Your browser is old and dusty. Try Google Chrome!

Details for sll5063

ORF sll5063
Accession NP_942219.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -43 -29 -1.67204 0.269
NP_442657.1_1 Forward -246 -229 9.60133 0.289
NP_443032.1_6 Reverse -67 -86 15.6341 0.119
NP_441818.1_9 Forward -181 -162 -10.522 0.295
NP_441098.1_3 Forward -383 -364 2.2072 0.25
NP_440996.1_4 Forward -296 -286 16.598 0.182
NP_442752.1_4 Forward -145 -138 9.47889 0.109
NP_441745.1_4 Reverse -354 -373 6.48849 0.195
NP_441250.1_6 Reverse -72 -91 14.7491 0.295
NP_441054.1_2 Forward -181 -162 14.2574 0.171
NP_441208.1_9 Forward -195 -181 8.06273 0.219
NP_441434.1_3 Forward -98 -79 1.27776 0.196
NP_440842.1_10 Reverse -32 -46 4.22782 0.254
NP_441014.1_5 Forward -294 -276 12.7038 0.231
NP_441012.1_4 Forward -397 -384 6.31247 0.282
NP_440376.1_1 Reverse -183 -192 4.12963 0.173
NP_441846.1_10 Reverse -70 -89 -23.305 0.282
NP_440042.1_2 Forward -80 -61 -4.72043 0.293
NP_440667.1_2 Forward -181 -162 -3.93378 0.242
NP_442658.1_1 Reverse -130 -140 7.45273 0.214
NP_442544.1_2 Forward -86 -72 -1.47537 0.287
NP_441958.1_5 Reverse -182 -192 -0.314959 0.198
NP_440203.1_5 Forward -76 -66 11.2876 0.2
NP_440203.1_5 Forward -67 -57 10.0093 0.242
NP_442690.1_1 Reverse -354 -373 -12.9802 0.252
NP_442690.1_1 Reverse -353 -372 -16.2252 0.285
NP_443055.1_6 Forward -206 -188 3.06666 0.2
NP_441000.1_6 Reverse -127 -141 -4.91696 0.254
NP_440345.1_3 Reverse -302 -316 15.5768 0.209
NP_440736.1_3 Reverse -181 -200 2.65439 0.282
NP_440983.1_9 Reverse -52 -71 5.01433 0.285
NP_441644.1_6 Forward -192 -182 5.38779 0.194
NP_440929.1_8 Forward -192 -183 3.93297 0.197
NP_441751.2_8 Forward -69 -55 -4.22864 0.166
NP_442554.1_8 Forward -43 -33 4.0116 0.2
NP_441715.1_9 Reverse -35 -49 17.0108 0.261
NP_441613.1_1 Forward -54 -35 20.354 0.0488
NP_442808.1_1 Forward -71 -61 6.66608 0.102
NP_442789.1_4 Forward -43 -24 -2.95047 0.246
NP_441878.1_6 Forward -45 -35 -0.0199663 0.163
NP_442594.1_8 Reverse -67 -86 7.17762 0.214
NP_441512.1_10 Reverse -81 -100 15.2408 0.258
NP_440717.1_3 Reverse -139 -153 7.27547 0.28
NP_442785.1_7 Reverse -181 -195 10.816 0.228
NP_442069.1_4 Reverse -44 -63 5.60432 0.254
NP_440026.1_8 Forward -289 -271 13.0972 0.223
NP_441750.1_4 Reverse -94 -113 3.83436 0.23
NP_443051.1_5 Reverse -257 -276 10.9142 0.228
NP_442294.1_5 Forward -388 -378 18.3679 0.232
NP_440163.1_9 Reverse -44 -63 11.8975 0.281
NP_441060.1_3 Forward -41 -22 8.94757 0.228
NP_440562.1_10 Forward -201 -183 12.3105 0.206
NP_442750.1_3 Reverse -235 -254 -12.9802 0.295
NP_442280.1_10 Forward -53 -35 6.23363 0.28
NP_440990.1_10 Forward -155 -136 14.2574 0.293
NP_442067.1_3 Reverse -80 -99 14.8474 0.224
NP_440999.1_9 Reverse -380 -394 2.16287 0.154
NP_442033.1_10 Reverse -27 -46 -14.5535 0.299
NP_443064.1_6 Reverse -136 -146 9.85209 0.193
NP_442646.1_7 Forward -161 -142 2.65439 0.291
NP_441462.1_2 Reverse -183 -193 -0.806614 0.254
NP_441560.1_3 Reverse -52 -70 6.70565 0.28
NP_440865.1_9 Forward -153 -134 -9.53865 0.293
NP_442907.1_9 Reverse -35 -54 -1.18052 0.233
NP_442813.1_1 Reverse -36 -55 21.0423 0.0084
NP_442694.1_4 Reverse -84 -93 11.0128 0.286
NP_442308.1_3 Reverse -26 -45 13.4708 0.251
NP_442001.1_4 Reverse -281 -300 7.37347 0.29
NP_441982.1_6 Reverse -307 -316 13.5358 0.274
NP_442843.1_1 Forward -398 -379 -11.7019 0.291
NP_442450.1_3 Reverse -342 -360 7.88485 0.211
NP_440588.1_2 Reverse -89 -108 -2.16383 0.161
NP_441031.1_1 Forward -386 -367 5.66585 0.282
NP_440040.1_4 Reverse -228 -247 10.7175 0.123
NP_441570.1_1 Forward -70 -52 -9.51896 0.139
NP_442348.1_2 Reverse -83 -92 7.57121 0.28
NP_440526.1_3 Reverse -284 -295 5.76138 0.233
NP_441432.1_8 Reverse -182 -191 12.2911 0.0444
NP_442489.1_7 Forward -192 -183 -1.47524 0.203
NP_440335.1_9 Forward -105 -87 10.1472 0.28
NP_442346.1_10 Reverse -379 -398 -3.24547 0.294
NP_441585.1_5 Forward -400 -381 3.53858 0.255
NP_441329.1_6 Reverse -368 -387 2.62561 0.225
NP_442821.1_7 Reverse -39 -58 16.3224 0.295
NP_440227.1_6 Forward -379 -365 14.8129 0.263
NP_442082.1_4 Forward -262 -243 4.916 0.265
NP_441541.1_1 Reverse -240 -258 -2.95826 0.264
NP_442402.1_1 Reverse -80 -99 8.84924 0.278
NP_442402.1_2 Reverse -85 -99 11.4053 0.272
NP_442402.1_4 Reverse -80 -99 -8.06442 0.278
NP_442402.1_6 Forward -100 -91 13.2744 0.289
NP_441848.1_4 Forward -102 -86 8.88755 0.288
NP_441084.1_6 Forward -46 -32 10.1198 0.254
NP_442039.1_10 Reverse -145 -163 13.7847 0.227
NP_442817.1_5 Reverse -24 -43 12.2908 0.203
NP_442471.1_6 Reverse -133 -152 15.2408 0.231
NP_441011.1_9 Reverse -356 -375 10.7175 0.277
NP_442533.1_6 Reverse -35 -44 1.57302 0.294
NP_442541.1_10 Forward -44 -30 2.06395 0.269
NP_443016.1_1 Reverse -29 -48 0.786102 0.193
NP_441482.1_7 Reverse -218 -232 -12.0951 0.29
NP_441697.1_5 Forward -275 -256 -9.50187 0.268
NP_441028.1_6 Reverse -89 -99 4.89613 0.275
NP_441527.1_4 Forward -212 -193 -3.29489 0.164
NP_441527.1_4 Forward -377 -358 -7.30556 0.232
NP_440007.1_9 Reverse -220 -234 0.786239 0.29
NP_441170.1_4 Reverse -26 -44 4.83737 0.232
NP_441972.1_5 Forward -43 -24 -7.67036 0.252
NP_440670.1_8 Forward -192 -183 3.14632 0.296
NP_440886.1_7 Reverse -189 -199 4.50281 0.232
NP_442125.1_2 Forward -376 -357 12.1925 0.0485
NP_441463.1_3 Forward -80 -61 -8.65367 0.272
NP_441836.1_2 Forward -55 -36 -4.03212 0.251
NP_442084.1_6 Forward -380 -362 8.7706 0.221
NP_441801.1_4 Reverse -387 -397 3.12662 0.231
NP_441173.1_9 Reverse -90 -98 10.9338 0.242
NP_443000.1_7 Reverse -59 -69 2.33998 0.226
NP_442495.1_5 Reverse -24 -43 7.17762 0.291
NP_440216.1_1 Forward -192 -178 -6.39192 0.143
NP_440172.1_1 Forward -192 -182 2.14332 0.283
NP_442418.1_4 Reverse -318 -336 16.4266 0.215
NP_441757.1_3 Forward -287 -268 -1.86883 0.259
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACTCCAGGGCAGTTATTGCTGTTAAGATAATTAAAGGAAAAAAGTATTTGTTAAGTGCTATTGTAGAATCTGAAAGACGGCTACTTTTTGAGTATATATATTCCAAGTTGGGCTGGTGCTCATGCAAAAGTTCTACTGTTTGTTATACAAAGAATTAATTTCGTCACTCGGATAACCCTGGTTGACTGACAAAAGATGATTGGAAGTAGCCGAATGCCTTGTGGTGAGGTAGTTTTGGGTACTGTATGGAAGAAGGGGGAGCCAGCGTTCTAACCTTAGATACCACTCAAAAGCGTGAACACTGTGGAAAAACTCCCCCCTCTACAATGCCTTGAACGCCTTGCTTGGTCAATCCGTGCCCTGGGCACATCGAGGTCATTTAACGACCTGTCTGTGGATG

CDS

GTGATAGCCTTGCTTCAGCGAGGGGAAGTTAGCCTAACGCTGTGGTTACCCTATATTCCGTGTCGAGGGGTGCAGGCCCAAAGTAAACAACGGCGTTTGAGTCGTTGGCTACACAATAGTCGTCTGAACGTGCACCGCCTATACAAGTCACTGATTCAGGCAGCATTGGCGGATTGGCAGGAAGAGATTTTGTACCTAAGCTTAGACACTTCGCTGTTTTGGGACGAGTATTGCTTGGTACGCCTAGCGGTTGTCTACCGAGGTCGGGCATTGCCCGTGGTTTGGCGGGTACTCAAACACCGCAGTGCCTCCATTGCTTTCCGTCAGTATTGGGAGATGCTCTATCAAGCCGCCAACCGATTGTCCCAAGGAGTGAAGGTAGTCCTGCTCGCCGACCGGGGTTTTATTCACACCGATGCGATGACCGCTGTCACGACCCATTTGGGGTGGCATTACCGAATTCGGCTCAAGCGAAATACTTGGATTTGGCGGGCTGGCCATGGATGGTGTCAATTTAAAGACATTCACCTTCAGCGTGGGGAGGCATTTTGCTGGCACAACGTTAGGCTCCATAAAGGTGACTACTATGGCCCAGTCCATGTGGCTTTTGGCTGCAACAACGTCAATGGGGAGTTTTGGGCTATTGTTCAGTGA

Protein

No sequence available