Your browser is old and dusty. Try Google Chrome!

Details for sll5123

ORF sll5123
Accession NP_942279.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -230 -244 -0.688726 0.237
NP_440557.1_1 Forward -119 -100 -1.47551 0.273
NP_440795.1_7 Forward -119 -112 14.6904 0.0123
NP_440795.1_7 Reverse -112 -119 14.6904 0.0123
NP_441418.1_6 Forward -120 -101 -29.7948 0.238
NP_441453.1_4 Reverse -111 -119 16.539 0.00633
NP_441453.1_4 Forward -120 -112 16.539 0.00633
NP_441960.1_3 Forward -122 -103 12.8414 0.291
NP_442151.1_6 Forward -120 -106 14.6509 0.0321
NP_442151.1_6 Reverse -111 -125 8.55439 0.171
NP_442151.1_6 Forward -348 -334 5.50613 0.274
NP_441818.1_1 Reverse -112 -123 18.446 0.0046
NP_441818.1_9 Forward -332 -313 -4.22878 0.234
NP_440226.1_1 Reverse -111 -130 16.2241 0.022
NP_440226.1_1 Forward -120 -101 13.4708 0.0356
NP_442169.1_1 Forward -102 -83 6.58763 0.26
NP_440996.1_5 Forward -43 -34 16.8124 0.146
NP_442655.1_1 Forward -353 -334 1.76941 0.238
NP_442173.1_1 Forward -119 -111 15.4574 0.00633
NP_442173.1_1 Reverse -112 -120 15.4574 0.00633
NP_442173.1_1 Forward -288 -280 11.3275 0.0463
NP_442752.1_4 Forward -120 -113 13.8055 0.0199
NP_442752.1_4 Reverse -111 -118 13.8055 0.0199
NP_443027.1_4 Reverse -109 -119 16.2046 0.0437
NP_443027.1_4 Forward -122 -112 11.0914 0.107
NP_441812.1_3 Forward -121 -107 19.1741 0.0453
NP_442975.1_10 Reverse -107 -121 4.22722 0.245
NP_440784.1_7 Forward -119 -112 15.9687 0.0123
NP_440784.1_7 Reverse -112 -119 15.9687 0.0123
NP_440061.1_9 Reverse -109 -123 10.9137 0.121
NP_440061.1_9 Forward -291 -277 9.24208 0.149
NP_441054.1_2 Forward -336 -317 9.93088 0.284
NP_441054.1_2 Reverse -243 -262 9.63589 0.288
NP_441054.1_4 Forward -130 -112 2.0841 0.169
NP_441476.1_5 Reverse -302 -321 -5.11376 0.26
NP_442062.1_8 Reverse -111 -121 17.3846 0.00193
NP_442062.1_8 Forward -120 -110 10.3048 0.0493
NP_440761.1_4 Forward -125 -106 5.01433 0.0718
NP_441900.1_2 Reverse -374 -392 -4.79978 0.288
NP_441859.1_3 Reverse -110 -129 6.68515 0.171
NP_440304.1_4 Reverse -109 -119 19.9412 0.00364
NP_440304.1_4 Forward -122 -112 1.84832 0.299
NP_442242.1_4 Forward -119 -112 14.3954 0.0124
NP_442242.1_4 Reverse -112 -119 14.3954 0.0124
NP_440893.1_6 Forward -118 -99 16.9115 0.223
NP_441208.1_9 Forward -123 -109 4.71948 0.291
NP_442110.1_7 Forward -120 -106 11.701 0.0593
NP_440014.1_6 Reverse -102 -121 8.06259 0.254
NP_441083.1_5 Reverse -111 -121 20.3345 0.00053
NP_441083.1_5 Forward -120 -110 11.2881 0.0159
NP_441434.1_1 Forward -140 -126 8.70139 0.254
NP_441738.1_2 Forward -118 -111 15.28 0.0102
NP_441738.1_2 Reverse -113 -120 15.28 0.0102
NP_441558.1_5 Reverse -109 -128 8.25926 0.155
NP_440209.1_1 Reverse -111 -119 18.1123 0.00295
NP_440209.1_1 Forward -120 -112 18.1123 0.00295
NP_442889.1_8 Forward -123 -109 3.24392 0.284
NP_440447.1_6 Forward -128 -110 5.72234 0.145
NP_441713.1_1 Forward -126 -107 -4.13045 0.113
NP_441770.1_4 Reverse -68 -87 -9.34199 0.25
NP_440178.1_7 Forward -121 -102 -22.5183 0.267
NP_441716.1_1 Reverse -111 -125 4.71948 0.252
NP_441327.1_5 Forward -87 -78 12.7828 0.29
NP_442111.1_3 Forward -306 -293 14.0036 0.245
NP_442111.1_4 Forward -121 -107 11.0127 0.0518
NP_442111.1_4 Forward -364 -350 3.44117 0.244
NP_441163.1_4 Reverse -219 -238 12.7268 0.278
NP_441387.1_8 Forward -140 -121 15.4215 0.185
NP_440906.1_5 Forward -119 -112 15.8704 0.0124
NP_440906.1_5 Reverse -112 -119 15.8704 0.0124
NP_440747.1_10 Forward -123 -111 16.8536 0.00143
NP_440747.1_10 Reverse -108 -120 7.80712 0.00223
NP_441130.1_10 Reverse -109 -123 10.4227 0.113
NP_441486.1_1 Forward -123 -109 4.22782 0.0475
NP_441486.1_1 Reverse -108 -122 -3.44199 0.178
NP_440944.1_2 Forward -188 -169 1.27776 0.255
NP_442634.1_4 Forward -122 -108 17.2075 0.01
NP_443018.1_3 Forward -119 -112 14.8871 0.0123
NP_443018.1_3 Reverse -112 -119 14.8871 0.0123
NP_443018.1_3 Forward -288 -281 8.8889 0.136
NP_441316.1_7 Forward -122 -107 -1.5934 0.238
NP_441634.1_8 Forward -122 -108 -3.34366 0.295
NP_440376.1_1 Forward -120 -111 19.4693 0.000692
NP_440376.1_1 Reverse -111 -120 19.4693 0.000692
NP_440376.1_1 Forward -269 -260 3.93297 0.188
NP_441857.1_5 Forward -127 -109 4.6407 0.222
NP_441588.1_4 Reverse -113 -123 8.73149 0.14
NP_443065.1_9 Reverse -248 -267 13.0775 0.231
NP_442687.1_7 Reverse -110 -120 9.02648 0.0994
NP_442687.1_7 Forward -121 -111 8.92815 0.0994
NP_442687.1_7 Forward -386 -376 4.79825 0.234
NP_442485.1_3 Reverse -49 -68 2.16274 0.215
NP_442485.1_3 Forward -389 -370 -0.983855 0.255
NP_440609.1_6 Reverse -177 -196 21.4356 0.0266
NP_440642.1_10 Reverse -79 -93 7.96378 0.215
NP_441422.1_7 Forward -122 -105 -3.79607 0.235
NP_440667.1_2 Forward -194 -175 5.89931 0.189
NP_440667.1_2 Forward -338 -319 -3.54046 0.234
NP_442658.1_1 Reverse -109 -119 13.0576 0.04
NP_442658.1_1 Forward -122 -112 7.94438 0.199
NP_442658.1_1 Reverse -278 -288 5.48612 0.265
NP_442782.1_2 Forward -120 -106 1.67122 0.281
NP_442205.1_9 Reverse -105 -121 2.51681 0.212
NP_442544.1_6 Reverse -104 -123 -7.08038 0.298
NP_441414.1_9 Reverse -111 -130 -1.08219 0.0977
NP_441414.1_9 Forward -120 -101 -4.91709 0.164
NP_439968.1_8 Forward -345 -329 14.0215 0.236
NP_441958.1_5 Reverse -110 -120 21.2195 0.000805
NP_441958.1_5 Forward -121 -111 12.2714 0.00183
NP_441127.1_1 Forward -384 -370 10.521 0.244
NP_440203.1_5 Forward -117 -107 12.5659 0.146
NP_439905.1_1 Reverse -112 -125 9.65572 0.216
NP_440984.1_7 Reverse -106 -120 11.701 0.122
NP_440984.1_7 Forward -125 -111 8.94771 0.133
NP_439990.1_5 Forward -125 -112 18.7022 0.0112
NP_442690.1_1 Forward -44 -25 -14.0619 0.268
NP_442911.1_2 Forward -130 -111 4.03102 0.0401
NP_442911.1_2 Reverse -101 -120 1.57275 0.0576
NP_440153.1_5 Forward -119 -105 3.53951 0.208
NP_442064.1_1 Forward -125 -106 1.86774 0.146
NP_443055.1_6 Reverse -210 -228 -2.73484 0.299
NP_440993.1_2 Reverse -106 -122 1.43517 0.279
NP_440993.1_3 Reverse -101 -120 0.686995 0.247
NP_442210.1_9 Forward -124 -106 8.08229 0.277
NP_441099.1_5 Forward -130 -111 -11.8003 0.29
NP_442002.1_9 Reverse -279 -286 9.97054 0.246
NP_440809.1_9 Reverse -102 -120 -6.96235 0.225
NP_440809.1_9 Forward -129 -111 -8.14232 0.227
NP_440475.1_1 Forward -129 -110 15.2531 0.134
NP_442438.1_10 Reverse -106 -120 3.04785 0.166
NP_441000.1_5 Reverse -204 -223 5.89851 0.248
NP_441000.1_6 Reverse -110 -124 -3.24533 0.221
NP_442771.1_1 Reverse -367 -385 -0.275845 0.105
NP_440484.1_3 Forward -122 -108 10.1277 0.242
NP_440147.1_4 Reverse -109 -122 11.3273 0.0326
NP_440147.1_4 Forward -122 -109 8.08242 0.0561
NP_440147.1_4 Reverse -139 -152 2.08423 0.21
NP_441550.1_8 Forward -122 -112 15.1225 0.0132
NP_441550.1_8 Reverse -109 -119 13.0576 0.0273
NP_441916.1_7 Forward -120 -110 18.9579 0.00144
NP_441916.1_7 Reverse -111 -121 10.3048 0.0261
NP_441916.1_10 Forward -91 -72 0.196116 0.288
NP_441041.1_4 Forward -69 -50 -11.3086 0.244
NP_441041.1_7 Forward -123 -111 10.8188 0.0864
NP_441041.1_7 Reverse -108 -120 6.34865 0.211
NP_442396.1_5 Reverse -4 -17 7.98409 0.169
NP_443063.1_2 Forward -386 -367 5.01433 0.286
NP_442004.1_6 Forward -120 -106 5.30946 0.191
NP_441725.1_5 Forward -119 -109 11.1898 0.0247
NP_441725.1_5 Reverse -112 -122 2.04498 0.115
NP_439966.1_7 Forward -122 -112 15.3192 0.0152
NP_439966.1_7 Reverse -109 -119 14.8275 0.0177
NP_442941.1_3 Forward -119 -109 19.9412 0.00262
NP_442941.1_3 Reverse -112 -122 19.2529 0.00262
NP_442941.1_5 Reverse -147 -161 15.8619 0.248
NP_440289.1_2 Forward -123 -110 5.82081 0.0605
NP_440289.1_2 Reverse -108 -121 3.85419 0.0735
NP_440289.1_2 Forward -381 -368 1.88757 0.112
NP_442281.1_1 Reverse -106 -120 16.3219 0.00832
NP_442281.1_1 Forward -125 -111 7.76712 0.0927
NP_442256.1_2 Forward -122 -104 -0.570838 0.14
NP_440437.1_1 Reverse -105 -124 5.50599 0.0868
NP_442012.1_9 Reverse -208 -226 20.9027 0.125
NP_440498.1_1 Reverse -102 -120 1.19912 0.208
NP_442982.1_4 Reverse -209 -228 14.1583 0.186
NP_442982.1_5 Reverse -101 -120 2.0644 0.223
NP_441644.1_6 Forward -120 -110 19.0557 0.000803
NP_441644.1_6 Reverse -111 -121 17.3841 0.00127
NP_442215.1_2 Forward -122 -106 3.59845 0.094
NP_442215.1_2 Reverse -324 -340 0.648521 0.148
NP_442215.1_2 Forward -350 -334 -6.82463 0.28
NP_442029.1_5 Forward -121 -102 17.5736 0.217
NP_442247.1_8 Forward -291 -277 9.43936 0.247
NP_440253.1_2 Reverse -111 -129 10.3439 0.0401
NP_440929.1_8 Forward -120 -111 19.2726 0.000701
NP_440929.1_8 Reverse -111 -120 19.2726 0.000701
NP_440780.1_1 Forward -55 -36 7.4002 0.276
NP_442933.1_10 Forward -120 -111 17.601 0.00325
NP_442933.1_10 Reverse -111 -120 17.601 0.00325
NP_441751.2_8 Reverse -112 -126 9.93102 0.0307
NP_441751.2_8 Forward -119 -105 6.29277 0.0368
NP_442554.1_8 Forward -119 -109 16.9913 0.0065
NP_442554.1_8 Reverse -112 -122 16.2046 0.0065
NP_441762.1_7 Reverse -110 -122 -6.64753 0.284
NP_441762.1_7 Forward -121 -109 -6.94252 0.284
NP_442142.1_4 Reverse -108 -121 14.8666 0.0302
NP_442142.1_4 Forward -123 -110 12.8017 0.0409
NP_442142.1_4 Reverse -329 -342 6.0169 0.175
NP_442292.1_1 Reverse -112 -121 18.486 0.00229
NP_442292.1_1 Forward -119 -110 17.5026 0.00435
NP_442476.1_6 Reverse -112 -126 4.62115 0.142
NP_442476.1_6 Forward -119 -105 2.35953 0.186
NP_440895.1_6 Forward -126 -113 10.5407 0.202
NP_443009.1_2 Reverse -113 -132 -0.197208 0.216
NP_443009.1_5 Forward -121 -110 14.5128 0.02
NP_443009.1_5 Reverse -110 -121 10.1862 0.0792
NP_443009.1_5 Reverse -140 -151 3.99143 0.268
NP_442408.2_1 Forward -120 -101 -5.80207 0.277
NP_440947.1_7 Forward -345 -326 10.2259 0.16
NP_441715.1_4 Reverse -112 -122 17.3846 0.0106
NP_441715.1_4 Forward -119 -109 14.238 0.0295
NP_441198.1_8 Reverse -109 -119 13.2713 0.108
NP_441198.1_8 Reverse -278 -288 10.7322 0.247
NP_440379.1_8 Forward -270 -251 12.5858 0.244
NP_440464.1_10 Forward -266 -256 12.9127 0.176
NP_441468.1_1 Forward -119 -112 15.8704 0.0124
NP_441468.1_1 Reverse -112 -119 15.8704 0.0124
NP_441673.1_1 Forward -120 -111 20.8459 0.000698
NP_441673.1_1 Reverse -111 -120 20.8459 0.000698
NP_441826.1_2 Reverse -105 -119 4.91614 0.0979
NP_441637.1_9 Reverse -368 -386 5.42735 0.245
NP_442868.1_6 Forward -122 -112 19.2529 0.00563
NP_442868.1_6 Reverse -109 -119 1.06167 0.205
NP_442719.1_2 Reverse -67 -85 -2.73484 0.192
NP_442719.1_2 Reverse -366 -384 -11.1913 0.29
NP_441612.1_2 Reverse -111 -121 8.54929 0.21
NP_442427.1_8 Reverse -271 -290 10.8159 0.156
NP_442427.1_8 Forward -129 -110 9.53756 0.18
NP_442808.1_1 Reverse -110 -120 8.73102 0.0481
NP_442808.1_1 Forward -121 -111 8.63269 0.0481
NP_442808.1_1 Forward -55 -45 1.06124 0.296
NP_442542.1_9 Reverse -385 -399 7.47213 0.196
NP_442050.1_5 Reverse -109 -119 18.0724 0.00365
NP_442050.1_5 Forward -122 -112 14.3359 0.0206
NP_441878.1_6 Reverse -110 -120 10.5014 0.0176
NP_441878.1_6 Forward -121 -111 10.4031 0.0176
NP_441036.1_8 Reverse -110 -120 15.713 0.00724
NP_441036.1_8 Forward -121 -111 8.33817 0.174
NP_441557.1_5 Forward -120 -111 19.9609 0.000699
NP_441557.1_5 Reverse -111 -120 19.9609 0.000699
NP_441445.1_1 Reverse -102 -121 4.12936 0.2
NP_441445.1_1 Forward -129 -110 1.76941 0.247
NP_442066.2_9 Forward -124 -111 17.9155 0.0209
NP_441224.1_2 Reverse -270 -288 17.1287 0.109
NP_441224.1_9 Reverse -200 -214 23.1074 0.027
NP_441308.1_8 Reverse -109 -119 13.353 0.218
NP_440101.1_3 Reverse -106 -125 3.53937 0.227
NP_440101.1_10 Reverse -290 -309 1.96607 0.272
NP_441458.1_10 Reverse -102 -121 7.86593 0.192
NP_442183.1_1 Forward -120 -106 10.521 0.0829
NP_441459.1_8 Reverse -195 -208 12.0157 0.286
NP_441549.1_9 Forward -124 -106 14.1788 0.0304
NP_442347.1_2 Reverse -112 -121 12.4878 0.056
NP_442347.1_2 Reverse -370 -379 3.34298 0.284
NP_442347.1_2 Forward -119 -110 3.34298 0.284
NP_442888.1_6 Forward -80 -61 6.09597 0.228
NP_442888.1_6 Forward -131 -112 4.42435 0.228
NP_441037.1_4 Reverse -109 -119 7.31769 0.237
NP_442594.1_8 Forward -223 -204 5.70265 0.241
NP_441633.1_3 Forward -122 -109 3.26421 0.0709
NP_441633.1_3 Forward -291 -278 -5.09393 0.223
NP_441633.1_3 Forward -380 -367 -6.2739 0.242
NP_440136.1_2 Forward -119 -112 15.9687 0.0123
NP_440136.1_2 Reverse -112 -119 15.9687 0.0123
NP_441728.2_4 Forward -42 -23 12.9387 0.263
NP_442998.1_5 Forward -86 -76 12.7631 0.159
NP_442998.1_10 Forward -118 -111 15.5754 0.0102
NP_442998.1_10 Reverse -113 -120 15.5754 0.0102
NP_440299.1_1 Reverse -137 -150 4.14862 0.217
NP_440299.1_1 Reverse -107 -120 3.46031 0.243
NP_440299.1_1 Forward -124 -111 2.28034 0.292
NP_441799.1_1 Reverse -107 -121 15.3386 0.0187
NP_441799.1_1 Forward -124 -110 14.5519 0.0228
NP_440640.1_6 Forward -347 -328 4.22769 0.213
NP_441007.1_10 Reverse -106 -119 10.934 0.0646
NP_441007.1_10 Forward -125 -112 2.87088 0.183
NP_440256.1_1 Forward -123 -104 9.24257 0.021
NP_440256.1_1 Reverse -108 -127 -1.57384 0.105
NP_442526.1_1 Reverse -319 -338 17.109 0.233
NP_441559.1_8 Forward -125 -111 -5.80194 0.27
NP_440915.1_6 Forward -124 -110 10.7177 0.0301
NP_440997.1_4 Forward -205 -186 12.0942 0.276
NP_442785.1_7 Reverse -109 -123 10.816 0.228
NP_441464.1_8 Forward -378 -364 4.81781 0.263
NP_440695.1_5 Forward -120 -101 0.0977854 0.284
NP_441494.1_6 Reverse -106 -119 5.82081 0.292
NP_442993.1_1 Reverse -369 -385 -0.43312 0.074
NP_442993.1_1 Reverse -111 -127 -9.47957 0.186
NP_442993.1_1 Forward -120 -104 -11.1512 0.235
NP_442993.1_1 Forward -69 -53 -12.0362 0.265
NP_442386.1_9 Forward -121 -112 13.8639 0.0289
NP_442386.1_9 Reverse -110 -119 6.39082 0.219
NP_441291.1_7 Reverse -177 -196 21.4356 0.0282
NP_441340.1_5 Forward -119 -112 15.6737 0.0124
NP_441340.1_5 Reverse -112 -119 15.6737 0.0124
NP_441340.1_5 Reverse -281 -288 4.07068 0.239
NP_442484.1_2 Forward -131 -112 0.491109 0.247
NP_440327.1_6 Forward -332 -313 3.14605 0.285
NP_442240.1_2 Forward -119 -100 -13.3736 0.167
NP_440161.1_3 Forward -122 -103 7.7676 0.287
NP_442714.1_3 Reverse -366 -385 17.0099 0.124
NP_442714.1_7 Forward -149 -130 4.916 0.181
NP_440586.1_8 Forward -119 -112 13.2151 0.026
NP_440586.1_8 Reverse -112 -119 13.2151 0.026
NP_442251.1_6 Forward -119 -112 15.2804 0.0124
NP_442251.1_6 Reverse -112 -119 15.2804 0.0124
NP_441262.1_3 Reverse -111 -118 14.7888 0.0223
NP_441262.1_3 Forward -120 -113 14.7888 0.0223
NP_443051.1_1 Reverse -110 -119 19.5676 0.00335
NP_443051.1_1 Forward -121 -112 10.4228 0.00754
NP_439937.1_9 Reverse -375 -392 -11.1715 0.245
NP_439937.1_9 Reverse -374 -391 -11.5649 0.257
NP_439937.1_9 Reverse -110 -127 -14.6131 0.287
NP_440439.1_1 Reverse -108 -121 9.06573 0.0475
NP_440439.1_1 Forward -123 -110 1.69091 0.147
NP_440372.1_2 Forward -119 -112 16.3621 0.0124
NP_440372.1_2 Reverse -112 -119 16.3621 0.0124
NP_440372.1_2 Reverse -281 -288 4.07068 0.262
NP_440316.1_10 Reverse -353 -363 10.9931 0.214
NP_441803.1_2 Reverse -106 -125 5.01433 0.171
NP_439977.1_5 Forward -126 -107 4.81767 0.15
NP_441572.1_7 Reverse -105 -124 -4.32711 0.232
NP_440267.1_2 Reverse -106 -120 8.65209 0.162
NP_442384.1_10 Forward -120 -107 13.589 0.0195
NP_442384.1_10 Reverse -111 -124 11.6223 0.0341
NP_441018.1_7 Forward -124 -105 7.07928 0.277
NP_442790.1_4 Forward -129 -110 -10.7186 0.217
NP_442262.1_10 Forward -119 -112 14.1988 0.0123
NP_442262.1_10 Reverse -112 -119 14.1988 0.0123
NP_442262.1_10 Forward -288 -281 11.4455 0.102
NP_441689.1_5 Reverse -109 -119 17.8758 0.0158
NP_441689.1_5 Forward -122 -112 5.78111 0.197
NP_440344.1_10 Forward -127 -110 -6.25434 0.113
NP_440344.1_10 Reverse -300 -317 -12.0559 0.239
NP_440282.1_10 Reverse -101 -120 -7.86702 0.254
NP_440531.1_6 Reverse -103 -122 -0.688862 0.218
NP_441965.1_10 Forward -123 -107 14.0215 0.0935
NP_441965.1_10 Reverse -108 -124 3.10679 0.274
NP_440297.1_9 Forward -119 -109 9.22315 0.0917
NP_440297.1_9 Reverse -112 -122 -0.118297 0.282
NP_441896.1_3 Forward -129 -110 1.27776 0.218
NP_440894.1_7 Reverse -143 -162 7.76679 0.298
NP_440999.1_9 Forward -124 -110 5.50613 0.111
NP_440999.1_9 Reverse -107 -121 0.392915 0.187
NP_440999.1_9 Reverse -50 -64 -0.787057 0.217
NP_440999.1_9 Forward -64 -50 -2.95034 0.281
NP_440888.1_2 Reverse -111 -125 14.7486 0.0152
NP_440888.1_2 Forward -120 -106 12.9786 0.0354
NP_442147.1_7 Forward -387 -368 10.7175 0.244
NP_442277.1_4 Forward -357 -338 3.34192 0.226
NP_441543.1_2 Reverse -112 -121 16.9127 0.00359
NP_441543.1_2 Forward -119 -110 15.9293 0.00518
NP_441543.1_2 Reverse -61 -70 7.57121 0.113
NP_442845.1_2 Reverse -105 -119 7.37441 0.195
NP_442845.1_2 Forward -126 -112 4.62115 0.256
NP_441551.1_5 Forward -124 -108 8.41597 0.238
NP_441469.1_8 Reverse -110 -119 6.5879 0.227
NP_441469.1_8 Forward -121 -112 6.48957 0.227
NP_443064.1_6 Reverse -111 -121 12.5669 0.0796
NP_443064.1_6 Forward -120 -110 10.8217 0.13
NP_442578.1_7 Forward -119 -112 14.5921 0.026
NP_442578.1_7 Reverse -112 -119 14.5921 0.026
NP_442578.1_7 Forward -377 -370 9.38056 0.138
NP_441462.1_2 Forward -120 -110 20.2362 0.000805
NP_441462.1_2 Reverse -111 -121 11.5831 0.00406
NP_441621.1_7 Forward -122 -108 -5.31028 0.25
NP_443062.1_1 Forward -120 -102 15.3714 0.0385
NP_443062.1_1 Reverse -111 -129 4.45062 0.26
NP_443062.1_6 Forward -128 -109 10.4225 0.113
NP_441410.1_3 Reverse -102 -121 8.35759 0.21
NP_442204.1_1 Reverse -107 -118 9.40011 0.0786
NP_442204.1_2 Forward -130 -111 7.7676 0.269
NP_440255.1_3 Forward -130 -120 14.918 0.298
NP_440516.1_8 Forward -120 -111 16.9127 0.00442
NP_440516.1_8 Reverse -111 -120 16.9127 0.00442
NP_440516.1_8 Reverse -354 -363 -0.295266 0.232
NP_442428.1_5 Forward -119 -112 15.8704 0.0124
NP_442428.1_5 Reverse -112 -119 15.8704 0.0124
NP_442120.1_10 Reverse -230 -249 -5.31042 0.199
NP_442823.1_4 Reverse -282 -301 16.3224 0.287
NP_440673.1_3 Forward -118 -111 12.4288 0.0426
NP_440673.1_3 Reverse -113 -120 12.4288 0.0426
NP_440673.1_3 Forward -287 -280 11.3472 0.085
NP_440673.1_3 Forward -209 -202 7.41394 0.263
NP_441052.1_2 Reverse -111 -121 19.9412 0.00106
NP_441052.1_2 Forward -120 -110 10.4031 0.0285
NP_442219.1_9 Reverse -112 -121 17.7976 0.00718
NP_442219.1_9 Forward -119 -110 8.25953 0.0681
NP_440436.1_4 Reverse -112 -121 17.2072 0.00233
NP_440436.1_4 Forward -119 -110 9.24241 0.0871
NP_440314.1_9 Forward -288 -269 -9.83364 0.278
NP_440314.1_9 Reverse -112 -131 -10.1286 0.286
NP_440648.1_1 Reverse -354 -373 5.80098 0.21
NP_441719.1_4 Forward -119 -112 16.3621 0.0124
NP_441719.1_4 Reverse -112 -119 16.3621 0.0124
NP_442366.1_3 Forward -121 -103 -4.40575 0.271
NP_441115.1_4 Reverse -110 -128 13.9813 0.0645
NP_442206.1_10 Forward -120 -105 6.27308 0.178
NP_443054.1_2 Reverse -109 -123 3.14618 0.24
NP_443054.1_2 Forward -387 -373 -0.0987402 0.284
NP_441851.1_10 Forward -121 -111 15.8113 0.00552
NP_441851.1_10 Reverse -110 -120 8.53483 0.114
NP_441851.1_10 Forward -290 -280 3.91327 0.296
NP_442011.1_1 Forward -121 -102 -2.45882 0.273
NP_441668.1_4 Reverse -101 -120 2.85105 0.189
NP_442515.1_1 Forward -121 -107 4.03116 0.109
NP_442515.1_1 Forward -270 -256 3.04785 0.125
NP_442515.1_1 Reverse -110 -124 2.35953 0.137
NP_442515.1_1 Reverse -201 -215 -3.73699 0.297
NP_442515.1_1 Forward -379 -365 -5.01529 0.298
NP_441349.1_10 Reverse -101 -120 6.19431 0.0378
NP_441349.1_10 Forward -130 -111 -7.76869 0.258
NP_441409.1_6 Forward -126 -107 2.26107 0.0584
NP_441409.1_6 Reverse -105 -124 2.0644 0.0584
NP_442843.1_1 Reverse -281 -300 -9.34199 0.265
NP_440431.1_3 Reverse -110 -129 12.9791 0.0412
NP_442450.1_5 Reverse -109 -119 9.41981 0.115
NP_440588.1_2 Reverse -102 -121 -1.18052 0.155
NP_442006.1_2 Reverse -383 -400 -16.3824 0.25
NP_441570.1_1 Forward -120 -102 0.412472 0.0394
NP_441078.1_4 Forward -120 -111 19.6659 0.0007
NP_441078.1_4 Reverse -111 -120 19.6659 0.0007
NP_441078.1_4 Reverse -369 -378 -1.57357 0.266
NP_440526.1_3 Reverse -112 -123 10.2846 0.0646
NP_441432.1_8 Reverse -110 -119 16.8143 0.00595
NP_441432.1_8 Forward -121 -112 16.8143 0.00595
NP_441432.1_8 Forward -70 -61 2.94966 0.28
NP_442320.1_8 Forward -126 -112 -2.36035 0.0871
NP_442344.1_7 Reverse -370 -389 -6.49039 0.171
NP_441732.1_2 Reverse -107 -123 1.63183 0.0341
NP_440760.1_1 Forward -120 -101 -21.535 0.238
NP_440760.1_1 Reverse -111 -130 -21.83 0.245
NP_440760.1_1 Forward -238 -219 -23.4033 0.297
NP_440199.1_10 Forward -123 -113 7.25653 0.231
NP_440913.1_1 Forward -122 -104 8.37728 0.185
NP_442489.1_7 Forward -120 -111 20.1576 0.000695
NP_442489.1_7 Reverse -111 -120 20.1576 0.000695
NP_442079.1_6 Reverse -103 -122 16.7157 0.244
NP_440559.1_1 Reverse -112 -121 17.4043 0.00658
NP_440559.1_1 Reverse -281 -290 10.5211 0.0586
NP_440559.1_1 Forward -119 -110 8.65285 0.0586
NP_441659.2_8 Forward -120 -110 20.9245 0.000805
NP_441659.2_8 Reverse -111 -121 18.1713 0.00133
NP_441022.1_1 Reverse -33 -42 11.1625 0.284
NP_442913.1_10 Reverse -102 -121 4.62101 0.0853
NP_441800.1_3 Forward -238 -220 7.59063 0.286
NP_442346.1_5 Forward -121 -111 16.6963 0.00248
NP_442346.1_5 Reverse -110 -120 16.303 0.00248
NP_442346.1_5 Forward -70 -60 6.8632 0.188
NP_440545.1_3 Forward -124 -107 -4.09106 0.218
NP_441856.1_3 Forward -123 -104 7.86593 0.101
NP_440250.1_3 Reverse -135 -154 14.2566 0.23
NP_440847.1_8 Reverse -181 -200 12.0942 0.277
NP_442603.1_7 Reverse -111 -125 8.84875 0.162
NP_442603.1_7 Forward -120 -106 8.65209 0.168
NP_440449.1_6 Forward -371 -353 6.5051 0.248
NP_441948.1_4 Reverse -104 -122 -5.29072 0.26
NP_441833.1_4 Forward -119 -112 15.9687 0.0124
NP_441833.1_4 Reverse -112 -119 15.9687 0.0124
NP_442162.1_9 Forward -119 -112 16.2637 0.0124
NP_442162.1_9 Reverse -112 -119 16.2637 0.0124
NP_442162.1_9 Forward -288 -281 9.28223 0.0694
NP_440671.1_4 Reverse -105 -119 8.35772 0.201
NP_442140.1_3 Reverse -112 -122 10.3048 0.0902
NP_442140.1_3 Forward -340 -330 7.64985 0.133
NP_442140.1_3 Forward -362 -352 6.46988 0.168
NP_440875.1_9 Forward -118 -108 8.27469 0.233
NP_440875.1_9 Reverse -113 -123 7.69067 0.255
NP_441813.1_5 Forward -122 -112 18.1713 0.00743
NP_441813.1_5 Reverse -109 -119 15.9097 0.01
NP_441813.1_5 Forward -291 -281 4.40493 0.159
NP_440590.1_4 Reverse -112 -125 13.294 0.013
NP_440567.1_1 Forward -119 -105 5.30946 0.104
NP_440567.1_1 Reverse -112 -126 -0.000409212 0.261
NP_442497.1_10 Forward -119 -110 17.601 0.00813
NP_442497.1_10 Reverse -112 -121 10.4228 0.0087
NP_440821.1_4 Reverse -109 -119 11.0914 0.0146
NP_440821.1_4 Forward -122 -112 9.41981 0.0286
NP_441239.1_9 Reverse -109 -121 12.1337 0.0494
NP_441239.1_9 Forward -122 -110 5.25052 0.223
NP_441727.1_3 Forward -127 -108 5.01433 0.257
NP_441892.1_1 Reverse -102 -119 -3.99273 0.253
NP_441892.1_1 Reverse -330 -347 -4.48438 0.261
NP_442399.1_3 Forward -148 -129 9.6916 0.254
NP_440604.1_6 Forward -120 -101 -0.983855 0.192
NP_442044.1_1 Reverse -8 -27 -6.58872 0.208
NP_441769.1_9 Forward -335 -316 17.2074 0.195
NP_440546.1_4 Forward -120 -110 13.5365 0.0459
NP_440546.1_4 Reverse -111 -121 10.046 0.109
NP_440546.1_4 Forward -341 -331 6.94336 0.269
NP_440462.1_6 Reverse -109 -119 16.893 0.00853
NP_440462.1_6 Forward -122 -112 9.61647 0.0429
NP_440868.1_4 Reverse -107 -119 15.1819 0.0164
NP_440868.1_4 Forward -124 -112 10.0687 0.0405
NP_442787.1_9 Forward -182 -163 14.0608 0.296
NP_442479.1_9 Forward -161 -142 -6.49039 0.266
NP_442402.1_4 Reverse -370 -389 2.45694 0.163
NP_442402.1_4 Reverse -103 -122 -3.14789 0.212
NP_442402.1_10 Reverse -379 -389 13.0576 0.204
NP_441084.1_6 Reverse -109 -123 11.0893 0.218
NP_442039.1_4 Forward -119 -112 15.1821 0.0124
NP_442039.1_4 Reverse -112 -119 15.1821 0.0124
NP_442837.1_3 Forward -119 -112 15.7721 0.0124
NP_442837.1_3 Reverse -112 -119 15.7721 0.0124
NP_439994.1_1 Reverse -362 -381 8.06259 0.271
NP_442053.1_1 Forward -120 -111 18.3876 0.0007
NP_442053.1_1 Reverse -111 -120 18.3876 0.0007
NP_440505.1_3 Forward -122 -112 18.3679 0.00213
NP_440505.1_3 Reverse -109 -119 15.123 0.014
NP_440505.1_3 Reverse -6 -16 4.60159 0.277
NP_441252.1_6 Forward -167 -160 11.6422 0.288
NP_441203.1_1 Forward -119 -100 -5.80207 0.107
NP_440914.1_1 Reverse -111 -121 17.5935 0.000537
NP_440914.1_1 Forward -120 -110 16.3248 0.00196
NP_440914.1_1 Reverse -280 -290 7.93196 0.214
NP_441011.1_8 Forward -119 -110 16.6177 0.00602
NP_441011.1_8 Forward -68 -59 9.14451 0.135
NP_441011.1_8 Reverse -112 -121 8.25953 0.144
NP_442533.1_6 Forward -120 -111 17.2076 0.00137
NP_442533.1_6 Reverse -111 -120 17.2076 0.00137
NP_442232.1_3 Reverse -103 -122 -14.9469 0.288
NP_442322.1_2 Reverse -210 -229 15.2399 0.229
NP_441482.1_7 Reverse -105 -119 7.86607 0.0233
NP_439944.1_9 Forward -119 -109 17.6796 0.00347
NP_439944.1_9 Reverse -112 -122 10.5014 0.0887
NP_442269.1_10 Forward -332 -313 2.45773 0.276
NP_441028.1_6 Reverse -379 -389 8.04271 0.217
NP_442664.1_3 Reverse -38 -52 16.5192 0.223
NP_440116.1_8 Reverse -112 -131 -4.72043 0.178
NP_441527.1_5 Reverse -109 -128 18.1335 0.169
NP_440115.1_6 Reverse -108 -118 7.45319 0.147
NP_440115.1_6 Forward -123 -113 6.8632 0.167
NP_440115.1_6 Reverse -277 -287 6.66654 0.172
NP_440007.1_9 Reverse -107 -121 8.75105 0.171
NP_440007.1_9 Forward -124 -110 5.89945 0.242
NP_439965.1_1 Reverse -102 -121 0.392778 0.146
NP_442562.1_4 Forward -194 -175 11.7008 0.117
NP_441602.1_4 Forward -80 -61 10.4225 0.278
NP_441972.1_5 Forward -347 -328 -5.70374 0.224
NP_441106.1_1 Reverse -110 -119 18.486 0.0028
NP_441106.1_1 Forward -121 -112 9.63616 0.0311
NP_440429.1_2 Reverse -370 -389 6.88262 0.299
NP_439903.1_6 Forward -123 -104 2.16195 0.231
NP_441286.1_1 Forward -121 -109 14.3953 0.00424
NP_441286.1_1 Reverse -110 -122 3.48056 0.0467
NP_441286.1_1 Forward -290 -278 -5.95921 0.235
NP_441385.1_1 Reverse -126 -141 14.4346 0.28
NP_440670.1_8 Forward -120 -111 18.3876 0.000699
NP_440670.1_8 Reverse -111 -120 18.3876 0.000699
NP_440886.1_7 Reverse -110 -120 8.04271 0.0805
NP_440886.1_7 Forward -121 -111 7.94438 0.0805
NP_442614.1_2 Reverse -111 -125 15.0442 0.0835
NP_442614.1_2 Forward -120 -106 10.226 0.234
NP_439995.1_7 Reverse -320 -334 18.0918 0.214
NP_442072.1_9 Forward -121 -103 -22.4003 0.234
NP_440513.1_6 Forward -358 -339 9.83173 0.249
NP_440907.2_8 Forward -119 -109 9.51767 0.103
NP_440907.2_8 Forward -288 -278 4.99446 0.228
NP_440326.1_5 Forward -122 -109 16.1456 0.179
NP_440841.1_4 Reverse -109 -128 -6.78538 0.215
NP_441626.1_2 Forward -119 -112 15.7721 0.0124
NP_441626.1_2 Reverse -112 -119 15.7721 0.0124
NP_441626.1_4 Forward -191 -172 14.7491 0.167
NP_441460.1_2 Reverse -79 -92 14.5717 0.234
NP_441401.1_5 Reverse -102 -121 13.2252 0.297
NP_442615.1_1 Reverse -102 -120 16.5388 0.00809
NP_442615.1_1 Forward -129 -111 3.26407 0.0561
NP_440387.1_1 Forward -120 -104 3.20513 0.0632
NP_441836.1_2 Forward -126 -107 -3.93378 0.247
NP_440114.1_10 Forward -120 -106 9.73436 0.164
NP_440114.1_10 Reverse -111 -125 7.9644 0.219
NP_440114.1_10 Reverse -332 -346 6.6861 0.26
NP_442698.1_10 Reverse -47 -66 1.27776 0.297
NP_440725.1_4 Reverse -175 -194 2.55606 0.189
NP_440287.1_6 Forward -129 -110 7.37428 0.154
NP_440287.1_7 Reverse -380 -399 17.7974 0.265
NP_439998.1_4 Forward -125 -106 18.7069 0.176
NP_439910.1_2 Forward -128 -111 -12.8425 0.103
NP_440457.1_1 Reverse -107 -119 1.31728 0.241
NP_440457.1_1 Forward -124 -112 -0.74767 0.273
NP_440798.1_6 Forward -119 -106 1.9859 0.188
NP_442509.1_9 Forward -385 -375 8.43603 0.192
NP_442509.1_9 Reverse -111 -121 8.14104 0.192
NP_442509.1_9 Forward -120 -110 8.04271 0.192
NP_441440.1_6 Reverse -243 -261 18.5054 0.0882
NP_440554.1_4 Forward -119 -109 16.1063 0.0189
NP_440554.1_4 Reverse -112 -122 8.92815 0.0646
NP_441885.1_5 Reverse -111 -121 20.9245 0.000538
NP_441885.1_5 Forward -120 -110 11.3864 0.00668
NP_442341.1_7 Forward -121 -107 4.81781 0.177
NP_442341.1_9 Forward -122 -108 10.1271 0.137
NP_442341.1_9 Reverse -109 -123 8.06211 0.179
NP_441173.1_9 Reverse -380 -388 11.3271 0.226
NP_443000.1_3 Forward -99 -80 11.1347 0.255
NP_443000.1_7 Forward -122 -112 19.9412 0.00223
NP_443000.1_7 Reverse -109 -119 17.4829 0.00719
NP_440275.1_3 Forward -122 -112 15.123 0.0182
NP_440275.1_3 Reverse -109 -119 9.12481 0.055
NP_440091.1_1 Forward -124 -112 1.31728 0.198
NP_440127.1_5 Reverse -268 -286 11.0322 0.274
NP_443010.1_10 Reverse -108 -125 9.43852 0.138
NP_441105.1_3 Forward -131 -112 7.96426 0.0512
NP_441105.1_3 Reverse -100 -119 -5.60541 0.222
NP_440216.1_1 Forward -120 -106 7.27608 0.00942
NP_440216.1_1 Reverse -111 -125 0.196253 0.0284
NP_440216.1_9 Forward -249 -240 5.99792 0.289
NP_440172.1_1 Forward -120 -110 17.5813 0.00421
NP_440172.1_1 Reverse -111 -121 15.0247 0.00945
NP_440172.1_1 Forward -289 -279 2.7333 0.268
NP_442015.1_10 Forward -124 -111 2.77255 0.187
NP_442015.1_10 Reverse -107 -120 1.39592 0.204
NP_441226.1_7 Forward -119 -112 14.4934 0.0123
NP_441226.1_7 Reverse -112 -119 14.4934 0.0123
NP_441757.1_3 Forward -121 -102 0.392778 0.19
NP_441111.1_7 Forward -119 -111 18.7023 0.00294
NP_441111.1_7 Reverse -112 -120 18.7023 0.00294
NP_441766.1_2 Forward -120 -111 17.5026 0.00297
NP_441766.1_2 Reverse -111 -120 17.5026 0.00297
NP_441766.1_2 Forward -289 -280 3.24465 0.227
NP_442417.1_5 Forward -120 -106 7.27608 0.194
NP_440416.1_9 Reverse -104 -123 -13.6686 0.169
NP_443052.1_8 Reverse -50 -69 -1.86883 0.0843
NP_443052.1_8 Forward -388 -369 -3.93378 0.109
NP_443052.1_9 Reverse -374 -393 -0.787193 0.216
NP_440261.1_5 Forward -119 -106 8.27909 0.0273
NP_440261.1_5 Reverse -112 -125 4.93583 0.0478
NP_440988.1_5 Forward -145 -126 13.8356 0.244
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGCATCGTCTTCTGGGGGAAACGGCGATAAACCCTTACCCGATAGTCCAACATGCGAAAACCCATGGTGGGGTCAGGTTCGGTTTGGAATTCCAGATGCAACACTAAGTCTTCCGATTGCTCCAAAATCAGGGAGTCAGCCCGAATTGGCTCCAAGGATAATTCCGTTGGACTGAGCTTGGTCAATTTGATTGGTCGCCCTAACAACCAGGCGGCATAGTCTTCGGAAAATGATTCGGCAAGGAATTTGCAGAGATTGTCAAACATACCCAAATTTTACTGGCGATCGCCTTGAGTAACTTCAGTTTGGCGGGAAGGGAAAATCCTCAATAGGTTATGGCTGTTACGTCCAACCCAGAAAAGTTTTAGTACAGTTGATAGTGAAGCTCTCCCCATAAATT

CDS

ATGCCTGCCAACGTGCTACCAGAAATTTACCGCCCCAGTCGGCGAACGGTTTATGAGTTGCCCCTTTACGCCTGTCCGGTATCAGCCGGTTTTCCCTCTCCGGCGGAGGACTATTTAGAGGGCAAGTTAGACCTCAATCAATATCTGATCAAACATCCTGCCGCCACCTTCTTTGTGCGAGTGACTGGGGATTCAATGATTGGAGCCGGGATTCATGCCGGGGATATTTTGATTGTGGATCGTTCCCTGGAGCCACGGGATGGCAAGGTGGTGATCGCTGTGGTCAATGGGGAACTGTTGGTTAAACGGTTGAGGATGGAAAAGCAAAAAATTTATCTGGCTTCTGAAAATTCTGACTATCCGCCCCTGGTCATCACCGATTTAATGGACTTTGAAGTATGGGGCGTGGTCACCAATGTGATTCATCCCCTATGA

Protein

No sequence available