Your browser is old and dusty. Try Google Chrome!

Details for sll6060

ORF sll6060
Accession NP_942503.1
Symbol
Category Other
Definition probable acetyltransferase
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -235 -249 -2.16369 0.285
NP_440795.1_7 Forward -298 -291 5.74231 0.279
NP_440815.1_2 Reverse -168 -182 10.5204 0.265
NP_442291.1_5 Reverse -289 -305 -2.30141 0.215
NP_440897.1_6 Reverse -118 -137 -4.72118 0.288
NP_441453.1_4 Reverse -290 -298 6.90259 0.121
NP_441453.1_4 Forward -299 -291 6.70593 0.121
NP_441818.1_9 Forward -252 -233 2.45773 0.186
NP_440226.1_1 Forward -299 -280 3.83436 0.212
NP_441976.1_2 Forward -170 -151 15.0432 0.257
NP_442173.1_1 Reverse -291 -299 11.7208 0.034
NP_442173.1_1 Forward -298 -290 7.49257 0.171
NP_443027.1_4 Forward -301 -291 11.0914 0.107
NP_440784.1_7 Reverse -291 -298 6.43063 0.218
NP_440784.1_7 Forward -298 -291 6.23397 0.241
NP_442861.1_1 Reverse -273 -292 11.8975 0.277
NP_440061.1_9 Forward -301 -287 9.14375 0.151
NP_440110.1_4 Forward -310 -291 3.83436 0.213
NP_442062.1_8 Forward -299 -289 7.25653 0.104
NP_442062.1_8 Reverse -290 -300 5.28991 0.176
NP_441859.1_3 Reverse -234 -253 4.12856 0.228
NP_442242.1_4 Reverse -291 -298 13.3138 0.027
NP_440044.1_8 Reverse -291 -310 -2.16383 0.261
NP_439918.1_2 Reverse -31 -50 -2.95047 0.251
NP_441208.1_9 Reverse -222 -236 7.27608 0.223
NP_442375.1_5 Reverse -243 -257 12.5853 0.289
NP_441925.1_5 Forward -322 -308 19.8624 0.0337
NP_441083.1_5 Reverse -290 -300 8.23984 0.0429
NP_441083.1_5 Forward -299 -289 1.16001 0.215
NP_441738.1_2 Reverse -292 -299 13.3134 0.0335
NP_441645.1_1 Forward -345 -326 11.11 0.191
NP_440209.1_1 Forward -299 -291 8.27922 0.0687
NP_442445.1_2 Forward -366 -347 8.45592 0.288
NP_441163.1_4 Reverse -159 -178 11.6619 0.297
NP_441533.1_1 Reverse -342 -361 12.5858 0.252
NP_440343.1_3 Forward -133 -115 3.8533 0.266
NP_440906.1_5 Reverse -291 -298 6.52896 0.199
NP_440906.1_5 Forward -298 -291 6.0373 0.262
NP_440747.1_10 Forward -302 -290 6.92215 0.012
NP_440747.1_10 Reverse -287 -299 -11.9574 0.178
NP_441486.1_1 Reverse -287 -301 -5.11362 0.222
NP_442634.1_4 Forward -301 -287 -4.52363 0.206
NP_442634.1_4 Reverse -55 -69 -5.40861 0.253
NP_443018.1_3 Reverse -236 -243 9.38056 0.128
NP_443018.1_3 Reverse -291 -298 5.15232 0.226
NP_443018.1_3 Forward -298 -291 5.05399 0.238
NP_441634.1_8 Forward -301 -287 -2.16369 0.295
NP_441182.1_5 Forward -258 -239 8.84924 0.222
NP_440376.1_1 Reverse -290 -299 0.196389 0.283
NP_440376.1_1 Forward -299 -290 -0.196935 0.285
NP_441797.1_7 Forward -209 -191 10.6389 0.286
NP_442530.1_2 Reverse -342 -352 11.2881 0.284
NP_440642.1_10 Forward -207 -193 2.35894 0.277
NP_440642.1_10 Forward -180 -166 2.35894 0.277
NP_441855.2_4 Forward -174 -155 11.0656 0.231
NP_442205.1_9 Forward -107 -91 2.71347 0.206
NP_440800.1_2 Forward -284 -265 13.6108 0.299
NP_442937.1_5 Forward -304 -285 7.27595 0.258
NP_441958.1_5 Forward -300 -290 1.16001 0.114
NP_442836.1_5 Reverse -284 -303 6.78429 0.171
NP_440203.1_5 Forward -231 -221 10.8943 0.209
NP_440984.1_7 Forward -241 -227 6.19444 0.224
NP_442690.1_1 Reverse -366 -385 -14.7502 0.273
NP_442690.1_1 Forward -327 -308 -16.0285 0.283
NP_442911.1_2 Reverse -280 -299 10.1275 0.0155
NP_440858.1_1 Reverse -267 -286 -5.70374 0.281
NP_442064.1_1 Forward -184 -165 -10.227 0.259
NP_443055.1_3 Forward -243 -224 11.3136 0.26
NP_442438.1_10 Reverse -285 -299 1.17956 0.204
NP_440147.1_4 Forward -301 -288 12.999 0.0326
NP_441550.1_8 Forward -301 -291 5.28945 0.255
NP_441916.1_7 Reverse -290 -300 1.25834 0.289
NP_439966.1_4 Reverse -274 -293 5.01433 0.293
NP_439966.1_7 Forward -301 -291 5.68278 0.214
NP_442941.1_3 Reverse -291 -301 9.81313 0.0263
NP_442941.1_3 Forward -298 -288 -1.10161 0.284
NP_440983.1_5 Reverse -228 -247 -6.58872 0.278
NP_442281.1_1 Forward -304 -290 12.2903 0.0385
NP_441079.1_7 Forward -337 -318 -3.63955 0.238
NP_441644.1_6 Reverse -235 -245 9.51767 0.0747
NP_441644.1_6 Reverse -290 -300 5.28945 0.199
NP_442215.1_2 Reverse -226 -242 -2.49807 0.198
NP_442215.1_2 Reverse -161 -177 -6.03799 0.263
NP_442029.1_6 Forward -255 -236 6.39097 0.238
NP_442247.1_8 Forward -301 -287 10.0294 0.247
NP_440780.1_1 Forward -338 -319 8.35512 0.274
NP_442933.1_10 Reverse -290 -299 7.96454 0.0937
NP_442933.1_10 Forward -299 -290 7.76787 0.11
NP_441751.2_8 Reverse -291 -305 -3.24533 0.137
NP_442554.1_8 Reverse -291 -301 13.5497 0.018
NP_442554.1_8 Forward -243 -233 9.61647 0.0576
NP_442142.1_4 Forward -302 -289 2.18201 0.299
NP_442292.1_1 Reverse -291 -300 16.421 0.00748
NP_442292.1_1 Forward -298 -289 -0.295266 0.24
NP_441715.1_4 Reverse -291 -301 16.1063 0.0144
NP_441198.1_4 Reverse -37 -56 8.84924 0.276
NP_440379.1_5 Forward -253 -234 -8.94866 0.257
NP_441468.1_1 Reverse -291 -298 13.0188 0.0383
NP_441468.1_1 Forward -298 -291 6.0373 0.223
NP_439939.1_4 Forward -189 -170 1.67108 0.199
NP_441673.1_1 Reverse -290 -299 1.37636 0.114
NP_441673.1_1 Forward -299 -290 1.1797 0.163
NP_441330.1_1 Reverse -152 -171 -15.3402 0.275
NP_442868.1_6 Forward -301 -291 9.61647 0.0429
NP_440789.1_8 Reverse -132 -151 13.2741 0.28
NP_442050.1_5 Reverse -288 -298 12.1726 0.0699
NP_442342.1_9 Reverse -233 -249 8.02334 0.194
NP_440334.1_1 Reverse -257 -276 13.7982 0.298
NP_440334.1_2 Forward -105 -92 13.6873 0.298
NP_440346.1_6 Forward -331 -321 13.5642 0.291
NP_440274.1_2 Forward -209 -195 12.9786 0.236
NP_441878.1_6 Forward -245 -235 0.668351 0.139
NP_441100.1_1 Reverse -347 -366 11.7992 0.255
NP_441036.1_8 Reverse -289 -299 6.56821 0.225
NP_441557.1_5 Forward -299 -290 8.84951 0.0343
NP_441557.1_5 Reverse -290 -299 0.786375 0.106
NP_441433.1_8 Reverse -143 -162 -4.32711 0.294
NP_441308.1_8 Forward -129 -119 9.02648 0.236
NP_442347.1_2 Reverse -291 -300 5.50626 0.229
NP_441633.1_3 Forward -301 -288 -6.17557 0.238
NP_440136.1_2 Reverse -291 -298 6.52896 0.116
NP_440136.1_2 Forward -298 -291 6.13563 0.193
NP_442590.1_10 Reverse -228 -247 7.86593 0.218
NP_442998.1_5 Reverse -175 -185 11.7798 0.176
NP_442998.1_5 Reverse -342 -352 11.3864 0.187
NP_442998.1_5 Reverse -208 -218 9.32148 0.243
NP_442998.1_10 Reverse -292 -299 12.3305 0.0564
NP_440299.1_1 Forward -303 -290 7.88518 0.103
NP_441799.1_1 Reverse -286 -300 13.077 0.0362
NP_441270.1_5 Reverse -39 -58 15.4341 0.191
NP_442158.1_4 Forward -181 -171 12.3697 0.253
NP_441866.1_6 Forward -213 -194 13.9616 0.159
NP_441866.1_6 Forward -181 -162 7.57013 0.271
NP_441704.1_2 Forward -339 -320 7.07848 0.256
NP_440215.1_6 Forward -309 -290 15.6332 0.228
NP_440695.1_6 Forward -166 -152 11.5748 0.265
NP_442386.1_9 Reverse -234 -243 8.35743 0.201
NP_442386.1_9 Reverse -289 -298 5.50585 0.25
NP_441340.1_5 Reverse -291 -298 5.93897 0.198
NP_441340.1_5 Forward -298 -291 5.84064 0.208
NP_441340.1_9 Reverse -314 -324 15.1001 0.194
NP_441340.1_9 Reverse -174 -184 8.15881 0.256
NP_440161.1_3 Reverse -288 -307 8.25926 0.273
NP_442251.1_6 Reverse -291 -298 13.0188 0.0408
NP_443051.1_1 Forward -300 -291 0.589713 0.143
NP_439937.1_9 Reverse -234 -251 -1.53514 0.124
NP_441595.1_2 Reverse -339 -352 9.80195 0.277
NP_440439.1_1 Forward -104 -91 -0.964025 0.244
NP_439943.1_2 Forward -230 -211 11.2092 0.251
NP_440372.1_2 Reverse -291 -298 6.62729 0.151
NP_440372.1_2 Forward -298 -291 6.52896 0.188
NP_441138.1_5 Reverse -325 -338 3.97694 0.297
NP_440210.1_10 Forward -214 -195 4.22689 0.296
NP_442384.1_10 Reverse -290 -303 2.37923 0.228
NP_441877.1_5 Reverse -287 -306 -1.18052 0.283
NP_442262.1_10 Reverse -291 -298 10.6589 0.14
NP_442262.1_10 Reverse -236 -243 9.47889 0.187
NP_441689.1_5 Reverse -288 -298 5.58445 0.23
NP_440531.1_6 Reverse -149 -168 4.32602 0.127
NP_440297.1_9 Reverse -236 -246 -0.0199663 0.282
NP_442378.1_1 Forward -381 -364 16.4601 0.22
NP_440894.1_10 Reverse -223 -242 5.11266 0.238
NP_440999.1_9 Reverse -286 -300 1.37622 0.166
NP_440888.1_2 Forward -299 -285 8.84875 0.145
NP_440888.1_2 Reverse -290 -304 6.68548 0.223
NP_442033.1_10 Forward -236 -217 -11.9969 0.261
NP_442033.1_10 Reverse -233 -252 -14.2585 0.298
NP_441543.1_2 Reverse -291 -300 7.17789 0.131
NP_441543.1_2 Forward -298 -289 4.22796 0.267
NP_442845.1_2 Reverse -284 -298 7.27608 0.195
NP_442578.1_7 Forward -298 -291 5.15232 0.291
NP_440148.1_1 Forward -386 -367 2.94938 0.186
NP_441462.1_2 Forward -299 -289 0.766681 0.125
NP_441621.1_3 Forward -371 -353 13.8838 0.186
NP_440939.1_5 Reverse -154 -170 11.7599 0.272
NP_440516.1_8 Forward -299 -290 -0.393597 0.255
NP_442428.1_5 Reverse -291 -298 6.3323 0.193
NP_442428.1_5 Forward -298 -291 6.13563 0.209
NP_441052.1_2 Forward -234 -224 2.24165 0.213
NP_441052.1_2 Reverse -290 -300 2.04498 0.22
NP_441052.1_2 Forward -299 -289 0.766681 0.256
NP_442219.1_9 Forward -298 -289 8.84951 0.0681
NP_442219.1_9 Reverse -291 -300 8.25953 0.0681
NP_440436.1_4 Reverse -291 -300 7.47246 0.129
NP_440436.1_4 Forward -298 -289 6.29249 0.164
NP_441884.1_2 Reverse -254 -268 19.0145 0.132
NP_441884.1_7 Forward -382 -369 17.0299 0.265
NP_441719.1_2 Forward -182 -168 13.4445 0.286
NP_441719.1_4 Reverse -291 -298 6.62729 0.151
NP_441719.1_4 Forward -298 -291 6.52896 0.188
NP_442813.1_4 Reverse -351 -370 -7.76869 0.299
NP_441231.1_3 Forward -351 -332 11.995 0.261
NP_442366.1_5 Reverse -115 -125 10.4026 0.271
NP_442695.1_3 Forward -175 -161 18.0918 0.179
NP_441851.1_10 Forward -300 -290 7.55152 0.137
NP_442515.1_1 Forward -300 -286 1.96621 0.145
NP_441409.1_6 Reverse -284 -303 -7.67036 0.154
NP_440432.1_9 Reverse -291 -306 -3.56002 0.183
NP_442843.1_1 Reverse -282 -301 -11.5053 0.291
NP_439960.1_10 Reverse -234 -252 -3.71743 0.279
NP_441975.1_5 Forward -359 -340 14.5932 0.184
NP_441078.1_4 Reverse -290 -299 0.196389 0.205
NP_441078.1_4 Forward -299 -290 0.196389 0.205
NP_441432.1_8 Forward -300 -291 7.17789 0.102
NP_442320.1_8 Forward -305 -291 -5.21195 0.209
NP_441732.1_2 Forward -303 -287 -16.4611 0.167
NP_440313.1_5 Forward -47 -29 10.7364 0.294
NP_440760.1_1 Forward -299 -280 -15.4385 0.147
NP_442797.1_9 Reverse -290 -308 14.8671 0.114
NP_441057.1_4 Forward -259 -241 0.805796 0.253
NP_441057.1_4 Forward -188 -170 -4.20908 0.299
NP_442489.1_7 Reverse -290 -299 0.688044 0.152
NP_442489.1_7 Forward -299 -290 0.491382 0.178
NP_440559.1_1 Reverse -291 -300 7.66954 0.0999
NP_440559.1_1 Forward -298 -289 7.66954 0.0999
NP_441659.2_8 Reverse -290 -300 6.17489 0.084
NP_441659.2_8 Reverse -235 -245 1.06167 0.251
NP_439956.1_7 Forward -162 -143 2.16274 0.276
NP_440708.1_5 Forward -301 -282 12.6841 0.0574
NP_441807.1_5 Reverse -279 -298 13.8641 0.117
NP_440335.1_9 Reverse -305 -323 16.4404 0.184
NP_442346.1_5 Forward -300 -290 6.56821 0.198
NP_442346.1_5 Reverse -289 -299 4.89658 0.269
NP_440545.1_3 Forward -248 -231 -3.5994 0.208
NP_442603.1_7 Forward -299 -285 14.6503 0.0613
NP_441888.1_7 Forward -304 -290 2.65453 0.225
NP_441833.1_4 Reverse -291 -298 12.9205 0.0393
NP_441833.1_4 Forward -298 -291 6.13563 0.198
NP_441895.1_2 Reverse -310 -329 -18.0934 0.234
NP_442162.1_9 Reverse -291 -298 6.52896 0.178
NP_442162.1_9 Forward -298 -291 6.43063 0.208
NP_440788.1_8 Reverse -121 -140 9.93088 0.286
NP_440224.1_1 Forward -310 -291 2.3594 0.132
NP_440204.1_9 Forward -315 -296 19.0757 0.12
NP_442140.1_3 Reverse -236 -246 8.92815 0.117
NP_442140.1_3 Forward -298 -288 3.42162 0.297
NP_441813.1_5 Forward -301 -291 8.33817 0.047
NP_440594.1_8 Forward -298 -285 11.5234 0.152
NP_440590.1_4 Forward -298 -285 -6.07724 0.299
NP_442497.1_4 Reverse -166 -185 10.8379 0.271
NP_442497.1_10 Reverse -291 -300 0.688044 0.141
NP_440821.1_4 Reverse -288 -298 -0.314959 0.251
NP_440821.1_4 Forward -301 -291 -0.41329 0.257
NP_440227.1_2 Forward -355 -339 7.04003 0.295
NP_441239.1_9 Reverse -233 -245 12.4287 0.0477
NP_441239.1_9 Forward -246 -234 7.4138 0.161
NP_440156.1_4 Forward -186 -176 11.6809 0.176
NP_441727.1_3 Forward -257 -238 2.45773 0.3
NP_440833.1_6 Reverse -344 -358 13.5686 0.157
NP_440833.1_6 Forward -288 -274 7.96378 0.277
NP_440833.1_6 Reverse -211 -225 7.76712 0.278
NP_440876.1_5 Reverse -371 -390 5.01433 0.283
NP_440354.1_5 Forward -182 -163 7.37428 0.174
NP_441617.1_6 Forward -185 -166 -5.40875 0.274
NP_440546.1_4 Forward -299 -289 8.10685 0.203
NP_442349.1_6 Forward -240 -221 5.01433 0.214
NP_442611.1_1 Forward -249 -230 3.53937 0.208
NP_440868.1_4 Forward -303 -291 4.95553 0.108
NP_440868.1_4 Reverse -286 -298 1.31728 0.186
NP_440401.1_9 Forward -333 -326 14.5917 0.287
NP_441497.1_3 Reverse -169 -188 -11.7019 0.294
NP_440532.1_6 Forward -350 -331 9.0459 0.286
NP_441848.1_7 Reverse -345 -364 4.52188 0.215
NP_441084.1_6 Reverse -187 -201 12.8346 0.152
NP_440696.1_6 Reverse -101 -120 3.24438 0.288
NP_442039.1_4 Reverse -291 -298 11.3472 0.086
NP_441811.1_8 Reverse -284 -298 8.94771 0.227
NP_442837.1_3 Reverse -291 -298 6.52896 0.2
NP_442837.1_3 Forward -298 -291 6.0373 0.25
NP_442053.1_1 Forward -299 -290 5.60459 0.176
NP_440505.1_3 Forward -301 -291 8.63316 0.138
NP_442532.1_4 Reverse -368 -386 7.28623 0.3
NP_440914.1_1 Reverse -290 -300 6.66328 0.269
NP_440914.1_1 Forward -299 -289 6.07773 0.297
NP_441699.1_7 Forward -201 -182 2.55527 0.255
NP_442533.1_6 Forward -299 -290 6.19458 0.115
NP_442533.1_6 Reverse -235 -244 4.22796 0.186
NP_439944.1_9 Forward -298 -288 13.648 0.0526
NP_441697.1_5 Reverse -345 -364 -11.3162 0.295
NP_441028.1_6 Reverse -262 -272 5.48612 0.255
NP_441527.1_4 Reverse -197 -216 -0.907597 0.146
NP_441527.1_4 Reverse -121 -140 -8.35597 0.243
NP_440115.1_6 Reverse -287 -297 6.96153 0.166
NP_440115.1_6 Forward -302 -292 6.76487 0.167
NP_441869.1_2 Forward -292 -273 8.55425 0.284
NP_441286.1_1 Forward -300 -288 2.59558 0.0573
NP_441286.1_1 Reverse -289 -301 -5.95921 0.235
NP_442674.1_3 Reverse -233 -252 3.24359 0.294
NP_440670.1_8 Forward -299 -290 5.70292 0.14
NP_440268.1_8 Reverse -337 -356 12.5858 0.247
NP_440083.1_9 Reverse -171 -190 16.2853 0.278
NP_442614.1_2 Forward -237 -223 8.55439 0.255
NP_442614.1_2 Forward -299 -285 5.70279 0.298
NP_442072.1_9 Reverse -84 -102 -14.9272 0.165
NP_442264.1_2 Forward -254 -237 12.1336 0.171
NP_442842.1_10 Forward -216 -197 9.88192 0.206
NP_441626.1_2 Reverse -291 -298 6.0373 0.212
NP_441626.1_2 Forward -298 -291 5.93897 0.231
NP_441962.1_4 Reverse -164 -183 -12.6852 0.263
NP_440387.1_1 Forward -299 -283 -6.03799 0.262
NP_441836.1_2 Reverse -284 -303 3.83436 0.147
NP_442352.1_10 Reverse -326 -344 4.6407 0.246
NP_441425.1_4 Reverse -173 -187 14.5526 0.282
NP_442698.1_10 Reverse -283 -302 2.45773 0.284
NP_440311.1_2 Reverse -184 -203 10.1275 0.299
NP_440766.1_4 Forward -248 -234 2.65453 0.176
NP_442930.1_1 Forward -186 -176 11.4843 0.258
NP_442930.1_1 Reverse -345 -355 11.3859 0.259
NP_440457.1_1 Forward -248 -236 3.48056 0.195
NP_440554.1_4 Reverse -291 -301 5.68323 0.135
NP_441885.1_5 Forward -299 -289 10.1081 0.0145
NP_441885.1_5 Reverse -290 -300 1.455 0.11
NP_442703.1_8 Forward -265 -247 11.7197 0.265
NP_442341.1_7 Forward -300 -286 4.52282 0.188
NP_440750.1_5 Reverse -124 -138 4.91614 0.294
NP_443000.1_7 Forward -301 -291 10.3048 0.0345
NP_440507.2_8 Forward -228 -209 8.84924 0.123
NP_441842.1_1 Forward -297 -284 16.1449 0.0484
NP_440275.1_3 Forward -301 -291 5.28991 0.158
NP_440091.1_1 Reverse -286 -298 0.825626 0.227
NP_442451.1_2 Reverse -282 -301 -11.2103 0.287
NP_442451.1_2 Reverse -361 -380 -11.6036 0.297
NP_441389.1_5 Forward -312 -293 11.1109 0.251
NP_441207.1_7 Reverse -177 -191 8.38408 0.288
NP_440258.1_8 Forward -188 -169 11.405 0.299
NP_441105.1_3 Reverse -158 -177 -10.0303 0.3
NP_442373.1_2 Reverse -42 -61 -7.96535 0.244
NP_440216.1_1 Reverse -290 -304 -12.1934 0.247
NP_440216.1_9 Reverse -171 -180 12.3894 0.241
NP_440216.1_9 Reverse -172 -181 6.19458 0.289
NP_440678.1_5 Reverse -228 -247 8.25926 0.279
NP_440172.1_1 Forward -299 -289 15.418 0.00945
NP_441111.1_7 Reverse -291 -299 8.96754 0.0463
NP_441766.1_2 Forward -299 -290 14.0611 0.0111
NP_443052.1_9 Reverse -233 -252 5.80098 0.139
NP_442116.1_6 Reverse -335 -352 6.64108 0.273
NP_442116.1_6 Reverse -336 -353 5.49518 0.296
NP_442154.1_1 Reverse -43 -61 -17.8771 0.272
NP_440261.1_5 Forward -298 -285 -5.29059 0.19
NP_440261.1_5 Reverse -291 -304 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TATTAAGTACGGTCTAAAATGTAGCGATATTTACCAATGAAGATAGGAAATTTTGTCCAGATAAATCAACCCCAATAATTTTTACTAGGGGTTTCTAACCTGGCGATCTCTACCAACTCTTGACCAATATGGAGGTTAACTTTTTGATGTTTCCGGTGCCATGGGCGGACATCCACAAGGAAAGTTCTTCACCTTACCCTTTATCCATAGTCTGAAAATTTTTCCATTGGCTTCAGCAAATTCCAGCAGTGGACTGATAGTTCTTTTTCGGACTCTGATCCGCTACCCTAAAAGCAGAAAGGGAGAGCCTTTAACTCCCTCCATCTATGAACAAATAGACCGACTCATCAACAACCCAGAAACCTAGTTCCCTAGTTGTCTTTGAATAAATAGGATTCCT

CDS

ATGACAGGACAAGAAATTTTGATAAGGGATGAGAGAAAGGACGATGCCGTTCTCATTACTGAAGTGACTATTGCGGCCTTCGCGCCCCTAGAGATTAGTAACCACACAGAGCAGTTCATCATCGAAGCTCTTCGTTCCGCAGGTGCTTTAACCCTGTCATTGGTTGCAGAAGTGAATAGTCGTGTTGTGGGACATATTGCATTTTCCCCTGTGGCCATCTCGGACGGCACAAAAAACTGGTATGGACTCGGCCCGGTCTCCGTGTTACCCCTATACCAGCGTAGGGGGATTGGTAAAGCTCTTATTCAGGAAGGACTGTCACAGTTGAAGGGCTTAGGAGCCAAGGGCTGTTGCCTTGTCGGACACCCAGAATACTACAAAAAATTTGGATTTAAGAATGTGGCGGGGCTTGCTCTCGAAGGGGTTCCCGATGAGGTATTTTTTGCTCTTTCGTTTGACAGTCATTATCCCCAGGGTGATGTTACCTTCCATGAAGGATTCAGAGCAAATAGCTCTAGCAACGTGAAATTATGA

Protein

No sequence available