -180 16.8552 0.131
NP_441851.1_10 Reverse -14 -24 17.4829 0.0027
NP_441851.1_10 Forward -25 -15 15.8113 0.00552
NP_441542.1_4 Forward -390 -376 3.14618 0.291
NP_441668.1_4 Forward -34 -15 17.109 0.0435
NP_442515.1_1 Forward -25 -11 13.8643 0.0278
NP_442515.1_1 Reverse -14 -28 13.2743 0.0278
NP_442709.1_3 Forward -31 -12 6.88262 0.141
NP_442709.1_3 Forward -82 -63 4.62101 0.236
NP_442709.1_4 Forward -238 -219 6.14789 0.19
NP_441046.1_2 Reverse -349 -368 5.89931 0.221
NP_441046.1_2 Forward -35 -16 1.37609 0.256
NP_442689.1_8 Forward -246 -229 -7.23765 0.292
NP_441409.1_6 Reverse -9 -28 -14.2585 0.253
NP_440432.1_9 Forward -23 -8 -3.65835 0.187
NP_440432.1_9 Reverse -16 -31 -3.95334 0.194
NP_440432.1_9 Reverse -116 -131 -5.91996 0.275
NP_440432.1_9 Reverse -142 -157 -6.21495 0.29
NP_440474.1_8 Forward -317 -303 6.88214 0.215
NP_440396.1_10 Forward -317 -301 11.3659 0.186
NP_441477.1_10 Forward -31 -13 1.88744 0.253
NP_440431.1_3 Forward -25 -6 2.75272 0.0928
NP_440431.1_5 Reverse -280 -299 10.0292 0.195
NP_442450.1_5 Reverse -13 -23 10.0098 0.115
NP_442450.1_5 Forward -26 -16 7.55152 0.13
NP_441031.1_1 Forward -201 -182 10.1005 0.205
NP_442237.1_3 Forward -201 -187 16.8182 0.281
NP_440195.1_4 Forward -36 -17 12.2908 0.13
NP_441078.1_4 Forward -24 -15 19.6659 0.0007
NP_441078.1_4 Reverse -15 -24 19.6659 0.0007
NP_442729.1_8 Forward -28 -15 10.639 0.125
NP_442348.1_2 Forward -62 -53 6.68623 0.299
NP_440526.1_3 Forward -23 -12 10.9729 0.0646
NP_440526.1_3 Reverse -16 -27 1.04151 0.267
NP_441432.1_8 Forward -25 -16 16.8143 0.00595
NP_441432.1_8 Reverse -14 -23 8.35786 0.0755
NP_442320.1_8 Forward -30 -16 -4.52363 0.171
NP_442344.1_7 Reverse -16 -35 -6.88371 0.172
NP_441732.1_7 Reverse -17 -36 9.43923 0.298
NP_440760.1_1 Reverse -15 -34 14.8474 0.00699
NP_440760.1_1 Forward -24 -5 -19.5684 0.219
NP_440760.1_7 Forward -229 -210 5.01354 0.211
NP_442797.1_2 Reverse -10 -28 12.1689 0.283
NP_442353.1_4 Forward -50 -31 -0.591301 0.29
NP_440281.1_9 Forward -41 -22 16.5191 0.218
NP_442489.1_2 Forward -329 -310 3.93269 0.227
NP_442489.1_7 Forward -24 -15 20.1576 0.000695
NP_442489.1_7 Reverse -15 -24 20.1576 0.000695
NP_442489.1_7 Forward -150 -141 -2.16355 0.295
NP_440559.1_1 Reverse -16 -25 17.4043 0.00658
NP_440559.1_1 Forward -23 -14 17.306 0.00658
NP_440559.1_1 Reverse -142 -151 4.52295 0.26
NP_441659.2_8 Forward -24 -14 19.3512 0.000966
NP_441659.2_8 Reverse -15 -25 18.1713 0.00133
NP_442749.1_4 Forward -183 -164 14.8474 0.218
NP_441092.1_3 Reverse -17 -36 2.45773 0.19
NP_442913.1_10 Forward -33 -14 -0.197208 0.157
NP_441807.1_5 Forward -35 -16 15.0441 0.11
NP_440315.1_9 Reverse -280 -290 17.7779 0.0679
NP_442346.1_5 Reverse -14 -24 17.9746 0.00128
NP_442346.1_5 Forward -25 -15 16.6963 0.00248
NP_442346.1_5 Forward -319 -309 7.64985 0.162
NP_440352.1_5 Reverse -285 -304 15.1865 0.13
NP_440545.1_3 Reverse -48 -65 -4.77938 0.232
NP_440545.1_3 Forward -28 -11 -5.46769 0.25
NP_441856.1_3 Reverse -12 -31 -0.197208 0.216
NP_440459.1_2 Reverse -281 -298 13.2152 0.131
NP_440459.1_2 Reverse -13 -30 12.3302 0.151
NP_442603.1_7 Reverse -15 -29 10.422 0.126
NP_442603.1_7 Forward -24 -10 7.17714 0.211
NP_441833.1_4 Forward -23 -16 15.9687 0.0124
NP_441833.1_4 Reverse -16 -23 15.9687 0.0124
NP_442162.1_9 Forward -23 -16 16.2637 0.0124
NP_442162.1_9 Reverse -16 -23 16.2637 0.0124
NP_440772.1_6 Reverse -342 -361 16.1257 0.146
NP_442199.1_5 Reverse -7 -26 -2.55715 0.188
NP_442140.1_3 Reverse -16 -26 12.2714 0.0632
NP_442140.1_3 Forward -23 -13 11.5831 0.0743
NP_441671.1_10 Forward -342 -323 3.83436 0.219
NP_440875.1_9 Forward -22 -12 7.59334 0.255
NP_440875.1_9 Reverse -324 -334 6.81464 0.297
NP_441813.1_5 Reverse -13 -23 18.3679 0.00743
NP_441813.1_5 Forward -26 -16 8.63316 0.0367
NP_441813.1_9 Reverse -230 -249 14.6508 0.222
NP_440594.1_8 Forward -23 -10 12.1134 0.152
NP_440590.1_4 Reverse -16 -29 7.88576 0.0493
NP_440590.1_4 Forward -23 -10 4.93583 0.0585
NP_440567.1_1 Reverse -16 -30 4.12949 0.129
NP_440567.1_1 Forward -23 -9 0.196253 0.254
NP_442497.1_10 Forward -23 -14 19.8626 0.00532
NP_442497.1_10 Reverse -16 -25 10.4228 0.0087
NP_440821.1_4 Reverse -13 -23 10.9931 0.0146
NP_440821.1_4 Forward -26 -16 9.41981 0.0286
NP_440227.1_6 Forward -204 -190 16.7227 0.212
NP_441239.1_9 Reverse -13 -25 12.6253 0.0446
NP_441239.1_9 Forward -26 -14 6.92215 0.173
NP_442270.1_9 Forward -329 -310 4.32602 0.131
NP_440219.1_1 Reverse -186 -205 15.7062 0.158
NP_441541.1_1 Reverse -179 -197 6.49544 0.153
NP_441541.1_1 Forward -207 -189 -0.952934 0.237
NP_440546.1_4 Forward -24 -14 12.8578 0.0572
NP_440546.1_4 Reverse -15 -25 10.046 0.109
NP_440462.1_6 Reverse -13 -23 9.7148 0.0429
NP_440462.1_6 Forward -26 -16 1.35667 0.294
NP_440868.1_4 Forward -28 -16 8.10212 0.0602
NP_440868.1_4 Reverse -11 -23 3.38223 0.136
NP_441582.1_5 Reverse -50 -69 3.34192 0.266
NP_441868.1_1 Reverse -186 -205 10.4559 0.261
NP_440812.1_4 Reverse -47 -66 17.6481 0.198
NP_442402.1_4 Forward -146 -127 -2.16459 0.195
NP_442402.1_4 Forward -126 -107 -10.1294 0.297
NP_441084.1_6 Reverse -13 -27 14.7737 0.0972
NP_442039.1_4 Forward -23 -16 15.1821 0.0124
NP_442039.1_4 Reverse -16 -23 15.1821 0.0124
NP_440825.1_7 Reverse -16 -26 12.9096 0.152
NP_442837.1_3 Forward -23 -16 15.7721 0.0124
NP_442837.1_3 Reverse -16 -23 15.7721 0.0124
NP_442053.1_1 Forward -24 -15 18.3876 0.0007
NP_442053.1_1 Reverse -15 -24 18.3876 0.0007
NP_440505.1_3 Reverse -13 -23 9.61647 0.122
NP_440505.1_3 Forward -26 -16 9.22315 0.122
NP_441408.2_7 Reverse -307 -326 1.67108 0.215
NP_440914.1_1 Reverse -15 -25 17.5935 0.000537
NP_440914.1_1 Forward -318 -308 10.079 0.158
NP_440914.1_1 Forward -24 -14 8.51751 0.186
NP_440914.1_7 Reverse -234 -253 4.72643 0.29
NP_441011.1_8 Forward -23 -14 14.356 0.0249
NP_441011.1_8 Forward -383 -374 9.14451 0.135
NP_441011.1_8 Reverse -16 -25 8.25953 0.144
NP_442101.1_10 Forward -32 -13 -9.24366 0.245
NP_442533.1_6 Forward -24 -15 17.2076 0.00137
NP_442533.1_6 Reverse -15 -24 17.2076 0.00137
NP_442322.1_4 Reverse -64 -81 6.42963 0.162
NP_440854.1_1 Reverse -212 -231 10.7424 0.152
NP_440854.1_5 Reverse -194 -208 14.5264 0.274
NP_442229.1_1 Forward -26 -12 7.07881 0.198
NP_441482.1_7 Reverse -9 -23 -10.4235 0.209
NP_441482.1_7 Forward -30 -16 -10.7185 0.213
NP_439944.1_9 Reverse -16 -26 10.5014 0.0887
NP_439944.1_9 Forward -23 -13 8.82982 0.101
NP_441697.1_5 Forward -315 -296 -9.40638 0.268
NP_441028.1_6 Forward -56 -46 5.68278 0.243
NP_440116.1_8 Reverse -16 -35 -6.29373 0.205
NP_440116.1_8 Forward -23 -4 -6.39206 0.208
NP_441527.1_4 Reverse -285 -304 -12.1756 0.285
NP_441527.1_4 Forward -205 -186 -12.9396 0.296
NP_440115.1_6 Reverse -12 -22 7.15819 0.158
NP_440007.1_9 Reverse -11 -25 7.86607 0.195
NP_441106.1_1 Reverse -14 -23 9.73449 0.0311
NP_441106.1_1 Forward -25 -16 9.63616 0.0311
NP_442588.1_10 Forward -391 -372 18.584 0.169
NP_442306.1_10 Reverse -136 -155 -12.0953 0.161
NP_442306.1_10 Reverse -10 -29 -19.3717 0.197
NP_441286.1_1 Forward -25 -13 15.4769 0.00418
NP_441286.1_1 Reverse -14 -26 3.48056 0.0467
NP_440670.1_8 Forward -24 -15 18.3876 0.000699
NP_440670.1_8 Reverse -15 -24 18.3876 0.000699
NP_440886.1_7 Reverse -14 -24 8.04271 0.0805
NP_440886.1_7 Forward -25 -15 7.94438 0.0805
NP_442614.1_2 Forward -24 -10 16.1259 0.0715
NP_442614.1_2 Reverse -15 -29 8.06273 0.255
NP_442072.1_9 Reverse -14 -32 -11.9772 0.0799
NP_440907.2_8 Forward -23 -13 9.91099 0.103
NP_440907.2_8 Reverse -16 -26 7.64939 0.117
NP_440907.2_8 Reverse -142 -152 4.10949 0.278
NP_439999.1_8 Reverse -60 -79 14.4533 0.236
NP_441626.1_2 Forward -23 -16 15.7721 0.0124
NP_441626.1_2 Reverse -16 -23 15.7721 0.0124
NP_442794.1_1 Forward -28 -16 9.28209 0.0795
NP_442615.1_1 Reverse -6 -24 3.55906 0.0536
NP_442615.1_1 Forward -33 -15 -3.81576 0.17
NP_442615.1_1 Reverse -132 -150 -5.19239 0.206
NP_441962.1_4 Forward -323 -304 -11.2103 0.238
NP_440387.1_1 Reverse -15 -31 11.1699 0.018
NP_441431.1_2 Reverse -12 -26 15.6336 0.045
NP_441836.1_2 Reverse -9 -28 -3.83545 0.244
NP_440814.1_4 Reverse -132 -151 -3.24547 0.144
NP_440814.1_4 Reverse -6 -25 -9.83364 0.221
NP_440114.1_10 Forward -24 -10 15.5359 0.0249
NP_442437.1_3 Reverse -17 -36 11.6017 0.193
NP_441510.2_7 Reverse -378 -392 10.0287 0.281
NP_440293.1_9 Forward -76 -62 11.7308 0.257
NP_440422.1_10 Forward -248 -229 6.72539 0.245
NP_440422.1_10 Forward -372 -353 6.33814 0.245
NP_441237.1_9 Reverse -16 -26 14.828 0.0242
NP_442743.1_8 Reverse -191 -210 8.73148 0.255
NP_439910.1_2 Reverse -7 -24 -12.7442 0.0944
NP_439910.1_2 Forward -158 -141 -22.6756 0.285
NP_440457.1_1 Reverse -11 -23 9.08543 0.0967
NP_441984.1_3 Reverse -11 -29 4.83737 0.3
NP_442509.1_9 Forward -24 -14 17.3841 0.00128
NP_442509.1_9 Reverse -15 -25 8.14104 0.192
NP_442936.1_10 Forward -207 -193 8.30683 0.269
NP_442514.1_5 Forward -146 -127 -7.3761 0.276
NP_440554.1_4 Forward -23 -13 8.82982 0.0646
NP_441885.1_5 Reverse -15 -25 20.9245 0.000538
NP_441885.1_5 Forward -24 -14 11.3864 0.00668
NP_440478.1_10 Forward -49 -35 7.37441 0.262
NP_442341.1_7 Reverse -14 -28 11.406 0.0555
NP_442341.1_7 Reverse -108 -122 7.17775 0.11
NP_442341.1_7 Forward -25 -11 6.19444 0.134
NP_440409.1_1 Forward -32 -13 0.58944 0.209
NP_443000.1_7 Reverse -13 -23 11.6814 0.0344
NP_443000.1_7 Forward -26 -16 10.3048 0.0345
NP_440275.1_3 Reverse -13 -23 16.9913 0.0133
NP_440275.1_3 Forward -26 -16 8.04317 0.0602
NP_440312.1_8 Forward -183 -164 7.49852 0.271
NP_442354.1_7 Reverse -12 -31 4.62101 0.281
NP_441359.1_5 Forward -121 -102 0.196116 0.299
NP_442451.1_2 Forward -32 -13 -6.88371 0.232
NP_441635.1_2 Forward -196 -177 9.59652 0.285
NP_440149.1_8 Reverse -15 -34 -3.24547 0.185
NP_441105.1_3 Reverse -4 -23 7.27595 0.0557
NP_440216.1_1 Forward -24 -10 8.35772 0.0061
NP_440216.1_1 Reverse -15 -29 -0.787057 0.0284
NP_440216.1_1 Forward -75 -61 -12.3901 0.264
NP_440216.1_9 Reverse -292 -301 6.39124 0.289
NP_440172.1_1 Forward -24 -14 16.303 0.00854
NP_440172.1_1 Reverse -15 -25 15.0247 0.00945
NP_440172.1_1 Reverse -141 -151 6.96153 0.0959
NP_442015.1_10 Reverse -11 -24 3.65753 0.178
NP_442015.1_10 Forward -28 -15 1.39592 0.204
NP_441226.1_7 Forward -23 -16 14.4934 0.0123
NP_441226.1_7 Reverse -16 -23 14.4934 0.0123
NP_441111.1_7 Forward -23 -15 18.7023 0.00294
NP_441111.1_7 Reverse -16 -24 18.7023 0.00294
NP_441766.1_2 Forward -24 -15 17.5026 0.00297
NP_441766.1_2 Reverse -15 -24 17.5026 0.00297
NP_441766.1_2 Reverse -141 -150 4.32629 0.187
NP_440416.1_9 Reverse -59 -78 -6.58872 0.0913
NP_440416.1_9 Forward -31 -12 -17.1101 0.231
NP_442116.1_6 Reverse -187 -204 12.9436 0.172
NP_442116.1_6 Reverse -186 -203 9.69683 0.227
NP_442116.1_6 Forward -202 -185 9.12387 0.235
NP_442116.1_6 Forward -235 -218 8.26445 0.254
NP_440261.1_5 Forward -23 -10 14.6706 0.0199
NP_440261.1_5 Reverse -16 -29 -0.865694 0.0655
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TAGGTTATGCTTTTGGTGTTATGGCTGGAATCTTTATTGTCAATAATTTCTCCACTAATGTTCAGGACAAGCCCTTGGAATTAGCAATGACCTCAATATTTTTCTTTGGCCCATTGGGAGCTTTGATAGGATTCACTATTGCAGTTGTATATCAACTTTTACATCAATATTTATGAGTTCTTTATATCCCTGATAAAAAATATGTTTAAAAAATCTTAATTGGATCTTTGAAATATATGATTGATTATGGATAGATCGCCTACAATATCCCCAATGCACGATGGTAATCCACGGTGCCATCAAATATAGACCCCACAGAAAGCCGGGCTTTAGCTGGGCGGACTTTGCCTCCCATCAGTAGCCAGCAAGAACTTTTGGCGATCGCCCGTAAAATTTGAGT

CDS

ATGTTCGATAATCTGTGCAAATTTCTAGCTGAATCATTTTCCGAAGACTATGCCGCCTGGTTGTTGGGACGACCAATCAAATTGACCAAGCTCAGTCCGACGGAATTATCCCTGGAACCAATTCGCGCTGACTCCCTGATTTTGGAGCAATCGGAAGACTTGGTTTTACATCTGGAATTCCAAACGGAACCTGACCCCACCATGGGTTTTCGGATGTTGGATTATCGGGTAAGGGTTTACCGCCGTTTCCCCCAGAAGACAATGCACCAATTCGTGATCTACCTGAAACATAGTAACAATGACTTGGTTTATCAGGATAGTTTTCAGGTGGGGGAGACTGTGCATCGTTACCAAGCGATTCGGCTCTGGGAACAATCATCGGACGCATTTCTCCAAAGCCCAGGGCTATTGCCCCTAGCGGTATTGACGCAGACCTCTGACCCTACATTAAAATTGAGGGAAGTGGCGACTGTGCTGGAACAGATTGAGGATAATCGAGTTAAAGCAAATCTCATGGCAGCAACTTCTGTTTTTGGAGGAATTCTGTTGTCGCCTGACATTATCAAGACAATTTTAAGGAGTGAAATTATGAAGGAATCCGCTGTTTATCAAGAAATTTTAGAGGAGGGTAAAATTGCTGGGAAACTAGAGGGAAAATTAGAAACCATACCCCTGTTGAAGAAATTAGGTCTTACAATTGCCGAAATTGCCAAGGAATTAGATATTGATGTTGAACTGGTTAATCGGTTTGTTGCTAACCAGAATAATTAA

Protein

No sequence available