Your browser is old and dusty. Try Google Chrome!

Details for sll5083

ORF sll5083
Accession NP_942239.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -284 -270 0.392915 0.211
NP_441453.1_1 Reverse -315 -333 5.91824 0.242
NP_441960.1_4 Reverse -288 -304 12.7425 0.242
NP_442151.1_6 Forward -243 -229 5.50613 0.274
NP_442623.1_1 Forward -205 -186 -8.16202 0.172
NP_442287.1_5 Forward -298 -288 10.3048 0.291
NP_442173.1_1 Reverse -323 -331 9.1642 0.085
NP_442752.1_4 Forward -243 -236 4.26735 0.293
NP_442752.1_4 Forward -205 -198 4.26735 0.293
NP_443027.1_4 Forward -207 -197 6.27322 0.286
NP_441812.1_3 Forward -244 -230 8.75105 0.251
NP_442975.1_10 Forward -335 -321 5.01387 0.234
NP_441054.1_4 Forward -215 -197 -4.01242 0.294
NP_440761.1_4 Reverse -317 -336 -20.65 0.289
NP_440304.1_4 Forward -333 -323 14.4347 0.051
NP_442242.1_4 Forward -379 -372 11.3472 0.105
NP_442242.1_4 Reverse -323 -330 10.7572 0.153
NP_442242.1_4 Forward -204 -197 10.0689 0.174
NP_440044.1_8 Reverse -323 -342 -3.93378 0.295
NP_440370.1_10 Forward -340 -321 10.9142 0.195
NP_441083.1_5 Reverse -282 -292 5.68323 0.11
NP_441083.1_5 Reverse -234 -244 1.35667 0.209
NP_441083.1_5 Reverse -196 -206 0.176696 0.241
NP_441083.1_5 Forward -243 -233 -0.806614 0.28
NP_441083.1_5 Forward -291 -281 -1.00328 0.289
NP_439957.1_10 Forward -81 -71 15.9097 0.278
NP_441942.1_7 Forward -288 -269 10.2259 0.297
NP_440209.1_1 Forward -205 -197 5.13263 0.17
NP_440209.1_1 Reverse -234 -242 5.0343 0.194
NP_440178.1_7 Reverse -321 -340 -13.3736 0.136
NP_440178.1_7 Reverse -281 -300 -22.2233 0.258
NP_442570.1_3 Forward -314 -295 -7.4737 0.27
NP_441716.1_1 Reverse -234 -248 11.406 0.0936
NP_441327.1_1 Reverse -98 -117 10.1721 0.203
NP_442111.1_4 Forward -244 -230 5.50613 0.162
NP_440906.1_5 Reverse -197 -204 9.47889 0.116
NP_440747.1_10 Forward -246 -234 -4.48425 0.101
NP_440747.1_10 Forward -208 -196 -12.5474 0.297
NP_441486.1_1 Forward -246 -232 -4.03198 0.186
NP_441880.2_10 Reverse -323 -341 12.2122 0.133
NP_440944.1_2 Forward -217 -198 3.04771 0.232
NP_442634.1_4 Forward -333 -319 1.76955 0.149
NP_441014.1_10 Reverse -59 -78 -0.492971 0.252
NP_441634.1_8 Forward -207 -193 -4.4253 0.295
NP_441634.1_8 Forward -275 -261 -4.81863 0.298
NP_440376.1_1 Reverse -282 -291 4.12963 0.173
NP_440376.1_1 Forward -243 -234 0.0980582 0.285
NP_440376.1_1 Reverse -234 -243 -0.000272808 0.285
NP_441588.1_4 Reverse -373 -383 7.35486 0.178
NP_442687.1_7 Reverse -195 -205 5.09324 0.221
NP_441077.1_6 Forward -76 -60 10.0324 0.164
NP_441855.2_4 Reverse -295 -314 9.33025 0.282
NP_441414.1_9 Forward -243 -224 -0.0988766 0.0869
NP_441414.1_9 Reverse -196 -215 -4.81876 0.162
NP_440800.1_7 Forward -284 -270 15.5359 0.241
NP_442321.1_4 Reverse -272 -291 -3.44213 0.276
NP_441958.1_5 Reverse -233 -243 1.55333 0.095
NP_441958.1_5 Reverse -281 -291 -1.00328 0.227
NP_441958.1_5 Forward -244 -234 -6.90313 0.293
NP_441127.1_1 Forward -340 -326 9.5377 0.272
NP_442836.1_10 Forward -312 -302 14.4347 0.212
NP_440203.1_5 Reverse -237 -247 9.71433 0.245
NP_439990.1_5 Forward -210 -197 7.88576 0.185
NP_442690.1_1 Forward -30 -11 -0.688862 0.127
NP_440153.1_5 Reverse -323 -337 5.01447 0.193
NP_440153.1_5 Reverse -283 -297 4.81781 0.196
NP_441591.1_10 Forward -315 -296 5.89931 0.295
NP_441941.1_9 Forward -296 -277 4.52268 0.219
NP_440993.1_3 Forward -172 -153 2.45694 0.206
NP_440934.1_2 Reverse -264 -283 5.40766 0.239
NP_441099.1_5 Reverse -186 -205 -8.85033 0.206
NP_441294.1_7 Forward -247 -233 12.8022 0.0838
NP_441294.1_7 Reverse -237 -251 9.25063 0.256
NP_441424.1_6 Forward -257 -238 15.0747 0.263
NP_440206.1_9 Forward -222 -203 6.98095 0.294
NP_441041.1_4 Forward -284 -265 -0.4922 0.0958
NP_441041.1_4 Reverse -270 -289 -11.1119 0.241
NP_441041.1_7 Reverse -319 -331 11.7906 0.0711
NP_441041.1_7 Reverse -193 -205 5.76558 0.241
NP_440569.1_10 Forward -225 -206 2.33913 0.293
NP_442941.1_3 Reverse -197 -207 -0.0199663 0.244
NP_442941.1_3 Forward -242 -232 -1.19994 0.288
NP_440289.1_2 Reverse -193 -206 1.19926 0.135
NP_441678.1_9 Forward -323 -304 -4.13045 0.292
NP_441334.1_7 Reverse -320 -339 -13.5702 0.217
NP_442256.1_2 Reverse -194 -212 -9.12563 0.249
NP_441457.1_7 Reverse -320 -339 1.17943 0.276
NP_443030.1_4 Reverse -263 -282 -7.57203 0.298
NP_441644.1_6 Forward -243 -233 6.17443 0.165
NP_441644.1_6 Forward -205 -195 4.40448 0.239
NP_442215.1_2 Forward -293 -277 4.77842 0.0823
NP_442215.1_2 Forward -245 -229 -6.03799 0.263
NP_442177.1_5 Forward -315 -301 11.3077 0.22
NP_442029.1_6 Forward -284 -265 13.5691 0.137
NP_440929.1_8 Forward -291 -282 3.93297 0.197
NP_441346.1_7 Reverse -173 -192 9.43923 0.284
NP_442933.1_1 Reverse -58 -77 6.06331 0.281
NP_442933.1_2 Forward -75 -57 11.3655 0.248
NP_442933.1_10 Reverse -234 -243 11.5045 0.042
NP_442554.1_8 Reverse -323 -333 7.25653 0.0955
NP_442970.1_3 Forward -39 -21 13.0544 0.213
NP_442142.1_4 Reverse -193 -206 5.0336 0.204
NP_442292.1_1 Reverse -323 -332 5.60459 0.14
NP_442292.1_1 Reverse -197 -206 -0.68859 0.268
NP_442292.1_1 Reverse -235 -244 -0.786921 0.287
NP_443009.1_5 Forward -332 -321 4.38475 0.249
NP_440620.1_4 Forward -134 -120 14.3354 0.272
NP_440183.1_1 Forward -204 -185 6.4893 0.278
NP_440464.1_10 Reverse -235 -245 14.1541 0.169
NP_441673.1_1 Forward -243 -234 1.37636 0.114
NP_441673.1_1 Reverse -234 -243 1.1797 0.163
NP_442757.1_7 Forward -209 -190 19.9606 0.11
NP_441764.1_4 Reverse -106 -123 10.3636 0.262
NP_442868.1_6 Forward -207 -197 -0.118297 0.264
NP_441911.1_10 Forward -76 -57 9.81228 0.227
NP_442808.1_1 Reverse -243 -253 2.24121 0.274
NP_442808.1_1 Reverse -301 -311 1.35624 0.287
NP_441849.1_2 Reverse -218 -237 5.77684 0.245
NP_442718.1_2 Forward -205 -186 -5.80207 0.295
NP_441557.1_5 Forward -243 -234 0.491382 0.144
NP_441557.1_5 Reverse -234 -243 0.29472 0.174
NP_441445.1_1 Forward -300 -281 6.39097 0.15
NP_442066.2_9 Forward -209 -196 6.70579 0.271
NP_441433.1_8 Forward -371 -352 -3.24547 0.276
NP_441308.1_1 Forward -96 -77 20.2556 0.0829
NP_442830.1_5 Reverse -301 -315 3.14559 0.25
NP_441819.1_5 Reverse -126 -145 10.3605 0.261
NP_440157.1_5 Forward -77 -58 15.6125 0.265
NP_442347.1_2 Reverse -235 -244 14.5527 0.056
NP_442347.1_2 Reverse -197 -206 6.19458 0.182
NP_442645.1_2 Forward -251 -232 -21.9284 0.29
NP_441633.1_3 Forward -207 -194 0.805932 0.115
NP_440136.1_2 Reverse -323 -330 3.97235 0.288
NP_442590.1_10 Forward -291 -272 5.11266 0.267
NP_442590.1_10 Forward -297 -278 3.53937 0.29
NP_442998.1_10 Reverse -324 -331 9.28223 0.117
NP_442998.1_10 Reverse -236 -243 5.93897 0.206
NP_442998.1_10 Reverse -198 -205 5.93897 0.206
NP_440899.1_8 Reverse -210 -229 1.96607 0.132
NP_440299.1_1 Forward -247 -234 2.87033 0.269
NP_441799.1_1 Forward -247 -233 5.70218 0.197
NP_441559.1_8 Reverse -265 -279 -5.50694 0.264
NP_440748.1_5 Reverse -266 -285 3.93269 0.204
NP_441464.1_8 Forward -331 -317 7.86607 0.205
NP_440026.1_4 Forward -315 -296 7.96426 0.288
NP_440695.1_6 Forward -175 -161 11.5748 0.265
NP_442957.1_8 Forward -281 -262 8.55425 0.287
NP_442484.1_2 Reverse -290 -309 -0.197208 0.257
NP_440327.1_6 Forward -323 -304 7.66927 0.228
NP_440146.1_1 Reverse -19 -37 14.4213 0.286
NP_440586.1_8 Forward -242 -235 12.6251 0.0546
NP_440586.1_8 Forward -204 -197 9.3802 0.156
NP_442251.1_6 Reverse -323 -330 9.67555 0.174
NP_440027.1_3 Reverse -234 -252 2.57501 0.289
NP_443051.1_1 Forward -332 -323 -0.000272808 0.245
NP_443051.1_1 Reverse -233 -242 -0.0986038 0.256
NP_439977.1_5 Reverse -316 -335 -1.08219 0.241
NP_441572.1_7 Reverse -228 -247 -3.83545 0.22
NP_442384.1_10 Reverse -234 -247 7.39411 0.0822
NP_442384.1_10 Reverse -196 -209 5.82081 0.118
NP_442384.1_10 Forward -291 -278 3.06754 0.203
NP_442384.1_10 Forward -243 -230 0.904263 0.275
NP_442262.1_10 Reverse -323 -330 8.8889 0.219
NP_440344.1_10 Reverse -275 -292 -7.82764 0.119
NP_440344.1_10 Reverse -189 -206 -9.89259 0.16
NP_440189.1_10 Reverse -223 -242 5.70265 0.279
NP_442187.1_3 Forward -206 -196 14.3364 0.199
NP_441896.1_3 Reverse -313 -332 1.17943 0.22
NP_440999.1_9 Reverse -192 -206 2.45787 0.149
NP_442892.1_9 Reverse -60 -74 12.782 0.296
NP_440491.1_1 Reverse -193 -212 8.37887 0.243
NP_441748.1_3 Forward -210 -191 12.7098 0.247
NP_441543.1_2 Forward -242 -233 11.0128 0.0598
NP_442710.1_7 Forward -38 -19 -5.30055 0.288
NP_442710.1_7 Forward -42 -23 -7.99162 0.299
NP_443064.1_6 Reverse -282 -292 12.373 0.0891
NP_442578.1_7 Forward -242 -235 12.6255 0.0418
NP_440071.1_6 Forward -315 -301 15.4531 0.235
NP_440998.1_6 Reverse -239 -258 13.8633 0.295
NP_441462.1_2 Forward -243 -233 1.16001 0.0976
NP_441462.1_2 Forward -205 -195 -1.29827 0.299
NP_440516.1_8 Forward -205 -196 7.96454 0.0463
NP_440673.1_3 Reverse -236 -243 10.1672 0.149
NP_440673.1_3 Reverse -198 -205 10.1672 0.149
NP_441052.1_2 Reverse -196 -206 8.53483 0.0435
NP_441052.1_2 Reverse -234 -244 7.84651 0.0605
NP_441052.1_2 Forward -243 -233 4.0116 0.168
NP_442219.1_9 Reverse -197 -206 4.81794 0.196
NP_442219.1_9 Reverse -235 -244 4.71961 0.198
NP_440592.1_2 Forward -255 -236 1.57275 0.271
NP_440436.1_4 Reverse -197 -206 4.12922 0.288
NP_441719.1_2 Reverse -58 -72 14.2134 0.278
NP_441719.1_4 Forward -242 -235 3.77569 0.285
NP_441719.1_6 Reverse -299 -318 10.52 0.269
NP_441004.1_1 Forward -309 -290 -9.24366 0.206
NP_441004.1_1 Forward -284 -265 -16.0285 0.281
NP_441004.1_2 Forward -314 -295 -1.57384 0.261
NP_441004.1_4 Forward -306 -296 17.2863 0.152
NP_441004.1_5 Forward -307 -293 11.406 0.241
NP_442366.1_5 Forward -246 -236 16.4008 0.0374
NP_440296.1_10 Forward -314 -295 -14.4552 0.269
NP_442515.1_1 Reverse -281 -295 -3.54032 0.292
NP_442515.1_1 Forward -206 -192 -3.63866 0.295
NP_442515.1_1 Forward -244 -230 -3.83532 0.298
NP_440593.1_3 Reverse -296 -315 4.81767 0.13
NP_440463.1_7 Reverse -300 -314 14.8476 0.296
NP_442689.1_8 Forward -26 -9 -2.41943 0.235
NP_441349.1_10 Forward -253 -234 6.39097 0.0364
NP_441409.1_6 Reverse -190 -209 -14.3569 0.255
NP_440432.1_9 Reverse -323 -338 -5.32998 0.245
NP_440474.1_8 Forward -330 -316 4.8172 0.266
NP_440431.1_3 Forward -148 -129 -6.78538 0.195
NP_440431.1_4 Forward -62 -43 3.29405 0.107
NP_440431.1_4 Forward -77 -58 -1.38506 0.216
NP_440078.1_10 Reverse -270 -289 2.45773 0.269
NP_441078.1_4 Forward -243 -234 0.393051 0.205
NP_441078.1_4 Reverse -234 -243 -0.000272808 0.205
NP_441094.1_3 Forward -281 -264 17.5418 0.0599
NP_440526.1_3 Forward -204 -193 0.943182 0.267
NP_441432.1_8 Forward -332 -323 8.1612 0.0815
NP_441432.1_8 Forward -244 -235 4.22796 0.235
NP_441432.1_8 Forward -206 -197 4.12963 0.237
NP_441432.1_8 Forward -279 -270 2.55633 0.298
NP_441432.1_9 Reverse -64 -77 10.8284 0.239
NP_441732.1_2 Reverse -230 -246 -16.0677 0.164
NP_440760.1_1 Forward -243 -224 -14.0619 0.122
NP_442489.1_7 Reverse -234 -243 7.47288 0.0613
NP_442489.1_7 Forward -243 -234 0.688044 0.152
NP_442489.1_7 Reverse -322 -331 -1.96689 0.28
NP_440559.1_1 Reverse -197 -206 4.32629 0.288
NP_441659.2_8 Forward -243 -233 1.65166 0.233
NP_442913.1_10 Reverse -225 -244 -3.83545 0.219
NP_442913.1_10 Forward -340 -321 -4.72043 0.244
NP_441800.1_4 Reverse -330 -344 19.4615 0.252
NP_442776.1_1 Reverse -270 -289 10.7175 0.164
NP_440779.1_5 Forward -380 -363 -14.7108 0.269
NP_442346.1_5 Forward -244 -234 4.20827 0.296
NP_440352.1_8 Reverse -86 -102 14.8519 0.286
NP_440545.1_3 Forward -335 -318 -3.30441 0.203
NP_440459.1_2 Reverse -267 -284 13.0185 0.131
NP_440010.1_10 Forward -315 -296 11.0125 0.209
NP_441833.1_4 Reverse -197 -204 4.46401 0.256
NP_441329.1_6 Forward -76 -57 -2.43547 0.294
NP_442140.1_3 Forward -379 -369 5.38824 0.211
NP_442140.1_3 Forward -204 -194 5.38824 0.211
NP_440590.1_4 Reverse -197 -210 -0.472371 0.189
NP_440227.1_2 Reverse -98 -114 7.33503 0.295
NP_440546.1_6 Reverse -159 -178 11.7992 0.245
NP_441848.1_4 Forward -38 -22 7.35968 0.29
NP_441084.1_6 Forward -72 -58 11.6711 0.194
NP_440653.1_10 Reverse -270 -289 13.4708 0.117
NP_440696.1_3 Forward -253 -235 -2.14413 0.274
NP_442039.1_4 Reverse -323 -330 10.5605 0.121
NP_440825.1_7 Reverse -235 -245 12.9096 0.152
NP_442837.1_3 Reverse -235 -242 9.87221 0.106
NP_440160.1_5 Reverse -200 -210 15.0242 0.267
NP_442053.1_1 Reverse -234 -243 6.5879 0.124
NP_440505.1_3 Forward -207 -197 7.45319 0.154
NP_440505.1_7 Reverse -227 -246 10.1275 0.153
NP_441959.1_10 Forward -255 -237 10.0785 0.299
NP_441408.2_7 Reverse -267 -286 -3.24547 0.272
NP_440914.1_1 Forward -331 -321 9.68861 0.178
NP_440914.1_1 Reverse -303 -313 7.44401 0.237
NP_440724.1_6 Forward -315 -296 6.78429 0.297
NP_442533.1_6 Forward -243 -234 4.91628 0.165
NP_440263.1_5 Forward -182 -168 6.98109 0.294
NP_442322.1_4 Reverse -300 -317 -6.64833 0.277
NP_442269.1_10 Reverse -216 -235 3.6377 0.248
NP_441527.1_4 Forward -77 -58 5.20389 0.106
NP_441527.1_4 Forward -76 -57 3.48503 0.117
NP_441527.1_4 Forward -69 -50 -5.10924 0.195
NP_441527.1_4 Forward -73 -54 -8.06949 0.24
NP_441527.1_4 Forward -74 -55 -11.1252 0.278
NP_441527.1_4 Forward -75 -56 -11.6982 0.284
NP_441527.1_4 Forward -67 -48 -12.2711 0.285
NP_441527.1_7 Reverse -56 -75 9.63507 0.282
NP_440115.1_6 Forward -246 -236 5.48657 0.244
NP_440115.1_6 Forward -334 -324 4.69992 0.288
NP_441286.1_1 Forward -206 -194 10.9537 0.0145
NP_441286.1_1 Forward -292 -280 -5.17256 0.192
NP_440670.1_8 Forward -331 -322 3.34298 0.275
NP_442614.1_2 Forward -205 -191 10.6193 0.234
NP_439995.1_5 Reverse -186 -205 3.73603 0.291
NP_441589.1_5 Forward -317 -298 15.6907 0.262
NP_442794.1_1 Forward -282 -270 6.03717 0.198
NP_441401.1_4 Forward -78 -65 14.4739 0.225
NP_440387.1_1 Forward -243 -227 4.0901 0.0471
NP_441431.1_2 Reverse -266 -280 6.19383 0.279
NP_441431.1_3 Forward -285 -266 2.94938 0.279
NP_441836.1_2 Reverse -163 -182 -6.49039 0.298
NP_442357.1_8 Forward -230 -211 5.99764 0.241
NP_440293.1_3 Forward -286 -267 -6.49039 0.29
NP_440293.1_10 Forward -306 -287 -2.85214 0.275
NP_440766.1_5 Reverse -15 -27 9.47014 0.275
NP_440643.1_2 Forward -205 -186 5.30933 0.278
NP_440457.1_1 Reverse -278 -290 0.0389777 0.25
NP_440798.1_6 Reverse -323 -336 0.412608 0.267
NP_441332.1_6 Reverse -302 -312 10.7754 0.287
NP_442509.1_9 Forward -291 -281 14.1392 0.0375
NP_441489.1_3 Reverse -13 -27 12.5211 0.198
NP_440554.1_4 Reverse -323 -333 2.33998 0.267
NP_441885.1_5 Reverse -234 -244 1.25834 0.11
NP_441885.1_5 Reverse -282 -292 -0.314959 0.195
NP_442228.1_10 Forward -320 -301 11.7992 0.255
NP_440409.1_1 Forward -339 -320 -4.91709 0.284
NP_443000.1_7 Forward -207 -197 7.25653 0.0927
NP_443060.1_5 Forward -251 -232 6.29183 0.24
NP_441730.1_8 Reverse -13 -32 16.8141 0.24
NP_440216.1_1 Forward -243 -229 -12.3901 0.264
NP_440172.1_1 Forward -331 -321 5.87989 0.127
NP_440172.1_1 Forward -243 -233 4.99491 0.157
NP_440172.1_1 Forward -205 -195 4.60159 0.178
NP_442015.1_10 Forward -295 -282 1.88757 0.204
NP_441766.1_2 Reverse -371 -380 5.21127 0.134
NP_440416.1_9 Forward -286 -267 -18.9784 0.267
NP_443052.1_9 Reverse -284 -303 -6.58872 0.285
NP_440988.1_5 Reverse -291 -310 13.933 0.238
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GCACTACTATGAACGATATAAGAGATCGTGCCCTGAGAATGCAGAACAGTATGAATTCCTGGAACAGGAGGCAATCTCATCTAAAGCTGGGGTTTGGGCTAATGGAGATGCTGAACGCCCTTGGAATTGGCGTGGAAGGAATAAGTAGGGGTTGGTTGGCGATCAACTAAAGCTAGAATCACTCGGAAACTTTCTGGCGATCATGCCTAAATGGAGTGATGTGCCGAAAGTTTCCACATATAGTTACCTCAAAGAGTGTTGTACGGAAAATTTCCGTATAATCAATAGTTATACATGTAATTATCACTGATAAACTTCTGAGTAAAAAAAAGCAAATGACAAAAGAACATATAAACGCAATAGAATATATATAAATGTTTGTGCCAATTTGAAAAAATCT

CDS

ATGATATTTCCCTTTGATATAAATATAAACCTAAGCGATTCAGGCATAACTGGCATCCAGAATAAGACCATTACTATCAATGGAGGTGTTACGACTTTTCTAGGTCCAAATGGTTCTGGTAAAACCCAACTACTAAGAGGGTTGAAATTAAGCCTTAGAAGTTATGCAAATGGAAAAAAAATAAGATATATTTCTGCTGGAAGGCTAGGTCCGATGGAAGCCTACCGGTCAGATTATGATGGTCAAAGAGGAAGGCAAATAAGGTTTGATCAAGCAACATTTGGCGACAAATCATCTACAACCAGAAGACATAAGAACGAAACAATTTTAGGTGATTTTGGGACTTTATCTGAACGTCCCGATATACTCATTAAAGTTCAAGAAAGACTTAGAAAGCTATTTAAAAGAGACTTAATGTTAGATTGGGACGGTGGAAATCTTAAAGTATTTTTCTCTAGAGTAGACCAAGAAACTAGCTCGAATTATTCTTCTGCACGTGAGGCGAGTGGTCTTCTACATCTGGTTGCAATTCTAGCAGCCTTATACGATGATGAAGTAGGTTGCCTACTAATCGATGAACCTGAAGTGTCGCTTCATCCGCAATTACAATCCTTCGTAATGGATGAAATTTTAAAAGTTGCGGGTCCTAATAATGAAGCTGGTAAAAAACTGGTATTTATCTCTACGCATTCGACTGAATTTATTGAGGTTAATTCTGTAGAACAACTTTCAACAATAGTTTTTTGTAAAGACATTCTTGAAGAAGCTGTTCAAATAGACCCTTCAATAGGTGAATTTCGAAGTAGAAAATTACAAGCTCTTTTAACCAGACTAGGGCAAGAACACAAATTGGCTCTTTTTTGTCACTCGCCTCTTCTGGTAGAAGGCCCAAGTGATGAAATCATTTGTTCAGCAATTAACAGAAAGCTTAATATTAATCTAGAGGCAGCTGGCTCTCAAGTGCTTCCTGTAACTGGCAAAGGACAGTTTCCTGTAGTAATCAAATTATTGAGATTGATAGGTAAGTCTCCTGCACTACTTGCAGATGCAGATGCGTTAACTGATAATCTTGATATCATTGGAGTCTTTACGAGTCTTGACAAAGCGAATATTTTTGCAAATGAATTAGGTCATCGTGATGCCCCTGCACTTGCAGGAACCATTTACAATGATTTTTGCAAACTTGTGGCTGACCAATGGAGTAATATCCAAGCACAAGCTGAATTACACTATTATTGGATTAATAGAGATATAGATAAAGACGAACTAATTGCCAAGCGAAGAAGTGCATTTTGTTGGATGTTCTCTAATGATGAGACAAGTATATTGAATATCGACAATGGAGCGAATTGGGTTTCTATTAAGCATAGATTGTCGACGTTATTAGACTTATTAGAAAAACTAGGTTGCTTTATTCTAAAGAAAGGAACAGTCGAAGGCTATTATCAGCATGTATCTAATTTAACAAATGACGAAAAACCGAATGCAGCTTCCTATGAAGTAAATGGTTTAATGGAGGCAAATATTGAGGCTGTCACTACAGCATATGACGATATCCTTAGTGCTCTGAAATATTGTTCTCAAGCAAAGGATATTAATGAAGCAGAAGCAATTCGTGACTTGTTGCTTGCAGTTATCACACCAGCTTTAGCGAGCATTAAGAAAGAAACTTCAGATGCGGAATTGAGATTACATTCAAATAATTTATTTGGAGCCAAATCAAGTTTGTTTAAACTGAGCAAAGAACAGGATGGTAATGACATTTATCTTTTAGTTGAACTTGCCTCCAATATCCTTGAAGTCGAAGGTTTTCCACTAAGAATAAAGAAAGGAAGTAATCCAATTGATATGGTAAATAAAGCATTAAAATTAAAATAA

Protein

No sequence available