Your browser is old and dusty. Try Google Chrome!

Details for sll5130

ORF sll5130
Accession NP_942286.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Reverse -75 -94 -1.18052 0.27
NP_442100.1_2 Reverse -304 -323 13.2741 0.208
NP_443041.1_7 Forward -324 -307 9.97027 0.161
NP_441818.1_1 Reverse -158 -169 11.7595 0.164
NP_440259.1_4 Forward -25 -11 15.5771 0.155
NP_440259.1_4 Reverse -291 -305 13.2634 0.226
NP_439997.1_6 Forward -33 -14 13.0775 0.177
NP_442062.1_3 Forward -396 -377 -2.75381 0.272
NP_442972.1_1 Forward -382 -364 9.9807 0.265
NP_441925.1_2 Forward -337 -318 2.55606 0.262
NP_442827.1_8 Reverse -227 -246 -1.37794 0.245
NP_441434.1_1 Forward -325 -311 12.3301 0.233
NP_441434.1_3 Reverse -361 -380 0.884433 0.198
NP_442889.1_8 Reverse -28 -42 9.83206 0.0943
NP_442889.1_10 Reverse -14 -33 13.1174 0.181
NP_441327.1_1 Reverse -168 -187 2.29119 0.298
NP_440851.1_3 Forward -285 -266 3.53937 0.245
NP_442634.1_4 Forward -58 -44 -4.81863 0.22
NP_442530.1_6 Reverse -180 -193 16.676 0.279
NP_442658.1_1 Forward -85 -75 4.89613 0.292
NP_440656.1_8 Forward -240 -221 -8.85033 0.273
NP_440995.1_8 Reverse -314 -333 -0.197208 0.284
NP_442690.1_1 Reverse -307 -326 -0.295539 0.126
NP_442690.1_1 Forward -385 -366 -3.83545 0.142
NP_442690.1_1 Reverse -294 -313 -12.2919 0.241
NP_442690.1_1 Reverse -167 -186 -14.4552 0.272
NP_441099.1_5 Reverse -147 -166 -2.36049 0.12
NP_441654.1_7 Reverse -11 -30 16.0185 0.155
NP_440809.1_9 Reverse -205 -223 -9.0273 0.291
NP_440147.1_4 Reverse -233 -246 2.18257 0.209
NP_440715.1_1 Forward -228 -209 22.6156 0.0115
NP_441568.1_6 Forward -338 -320 16.1401 0.18
NP_442941.1_3 Reverse -158 -168 4.60159 0.14
NP_440289.1_2 Forward -73 -60 1.19926 0.135
NP_441079.1_7 Forward -326 -307 1.96529 0.177
NP_442172.1_5 Reverse -170 -184 18.728 0.205
NP_442500.1_8 Forward -327 -313 15.3843 0.146
NP_441860.1_4 Forward -349 -336 21.9471 0.0214
NP_440587.1_5 Reverse -223 -241 15.0428 0.245
NP_440421.1_1 Reverse -149 -163 16.8142 0.155
NP_441715.1_4 Reverse -158 -168 5.68323 0.189
NP_441826.1_2 Reverse -75 -89 -3.34366 0.284
NP_441330.1_9 Reverse -158 -177 10.1275 0.283
NP_442868.1_6 Forward -168 -158 3.22496 0.202
NP_440785.1_2 Forward -318 -299 6.29264 0.223
NP_441518.1_3 Forward -239 -220 -13.5702 0.264
NP_442830.1_7 Forward -255 -236 12.7825 0.111
NP_441819.1_5 Forward -384 -365 8.35512 0.295
NP_442347.1_2 Forward -165 -156 5.89959 0.21
NP_442347.1_2 Reverse -208 -217 3.7363 0.284
NP_441395.1_8 Reverse -8 -27 9.53756 0.181
NP_440749.1_4 Reverse -61 -79 16.0463 0.0825
NP_440787.1_5 Forward -326 -312 10.3243 0.256
NP_441199.1_10 Reverse -306 -324 10.6016 0.3
NP_442959.1_5 Reverse -307 -326 10.2259 0.224
NP_440408.1_7 Forward -302 -283 7.17762 0.291
NP_440267.1_2 Reverse -42 -56 14.6503 0.101
NP_442384.1_10 Forward -244 -231 1.9859 0.24
NP_442114.1_8 Forward -326 -312 8.84875 0.234
NP_441018.1_3 Reverse -141 -160 10.0284 0.286
NP_441018.1_8 Reverse -4 -23 20.354 0.059
NP_442917.1_1 Forward -274 -255 10.2251 0.181
NP_440297.1_9 Reverse -62 -72 3.81494 0.26
NP_440350.1_5 Reverse -342 -361 -5.70374 0.292
NP_440999.1_8 Forward -373 -354 5.80098 0.28
NP_442710.1_7 Forward -316 -297 -4.82 0.272
NP_443064.1_6 Reverse -235 -245 9.3673 0.226
NP_440673.1_3 Forward -242 -235 7.51227 0.252
NP_442430.1_6 Forward -308 -289 5.01433 0.271
NP_441851.1_10 Forward -218 -208 5.28991 0.218
NP_442011.1_1 Reverse -234 -253 -2.45882 0.273
NP_442515.1_1 Forward -71 -57 1.27789 0.165
NP_442515.1_1 Reverse -234 -248 -0.983719 0.241
NP_441982.1_6 Forward -239 -230 11.7214 0.288
NP_441982.1_6 Forward -273 -264 11.053 0.288
NP_440165.1_5 Reverse -373 -392 -4.32711 0.22
NP_442689.1_8 Forward -381 -364 0.92382 0.191
NP_442689.1_8 Reverse -298 -315 0.137172 0.191
NP_442689.1_8 Reverse -311 -328 -2.51776 0.235
NP_442689.1_8 Reverse -299 -316 -7.33598 0.292
NP_441409.1_6 Reverse -324 -343 -6.39206 0.124
NP_441150.1_4 Reverse -327 -346 15.8299 0.149
NP_441124.1_5 Reverse -360 -370 11.9577 0.239
NP_440431.1_4 Forward -156 -137 -10.0748 0.295
NP_442168.1_6 Forward -220 -201 8.94757 0.23
NP_441539.1_1 Reverse -306 -320 10.717 0.294
NP_441432.1_8 Reverse -234 -243 11.9961 0.0519
NP_441432.1_9 Forward -27 -14 19.4576 0.00893
NP_441432.1_9 Reverse -290 -303 11.701 0.221
NP_441432.1_9 Reverse -313 -326 11.604 0.221
NP_441057.1_10 Forward -369 -350 12.1925 0.277
NP_440281.1_6 Forward -348 -329 8.94757 0.268
NP_442400.1_10 Forward -175 -162 12.4757 0.208
NP_441786.1_8 Reverse -295 -314 21.1397 0.0106
NP_440250.1_4 Reverse -295 -314 4.71854 0.253
NP_442934.1_9 Forward -330 -312 13.1955 0.282
NP_441888.1_7 Reverse -335 -349 6.09611 0.225
NP_441329.1_6 Reverse -11 -30 3.10306 0.217
NP_441112.1_8 Forward -314 -295 6.88262 0.207
NP_440671.1_1 Reverse -266 -285 4.12128 0.276
NP_442943.1_1 Forward -276 -261 9.03926 0.19
NP_441009.1_8 Forward -254 -235 14.4533 0.236
NP_442568.1_8 Forward -234 -220 7.86607 0.296
NP_442627.1_4 Forward -319 -301 20.0553 0.058
NP_442399.1_3 Forward -242 -223 13.3438 0.142
NP_442193.1_1 Forward -71 -53 9.95058 0.233
NP_441769.1_3 Reverse -309 -328 -4.52452 0.245
NP_441936.1_3 Reverse -53 -72 9.43841 0.234
NP_440441.1_7 Forward -231 -212 9.93088 0.248
NP_440532.1_1 Reverse -214 -233 11.9958 0.138
NP_442499.1_4 Reverse -72 -86 11.406 0.226
NP_440402.1_3 Forward -175 -156 4.22769 0.276
NP_442402.1_2 Reverse -89 -103 10.3237 0.292
NP_442402.1_4 Reverse -291 -310 -7.96609 0.278
NP_441848.1_4 Forward -276 -260 7.83714 0.288
NP_441848.1_4 Forward -314 -298 7.64616 0.288
NP_442679.1_1 Forward -356 -337 -3.63879 0.261
NP_442829.1_2 Forward -326 -310 18.4809 0.12
NP_442844.1_5 Reverse -319 -338 4.03023 0.26
NP_442532.1_2 Forward -373 -354 9.40553 0.121
NP_440816.1_2 Forward -329 -310 6.72539 0.27
NP_440816.1_2 Forward -66 -47 5.66045 0.296
NP_441527.1_4 Forward -359 -340 -3.39039 0.166
NP_441527.1_4 Forward -157 -138 -6.44613 0.218
NP_441527.1_4 Forward -356 -337 -8.45146 0.244
NP_441527.1_4 Forward -305 -286 -9.2154 0.255
NP_441527.1_4 Forward -303 -284 -12.1756 0.285
NP_441527.1_4 Forward -338 -319 -12.2711 0.285
NP_440007.1_9 Forward -170 -156 3.8345 0.267
NP_439903.1_6 Reverse -44 -63 -0.591301 0.283
NP_001035870.1_10 Forward -161 -142 13.3161 0.258
NP_442704.1_5 Reverse -167 -186 16.7157 0.0877
NP_442842.1_10 Reverse -341 -360 2.89236 0.251
NP_442238.1_1 Forward -228 -209 2.55606 0.215
NP_441401.1_4 Forward -324 -311 17.4239 0.131
NP_440114.1_10 Reverse -214 -228 8.65272 0.198
NP_442698.1_10 Forward -337 -318 3.44104 0.279
NP_440766.1_6 Reverse -248 -267 12.7825 0.26
NP_440422.1_10 Forward -33 -14 15.0513 0.147
NP_440422.1_10 Reverse -297 -316 10.017 0.2
NP_442930.1_1 Forward -373 -363 10.1076 0.278
NP_440987.1_4 Forward -327 -308 11.9958 0.143
NP_442680.1_5 Forward -330 -311 7.00825 0.201
NP_442680.1_5 Forward -241 -222 -0.904675 0.297
NP_442862.1_3 Forward -61 -44 8.10198 0.25
NP_441275.1_1 Reverse -291 -309 0.510803 0.294
NP_441397.1_8 Forward -104 -91 11.6163 0.297
NP_443010.1_10 Forward -226 -209 5.76644 0.198
NP_442638.1_3 Forward -321 -302 11.4109 0.298
NP_442638.1_3 Forward -354 -335 10.4559 0.298
NP_441207.1_7 Forward -327 -313 8.77134 0.282
NP_442918.1_4 Forward -381 -367 18.8791 0.181
NP_442918.1_6 Forward -77 -58 16.7086 0.175
NP_440172.1_1 Reverse -235 -245 2.7333 0.268
NP_442116.1_6 Forward -313 -296 17.8136 0.0788
NP_442116.1_6 Reverse -272 -289 9.60133 0.227
NP_442116.1_6 Reverse -285 -302 7.78699 0.254
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CCATGATAATTCAGAGTTTAGATTGGTTACAAATTTACCTATAGAAAGTAAAGAAATAGAAGGAGTTAGTGATGAAAAAATAGCAGAAATTTATAAAAAAAGATGGCAAATAGAATTGTTATGGAAATTCTTAAAAATGCACTTAAAGCTGAATAGACTGATTGCCAAAAATGAGAATGCAATTGGGATTCAAATCTATACCTGTATAATTGCTTATTTAATACTAAAATTACTGGTAATCCCAAAAGAAGCAGGTACAACAATGTTAGACAAACTACGTTATTTACAGGCTTTCATGTGTGAAAAAATAAGCTATGTACACTGGCTAAGGGAGTTAGCACTAAGGTGATGAATTTGCTTTGCTATAGGATTATTCTGTCTATTTTTAGGTCGTACATAA

CDS

GTGCGATTCAACGATTCTGAGATTGAGCATATCTGGGCAAATCATTTTGAGGAGCATACAGACGAGTTTTCTCATGAGTATGAATTTCGGGACTATCGCAATCGTTTGGGGGGTTTAGTTCTGTTACCAAAGTCTGTGAATGCAAGTCTTCAGGACAAACCCTATAGTCATAAGGTGAATGTCTACTCTACTCAGAATCTTTTGGCTGGTTCTCTACATCCGCAGACATATGAAAATAAGCCAAAAGTCAAACAAATGCAAGAAAGAACTGGTTTAGATCTTAAGCCTATTTACCAAGAGGATGGGAAATCTCAGTTTACAAAGGTTAGTTTTGAGGAGCGATTCGCTTTGTATCGAGGCATTGCTGAGCAAATGTGGTCTGTAGAAAGTTTGAAAGAGCTAGTTTAG

Protein

No sequence available