Your browser is old and dusty. Try Google Chrome!

Details for sll5059

ORF sll5059
Accession NP_942215.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -217 -231 6.98109 0.11
NP_441061.1_2 Reverse -136 -150 -0.688726 0.237
NP_441061.1_2 Forward -224 -210 -1.8687 0.274
NP_440795.1_7 Forward -224 -217 14.6904 0.0123
NP_440795.1_7 Reverse -217 -224 14.6904 0.0123
NP_441418.1_6 Forward -225 -206 -11.8003 0.0565
NP_441418.1_6 Reverse -216 -235 -11.8986 0.0576
NP_441480.1_10 Reverse -160 -179 7.47261 0.286
NP_442291.1_5 Reverse -215 -231 3.79511 0.105
NP_442291.1_5 Reverse -100 -116 -1.61309 0.201
NP_440897.1_6 Forward -225 -206 14.9449 0.0364
NP_441453.1_4 Reverse -216 -224 16.539 0.00633
NP_441453.1_4 Forward -225 -217 16.539 0.00633
NP_441818.1_1 Reverse -217 -228 9.69459 0.232
NP_441818.1_1 Forward -27 -16 9.30127 0.246
NP_440226.1_1 Reverse -216 -235 17.2074 0.0197
NP_440226.1_1 Forward -225 -206 5.30933 0.161
NP_441630.1_3 Forward -233 -214 -0.000545616 0.285
NP_441630.1_3 Reverse -208 -227 -1.18052 0.293
NP_440150.1_6 Forward -228 -209 6.88262 0.223
NP_442173.1_1 Forward -224 -216 15.4574 0.00633
NP_442173.1_1 Reverse -217 -225 15.4574 0.00633
NP_442752.1_4 Forward -225 -218 13.8055 0.0199
NP_442752.1_4 Reverse -216 -223 13.8055 0.0199
NP_443027.1_4 Forward -227 -217 14.828 0.0437
NP_443027.1_4 Reverse -214 -224 13.943 0.0452
NP_443027.1_4 Reverse -307 -317 9.12481 0.177
NP_441812.1_3 Reverse -215 -229 14.9459 0.106
NP_442975.1_10 Forward -229 -215 13.8636 0.0459
NP_442975.1_10 Reverse -212 -226 3.73557 0.252
NP_440784.1_7 Forward -224 -217 15.9687 0.0123
NP_440784.1_7 Reverse -217 -224 15.9687 0.0123
NP_440061.1_9 Forward -227 -213 12.3887 0.0971
NP_440061.1_9 Reverse -72 -86 4.91554 0.3
NP_442062.1_8 Forward -225 -215 19.4496 0.000558
NP_442062.1_8 Reverse -216 -226 19.4496 0.000558
NP_442062.1_8 Forward -210 -200 3.32329 0.275
NP_440761.1_4 Forward -155 -136 -20.4534 0.287
NP_441859.1_3 Forward -226 -207 5.50519 0.198
NP_441859.1_3 Reverse -215 -234 3.34192 0.244
NP_440304.1_4 Forward -227 -217 10.8948 0.051
NP_440304.1_4 Reverse -214 -224 9.91146 0.051
NP_442242.1_4 Forward -224 -217 14.3954 0.0124
NP_442242.1_4 Reverse -217 -224 14.3954 0.0124
NP_441208.1_9 Reverse -213 -227 6.09611 0.253
NP_441594.1_6 Forward -153 -134 4.81767 0.211
NP_441491.1_6 Forward -354 -340 15.1747 0.265
NP_442726.1_1 Reverse -217 -236 8.84924 0.268
NP_441083.1_5 Forward -225 -215 11.3864 0.0159
NP_441083.1_5 Reverse -216 -226 11.3864 0.0159
NP_441083.1_5 Reverse -365 -375 3.32329 0.173
NP_442827.1_8 Reverse -208 -227 5.60352 0.115
NP_441149.1_9 Reverse -227 -246 -1.27961 0.282
NP_441141.1_4 Forward -316 -297 9.53756 0.292
NP_440109.1_6 Reverse -131 -150 7.57094 0.268
NP_441738.1_2 Forward -223 -216 15.28 0.0102
NP_441738.1_2 Reverse -218 -225 15.28 0.0102
NP_441558.1_5 Forward -227 -208 4.03102 0.293
NP_440209.1_1 Reverse -216 -224 18.1123 0.00295
NP_440209.1_1 Forward -225 -217 18.1123 0.00295
NP_440870.1_4 Reverse -210 -228 3.06741 0.163
NP_442889.1_8 Forward -228 -214 4.03056 0.27
NP_441713.1_1 Reverse -210 -229 -15.1435 0.26
NP_440178.1_5 Reverse -222 -231 18.6826 0.137
NP_441716.1_1 Forward -225 -211 13.8643 0.0689
NP_442111.1_4 Forward -226 -212 8.35772 0.0758
NP_442111.1_4 Reverse -84 -98 2.06454 0.291
NP_441163.1_1 Reverse -208 -225 8.98622 0.226
NP_440906.1_5 Forward -224 -217 15.8704 0.0124
NP_440906.1_5 Reverse -217 -224 15.8704 0.0124
NP_440747.1_10 Forward -228 -216 -2.02597 0.0196
NP_440747.1_10 Reverse -213 -225 -2.02597 0.0196
NP_441130.1_10 Forward -227 -213 20.9441 0.00768
NP_441130.1_10 Reverse -214 -228 11.2093 0.107
NP_441486.1_1 Forward -228 -214 11.8976 0.0137
NP_441486.1_1 Reverse -213 -227 10.3243 0.0209
NP_442634.1_2 Reverse -210 -229 8.16093 0.161
NP_442634.1_4 Reverse -214 -228 -3.63866 0.161
NP_442634.1_4 Forward -35 -21 -4.52363 0.206
NP_441265.1_3 Reverse -210 -224 5.99778 0.181
NP_442848.1_1 Forward -231 -217 -2.95034 0.263
NP_442848.1_1 Reverse -210 -224 -3.73699 0.27
NP_442848.1_5 Reverse -134 -152 4.54237 0.276
NP_443018.1_3 Forward -224 -217 14.8871 0.0123
NP_443018.1_3 Reverse -217 -224 14.8871 0.0123
NP_443018.1_3 Forward -317 -310 4.07068 0.299
NP_441316.1_7 Forward -227 -212 -3.36336 0.273
NP_441634.1_8 Forward -227 -213 12.8809 0.047
NP_441634.1_8 Reverse -302 -316 2.5562 0.167
NP_441634.1_8 Forward -30 -16 -1.77037 0.295
NP_441634.1_8 Reverse -214 -228 -4.32697 0.295
NP_440376.1_1 Forward -225 -216 19.4693 0.000692
NP_440376.1_1 Reverse -216 -225 19.4693 0.000692
NP_441857.1_5 Reverse -209 -227 3.16574 0.246
NP_441588.1_4 Reverse -218 -228 6.96153 0.178
NP_442687.1_7 Forward -226 -216 15.8113 0.0125
NP_442687.1_7 Reverse -215 -225 15.8113 0.0125
NP_442191.1_4 Forward -224 -210 13.7079 0.132
NP_441422.1_7 Forward -227 -210 -4.68105 0.247
NP_441763.1_5 Reverse -203 -222 -4.52377 0.24
NP_442658.1_1 Reverse -214 -224 18.7607 0.00222
NP_442658.1_1 Forward -227 -217 15.9091 0.00966
NP_440141.1_8 Reverse -207 -226 7.07928 0.249
NP_440656.1_8 Forward -236 -217 -3.73712 0.198
NP_441414.1_9 Forward -225 -206 5.30933 0.048
NP_441414.1_9 Reverse -216 -235 -9.44032 0.259
NP_441958.1_5 Forward -226 -216 12.2714 0.00183
NP_441958.1_5 Reverse -215 -225 12.2714 0.00183
NP_440950.1_8 Forward -60 -41 9.33841 0.298
NP_442816.1_7 Forward -292 -273 5.49036 0.246
NP_439905.1_1 Forward -224 -211 9.85238 0.216
NP_442911.1_2 Reverse -206 -225 8.94757 0.0188
NP_442911.1_2 Forward -235 -216 -1.27885 0.0834
NP_440153.1_5 Forward -224 -210 4.22782 0.199
NP_441591.1_10 Forward -227 -208 8.84924 0.227
NP_442119.1_9 Forward -226 -207 14.9458 0.21
NP_440993.1_2 Forward -230 -214 7.92501 0.157
NP_440602.1_8 Reverse -216 -230 15.9292 0.115
NP_441099.1_8 Reverse -24 -42 14.5713 0.158
NP_442002.1_9 Forward -226 -219 10.7572 0.185
NP_442002.1_9 Reverse -215 -222 10.7572 0.185
NP_441294.1_7 Reverse -212 -226 10.5945 0.181
NP_442438.1_10 Reverse -211 -225 14.3559 0.0311
NP_442438.1_10 Forward -230 -216 1.76955 0.188
NP_441292.1_2 Reverse -205 -224 -5.31042 0.241
NP_441000.1_6 Reverse -215 -229 13.2743 0.0396
NP_441000.1_6 Forward -226 -212 12.8809 0.0396
NP_441000.1_6 Reverse -84 -98 -0.393733 0.204
NP_441000.1_6 Forward -319 -305 -3.54032 0.224
NP_442771.1_1 Forward -227 -209 -6.96235 0.169
NP_441674.1_6 Forward -224 -205 4.22769 0.261
NP_440147.1_4 Forward -227 -214 11.524 0.0326
NP_440147.1_4 Reverse -214 -227 2.08423 0.21
NP_441550.1_8 Reverse -214 -224 10.501 0.066
NP_441550.1_8 Forward -227 -217 6.0761 0.214
NP_441550.1_8 Forward -376 -366 5.48612 0.247
NP_441550.1_8 Reverse -363 -373 5.38779 0.252
NP_441916.1_7 Forward -225 -215 18.4663 0.00144
NP_441916.1_7 Reverse -216 -226 18.4663 0.00144
NP_441916.1_7 Forward -192 -182 3.22496 0.223
NP_441916.1_10 Forward -152 -133 11.9958 0.127
NP_441041.1_7 Forward -228 -216 10.916 0.0864
NP_441041.1_7 Reverse -213 -225 10.2357 0.1
NP_441725.1_5 Reverse -217 -227 11.2881 0.0247
NP_441725.1_5 Forward -224 -214 9.02648 0.0553
NP_439966.1_7 Forward -227 -217 18.4657 0.00473
NP_439966.1_7 Reverse -214 -224 17.4824 0.00636
NP_439966.1_9 Reverse -214 -223 10.7178 0.0863
NP_439966.1_9 Forward -227 -218 0.983037 0.253
NP_442941.1_3 Reverse -217 -227 11.4848 0.0116
NP_442941.1_3 Forward -224 -214 2.53664 0.14
NP_440289.1_2 Forward -228 -215 14.6706 0.0107
NP_440289.1_2 Reverse -213 -226 3.5592 0.0767
NP_441514.1_1 Reverse -105 -115 14.727 0.274
NP_442281.1_1 Forward -230 -216 20.7467 0.00192
NP_442281.1_1 Reverse -313 -327 3.34225 0.235
NP_441334.1_7 Reverse -199 -218 -4.81876 0.12
NP_441334.1_7 Forward -227 -208 -20.5517 0.277
NP_441079.1_7 Reverse -107 -126 -5.80282 0.268
NP_442256.1_2 Reverse -214 -232 -8.92897 0.241
NP_440437.1_1 Forward -231 -212 0.58944 0.168
NP_440437.1_1 Reverse -210 -229 0.294447 0.172
NP_441556.1_7 Reverse -205 -224 6.68515 0.171
NP_441644.1_6 Forward -225 -215 10.1076 0.0628
NP_441644.1_6 Reverse -216 -226 10.1076 0.0628
NP_441644.1_6 Forward -185 -175 3.42118 0.282
NP_442215.1_2 Reverse -214 -230 -4.66135 0.237
NP_442215.1_2 Forward -224 -208 -7.31629 0.291
NP_440253.1_2 Reverse -216 -234 17.1287 0.0115
NP_440929.1_8 Forward -225 -216 19.2726 0.000701
NP_440929.1_8 Reverse -216 -225 19.2726 0.000701
NP_442933.1_10 Forward -225 -216 17.601 0.00325
NP_442933.1_10 Reverse -216 -225 17.601 0.00325
NP_441751.2_8 Reverse -217 -231 -2.55701 0.132
NP_441751.2_8 Forward -224 -210 -3.24533 0.137
NP_442926.1_1 Forward -314 -295 -0.295539 0.254
NP_442554.1_8 Forward -224 -214 16.008 0.0065
NP_442554.1_8 Reverse -217 -227 13.8447 0.0145
NP_442554.1_8 Forward -317 -307 7.05986 0.0993
NP_441762.1_7 Forward -226 -214 21.5735 0.00342
NP_441762.1_7 Reverse -215 -227 12.0354 0.0142
NP_442142.1_4 Forward -228 -215 18.4065 0.0255
NP_442142.1_4 Reverse -213 -226 8.57349 0.112
NP_442292.1_1 Forward -224 -215 9.63616 0.0183
NP_442292.1_1 Reverse -217 -226 9.63616 0.0183
NP_442476.1_6 Forward -224 -210 5.21113 0.139
NP_442381.1_8 Reverse -213 -232 -4.91709 0.14
NP_443009.1_5 Reverse -215 -226 11.6612 0.0602
NP_443009.1_5 Forward -226 -215 11.6612 0.0602
NP_441715.1_4 Reverse -217 -227 16.303 0.0117
NP_441715.1_4 Forward -224 -214 9.32148 0.097
NP_440379.1_5 Forward -225 -206 -1.67217 0.192
NP_441468.1_1 Forward -224 -217 15.8704 0.0124
NP_441468.1_1 Reverse -217 -224 15.8704 0.0124
NP_441468.1_1 Forward -317 -310 10.9539 0.0726
NP_441020.2_6 Reverse -214 -231 21.5733 0.00253
NP_441015.1_10 Forward -317 -298 -10.4236 0.284
NP_441673.1_1 Forward -225 -216 20.8459 0.000698
NP_441673.1_1 Reverse -216 -225 20.8459 0.000698
NP_441826.1_2 Forward -231 -217 1.27789 0.157
NP_441826.1_2 Reverse -210 -224 1.08123 0.164
NP_441826.1_2 Forward -34 -20 -3.34366 0.284
NP_442868.1_6 Reverse -214 -224 8.53483 0.0555
NP_442868.1_6 Forward -227 -217 0.963343 0.205
NP_442719.1_2 Reverse -128 -146 -3.71814 0.201
NP_441251.1_7 Forward -275 -262 11.0324 0.277
NP_442361.1_3 Forward -231 -218 7.88576 0.285
NP_442808.1_1 Forward -226 -216 18.4657 0.00201
NP_442808.1_1 Reverse -215 -225 18.4657 0.00201
NP_442808.1_1 Reverse -76 -86 1.5529 0.282
NP_440568.1_7 Reverse -166 -185 15.8307 0.299
NP_442542.1_2 Reverse -214 -227 12.409 0.114
NP_442542.1_2 Reverse -181 -194 5.72248 0.253
NP_442542.1_9 Reverse -209 -223 4.91554 0.28
NP_442113.1_10 Forward -229 -210 -8.45701 0.282
NP_442050.1_5 Forward -227 -217 9.12434 0.193
NP_442050.1_5 Reverse -214 -224 8.23937 0.234
NP_441114.1_3 Reverse -20 -29 7.37455 0.239
NP_440558.1_2 Forward -219 -200 1.86774 0.175
NP_440558.1_2 Forward -37 -18 -1.08219 0.208
NP_440558.1_2 Reverse -15 -34 -6.09707 0.271
NP_441518.1_3 Forward -235 -216 4.03102 0.05
NP_441878.1_6 Forward -226 -216 10.4031 0.0176
NP_441878.1_6 Reverse -215 -225 10.4031 0.0176
NP_441036.1_8 Forward -226 -216 17.7779 0.000554
NP_441036.1_8 Reverse -215 -225 17.7779 0.000554
NP_441557.1_4 Forward -275 -261 9.93102 0.291
NP_441557.1_5 Forward -225 -216 19.9609 0.000699
NP_441557.1_5 Reverse -216 -225 19.9609 0.000699
NP_441445.1_1 Forward -234 -215 11.1109 0.0895
NP_441445.1_1 Reverse -207 -226 8.65258 0.117
NP_441308.1_8 Forward -227 -217 10.1081 0.22
NP_441308.1_8 Reverse -214 -224 9.22315 0.226
NP_441458.1_8 Reverse -261 -280 7.57817 0.229
NP_442183.1_1 Reverse -216 -230 19.4691 0.00583
NP_442183.1_1 Reverse -101 -115 6.3911 0.176
NP_441549.1_9 Reverse -294 -312 -8.24065 0.223
NP_442347.1_2 Forward -224 -215 11.1111 0.056
NP_442347.1_2 Reverse -217 -226 11.1111 0.056
NP_442347.1_2 Reverse -167 -176 4.62128 0.274
NP_441037.1_4 Reverse -214 -224 16.2838 0.0168
NP_441037.1_4 Forward -227 -217 7.02532 0.237
NP_440563.1_6 Reverse -97 -110 18.8005 0.124
NP_441633.1_3 Forward -227 -214 13.3923 0.018
NP_441633.1_3 Reverse -214 -227 3.5592 0.0699
NP_440136.1_2 Forward -224 -217 15.9687 0.0123
NP_440136.1_2 Reverse -217 -224 15.9687 0.0123
NP_442998.1_5 Reverse -335 -345 9.41981 0.241
NP_442998.1_10 Forward -223 -216 15.5754 0.0102
NP_442998.1_10 Reverse -218 -225 15.5754 0.0102
NP_440299.1_1 Reverse -212 -225 13.5883 0.0298
NP_440299.1_1 Forward -229 -216 2.28034 0.292
NP_441799.1_1 Reverse -212 -226 16.6169 0.0138
NP_441799.1_1 Forward -229 -215 11.307 0.0591
NP_440256.1_1 Forward -228 -209 -0.197208 0.0907
NP_440256.1_1 Reverse -213 -232 -3.63879 0.137
NP_440087.1_1 Forward -327 -308 -8.45701 0.28
NP_441559.1_8 Reverse -211 -225 9.73436 0.0625
NP_440915.1_6 Reverse -212 -226 4.71948 0.0953
NP_440915.1_6 Reverse -172 -186 -0.590395 0.202
NP_440915.1_6 Forward -229 -215 -3.147 0.29
NP_441296.1_9 Reverse -137 -150 10.5401 0.262
NP_440134.1_2 Forward -147 -128 3.04771 0.298
NP_442866.1_1 Reverse -211 -230 -2.95047 0.216
NP_441464.1_8 Forward -225 -211 8.55439 0.194
NP_441939.1_3 Forward -224 -205 11.1109 0.118
NP_442993.1_1 Reverse -216 -232 1.73016 0.0502
NP_440677.1_1 Reverse -204 -223 9.83255 0.181
NP_442386.1_9 Reverse -215 -224 15.7322 0.0144
NP_442386.1_9 Forward -226 -217 15.7322 0.0144
NP_442386.1_9 Reverse -317 -326 4.81753 0.282
NP_441340.1_5 Forward -224 -217 15.6737 0.0124
NP_441340.1_5 Reverse -217 -224 15.6737 0.0124
NP_441340.1_9 Forward -241 -231 7.29115 0.289
NP_441947.1_4 Forward -236 -217 15.0441 0.16
NP_442791.1_5 Reverse -208 -227 -8.35868 0.279
NP_440161.1_3 Reverse -214 -233 19.9606 0.0516
NP_441027.1_1 Forward -271 -257 11.7003 0.27
NP_440586.1_1 Reverse -209 -228 -2.75381 0.259
NP_440586.1_8 Forward -224 -217 13.2151 0.026
NP_440586.1_8 Reverse -217 -224 13.2151 0.026
NP_442251.1_6 Forward -224 -217 15.2804 0.0124
NP_442251.1_6 Reverse -217 -224 15.2804 0.0124
NP_442959.1_4 Reverse -289 -308 10.1275 0.216
NP_440684.1_9 Forward -231 -217 8.94771 0.221
NP_441262.1_3 Reverse -216 -223 14.7888 0.0223
NP_441262.1_3 Forward -225 -218 14.7888 0.0223
NP_440027.1_3 Forward -225 -207 1.5917 0.3
NP_443051.1_1 Reverse -215 -224 10.4228 0.00754
NP_443051.1_1 Forward -226 -217 10.4228 0.00754
NP_439937.1_8 Reverse -214 -233 -2.45882 0.259
NP_439937.1_8 Forward -227 -208 -4.42544 0.284
NP_439937.1_9 Forward -226 -209 10.9528 0.04
NP_443039.1_7 Reverse -136 -150 7.76712 0.19
NP_440439.1_1 Reverse -213 -226 19.0955 0.0105
NP_440439.1_1 Forward -228 -215 8.37742 0.0537
NP_440372.1_2 Forward -224 -217 16.3621 0.0124
NP_440372.1_2 Reverse -217 -224 16.3621 0.0124
NP_441803.1_2 Forward -230 -211 3.6377 0.191
NP_439977.1_5 Reverse -303 -322 -1.67217 0.257
NP_440139.1_1 Forward -231 -212 6.48849 0.141
NP_441572.1_7 Forward -324 -305 -5.31042 0.257
NP_440267.1_2 Forward -230 -216 9.43874 0.156
NP_442384.1_10 Forward -225 -212 10.2457 0.0465
NP_442114.1_4 Forward -225 -214 12.1534 0.107
NP_442262.1_10 Forward -224 -217 14.1988 0.0123
NP_442262.1_10 Reverse -217 -224 14.1988 0.0123
NP_442262.1_10 Forward -317 -310 9.47889 0.187
NP_442262.1_10 Forward -209 -202 7.6106 0.274
NP_441689.1_5 Forward -227 -217 8.53436 0.132
NP_442244.1_6 Forward -228 -209 1.0811 0.291
NP_440163.1_10 Forward -228 -218 15.2213 0.0762
NP_440344.1_10 Forward -232 -215 16.9518 0.00338
NP_440344.1_10 Reverse -209 -226 5.34871 0.0214
NP_440531.1_6 Reverse -208 -227 -4.22878 0.278
NP_442693.1_6 Reverse -170 -189 -0.983855 0.297
NP_440297.1_9 Reverse -217 -227 9.32148 0.0917
NP_440297.1_9 Reverse -310 -320 0.373358 0.282
NP_440297.1_9 Forward -224 -214 -0.216628 0.282
NP_440350.1_5 Reverse -39 -58 -5.31042 0.289
NP_442280.1_10 Reverse -299 -317 4.77262 0.294
NP_441896.1_3 Reverse -207 -226 1.57275 0.213
NP_440999.1_9 Reverse -212 -226 3.14618 0.135
NP_440999.1_9 Forward -226 -212 -0.393733 0.205
NP_440888.1_2 Forward -225 -211 18.1901 0.00261
NP_440888.1_2 Reverse -216 -230 14.5519 0.0168
NP_442277.1_4 Reverse -207 -226 5.40686 0.175
NP_441543.1_2 Forward -224 -215 18.486 0.00236
NP_441543.1_2 Reverse -217 -226 18.486 0.00236
NP_441551.1_5 Reverse -212 -228 12.5458 0.15
NP_441469.1_8 Reverse -215 -224 16.126 0.00797
NP_441469.1_8 Forward -226 -217 16.126 0.00797
NP_441469.1_8 Forward -319 -310 10.7178 0.202
NP_441469.1_8 Reverse -308 -317 6.39124 0.227
NP_442337.1_8 Forward -115 -96 3.24438 0.217
NP_442578.1_7 Forward -224 -217 14.5921 0.026
NP_442578.1_7 Reverse -217 -224 14.5921 0.026
NP_441462.1_2 Forward -225 -215 11.5831 0.00406
NP_441462.1_2 Reverse -216 -226 11.5831 0.00406
NP_441621.1_7 Forward -227 -213 6.09611 0.068
NP_441621.1_7 Reverse -214 -228 5.99778 0.068
NP_443062.1_1 Reverse -216 -234 11.2761 0.102
NP_443062.1_6 Reverse -208 -227 9.43923 0.126
NP_443062.1_6 Forward -233 -214 4.12936 0.221
NP_443062.1_6 Forward -95 -76 1.57275 0.272
NP_442204.1_1 Forward -214 -203 9.9901 0.0736
NP_442204.1_1 Reverse -172 -183 2.91027 0.266
NP_441560.1_10 Forward -233 -214 5.40766 0.294
NP_440516.1_8 Forward -225 -216 16.9127 0.00442
NP_440516.1_8 Reverse -216 -225 16.9127 0.00442
NP_441785.1_1 Reverse -216 -230 14.3866 0.161
NP_442428.1_5 Forward -224 -217 15.8704 0.0124
NP_442428.1_5 Reverse -217 -224 15.8704 0.0124
NP_442428.1_5 Forward -317 -310 4.66067 0.244
NP_442120.1_10 Forward -150 -131 -10.817 0.261
NP_440673.1_3 Forward -223 -216 12.4288 0.0426
NP_440673.1_3 Reverse -218 -225 12.4288 0.0426
NP_441714.1_3 Reverse -209 -227 14.2763 0.191
NP_441052.1_2 Forward -225 -215 10.5014 0.0285
NP_441052.1_2 Reverse -216 -226 10.5014 0.0285
NP_441052.1_2 Forward -83 -73 1.35667 0.248
NP_442219.1_9 Forward -224 -215 8.35786 0.0681
NP_442219.1_9 Reverse -217 -226 8.35786 0.0681
NP_440436.1_4 Forward -224 -215 18.1905 0.00233
NP_440436.1_4 Reverse -217 -226 18.1905 0.00233
NP_441884.1_8 Forward -226 -207 -8.94866 0.265
NP_441884.1_9 Forward -228 -209 -2.36049 0.0594
NP_441884.1_9 Reverse -213 -232 -23.6 0.284
NP_440689.1_7 Reverse -71 -89 17.2262 0.221
NP_440314.1_9 Reverse -310 -329 -5.50708 0.224
NP_441719.1_4 Forward -224 -217 16.3621 0.0124
NP_441719.1_4 Reverse -217 -224 16.3621 0.0124
NP_441733.1_10 Reverse -213 -226 10.934 0.106
NP_441733.1_10 Forward -228 -215 10.2457 0.106
NP_442366.1_3 Reverse -215 -233 15.0638 0.0212
NP_439949.1_7 Forward -275 -261 16.3225 0.176
NP_440129.1_10 Forward -232 -218 13.2743 0.0557
NP_441115.1_4 Forward -226 -208 7.29487 0.291
NP_443054.1_2 Forward -227 -213 12.4876 0.0722
NP_443054.1_2 Reverse -214 -228 3.63784 0.24
NP_441851.1_10 Forward -226 -216 16.008 0.00552
NP_441851.1_10 Reverse -215 -225 16.008 0.00552
NP_441851.1_10 Forward -319 -309 4.99491 0.233
NP_442622.1_1 Forward -226 -207 -11.4069 0.257
NP_442856.1_7 Forward -219 -200 -5.11376 0.272
NP_442515.1_1 Forward -226 -212 -4.13031 0.298
NP_440165.1_5 Reverse -215 -234 -7.27704 0.259
NP_440165.1_5 Forward -211 -192 -7.76869 0.276
NP_442709.1_10 Reverse -246 -265 19.6656 0.0894
NP_440940.1_7 Reverse -206 -224 14.6697 0.0726
NP_441349.1_10 Forward -235 -216 -6.98204 0.239
NP_440432.1_9 Reverse -217 -232 0.471552 0.159
NP_440474.1_8 Forward -224 -210 15.4369 0.0566
NP_440474.1_8 Reverse -217 -231 14.7486 0.0595
NP_442450.1_5 Forward -227 -217 9.32148 0.115
NP_440588.1_2 Reverse -207 -226 1.0811 0.139
NP_442006.1_2 Reverse -207 -224 -15.9891 0.235
NP_441570.1_1 Reverse -216 -234 0.412472 0.0394
NP_441570.1_1 Forward -225 -207 -5.58572 0.0758
NP_441078.1_4 Forward -225 -216 19.6659 0.0007
NP_441078.1_4 Reverse -216 -225 19.6659 0.0007
NP_442348.1_2 Forward -272 -263 7.96454 0.28
NP_442348.1_2 Forward -327 -318 7.47288 0.28
NP_440526.1_3 Forward -224 -213 2.41814 0.267
NP_440526.1_3 Reverse -217 -228 1.92649 0.267
NP_441432.1_8 Reverse -215 -224 8.25953 0.0755
NP_441432.1_8 Forward -226 -217 8.25953 0.0755
NP_441432.1_8 Forward -34 -25 2.55633 0.298
NP_442320.1_8 Forward -231 -217 12.8809 0.016
NP_441732.1_2 Forward -229 -213 -6.43131 0.0495
NP_441732.1_2 Forward -214 -198 -15.9694 0.164
NP_440199.1_10 Forward -228 -218 14.533 0.0861
NP_442400.1_1 Reverse -213 -232 -3.44213 0.243
NP_440713.1_4 Reverse -206 -225 13.2741 0.0988
NP_442489.1_7 Forward -225 -216 20.1576 0.000695
NP_442489.1_7 Reverse -216 -225 20.1576 0.000695
NP_440559.1_1 Reverse -217 -226 8.75118 0.0586
NP_440559.1_1 Forward -224 -215 8.75118 0.0586
NP_441659.2_8 Forward -225 -215 11.9764 0.0147
NP_441659.2_8 Reverse -216 -226 11.9764 0.0147
NP_441659.2_8 Forward -185 -175 2.63497 0.195
NP_442776.1_1 Forward -221 -202 12.2908 0.127
NP_440779.1_5 Reverse -216 -233 -6.15601 0.164
NP_440779.1_5 Forward -225 -208 -14.1208 0.243
NP_442346.1_5 Forward -226 -216 9.02648 0.118
NP_442346.1_5 Reverse -215 -225 9.02648 0.118
NP_442346.1_10 Forward -227 -208 1.57275 0.214
NP_440545.1_3 Reverse -212 -229 -0.944468 0.161
NP_440545.1_3 Forward -229 -212 -3.00942 0.197
NP_441856.1_3 Forward -377 -358 -0.4922 0.223
NP_441888.1_7 Forward -230 -216 2.35953 0.225
NP_441948.1_4 Forward -232 -214 15.6538 0.0238
NP_441948.1_4 Reverse -209 -227 12.4089 0.0468
NP_441833.1_4 Forward -224 -217 15.9687 0.0124
NP_441833.1_4 Reverse -217 -224 15.9687 0.0124
NP_442162.1_9 Forward -224 -217 16.2637 0.0124
NP_442162.1_9 Reverse -217 -224 16.2637 0.0124
NP_441313.1_6 Forward -39 -20 5.70265 0.186
NP_440671.1_4 Forward -231 -217 8.55439 0.195
NP_442404.1_9 Reverse -321 -335 8.55376 0.296
NP_440772.1_8 Forward -231 -212 8.84924 0.253
NP_442199.1_5 Forward -233 -214 6.68596 0.0791
NP_442140.1_3 Forward -224 -214 17.4829 0.0159
NP_442140.1_3 Reverse -217 -227 8.33817 0.119
NP_442140.1_3 Forward -317 -307 4.50326 0.243
NP_440875.1_9 Forward -223 -213 15.2829 0.0295
NP_440875.1_9 Reverse -218 -228 8.37203 0.233
NP_441813.1_5 Forward -227 -217 17.188 0.00979
NP_441813.1_5 Reverse -214 -224 10.0098 0.0208
NP_440594.1_8 Forward -224 -211 10.6384 0.159
NP_440590.1_4 Forward -224 -211 14.1789 0.0112
NP_440590.1_4 Reverse -217 -230 -3.81562 0.255
NP_440567.1_1 Forward -224 -210 13.9626 0.0194
NP_440567.1_1 Reverse -217 -231 5.80112 0.0959
NP_442497.1_10 Forward -224 -215 10.4228 0.0087
NP_442497.1_10 Reverse -217 -226 10.4228 0.0087
NP_440821.1_4 Forward -227 -217 19.0562 0.00399
NP_440821.1_4 Reverse -214 -224 18.7612 0.00422
NP_441239.1_9 Reverse -214 -226 18.6235 0.0114
NP_441239.1_9 Forward -227 -215 15.8703 0.0178
NP_441239.1_9 Forward -320 -308 6.43049 0.189
NP_441239.1_9 Reverse -307 -319 4.36554 0.253
NP_440624.1_5 Forward -124 -106 9.78833 0.222
NP_441892.1_1 Forward -234 -217 6.92201 0.0931
NP_442082.1_2 Forward -237 -218 5.30853 0.258
NP_440989.1_3 Reverse -211 -230 13.6675 0.18
NP_440354.1_7 Reverse -210 -228 15.9488 0.167
NP_442138.1_10 Reverse -216 -235 10.2259 0.0361
NP_440546.1_4 Forward -225 -215 11.8882 0.0679
NP_440546.1_4 Reverse -216 -226 11.8882 0.0679
NP_440675.1_10 Reverse -290 -309 11.5042 0.262
NP_440462.1_6 Reverse -214 -224 17.9746 0.00578
NP_440462.1_6 Forward -227 -217 15.418 0.0142
NP_442340.1_3 Forward -223 -204 -11.0136 0.295
NP_440868.1_4 Reverse -212 -224 19.6068 0.00963
NP_440868.1_4 Forward -229 -217 8.49544 0.0602
NP_441582.1_5 Reverse -72 -91 10.9134 0.154
NP_441582.1_5 Forward -227 -208 8.25844 0.164
NP_442039.1_4 Forward -224 -217 15.1821 0.0124
NP_442039.1_4 Reverse -217 -224 15.1821 0.0124
NP_441811.1_8 Reverse -210 -224 6.3911 0.273
NP_442891.1_5 Reverse -228 -238 16.3493 0.293
NP_442837.1_3 Forward -224 -217 15.7721 0.0124
NP_442837.1_3 Reverse -217 -224 15.7721 0.0124
NP_442837.1_3 Forward -109 -102 6.13563 0.25
NP_442053.1_1 Forward -225 -216 18.3876 0.0007
NP_442053.1_1 Reverse -216 -225 18.3876 0.0007
NP_440505.1_3 Reverse -214 -224 14.1397 0.0235
NP_440505.1_3 Forward -227 -217 13.8447 0.0247
NP_440505.1_3 Reverse -247 -257 7.25653 0.16
NP_440505.1_3 Forward -329 -319 5.09324 0.246
NP_441788.1_3 Forward -137 -118 14.2373 0.289
NP_440914.1_1 Forward -225 -215 8.6151 0.186
NP_440914.1_1 Reverse -216 -226 8.6151 0.186
NP_441011.1_8 Forward -224 -215 16.9127 0.00602
NP_441011.1_8 Reverse -217 -226 16.9127 0.00602
NP_441011.1_8 Forward -93 -84 6.29291 0.194
NP_442533.1_6 Forward -225 -216 17.2076 0.00137
NP_442533.1_6 Reverse -216 -225 17.2076 0.00137
NP_442541.1_10 Forward -313 -299 2.75226 0.254
NP_440263.1_3 Forward -191 -172 1.17943 0.295
NP_442232.1_3 Reverse -208 -227 -12.8819 0.282
NP_442229.1_1 Reverse -214 -228 11.5037 0.18
NP_441482.1_7 Forward -231 -217 -10.9151 0.222
NP_439944.1_9 Forward -224 -214 10.4031 0.0887
NP_439944.1_9 Reverse -217 -227 10.3048 0.0887
NP_440116.1_8 Forward -191 -172 -9.93197 0.294
NP_441527.1_4 Forward -58 -39 -7.30556 0.232
NP_440115.1_6 Reverse -213 -223 9.61647 0.115
NP_440007.1_4 Reverse -110 -129 13.6675 0.19
NP_441602.1_4 Forward -236 -217 9.43923 0.278
NP_441106.1_1 Reverse -215 -224 18.191 0.0028
NP_441106.1_1 Forward -226 -217 18.191 0.0028
NP_439903.1_7 Forward -96 -77 12.1925 0.199
NP_442306.1_10 Reverse -211 -230 -11.3086 0.126
NP_441286.1_1 Forward -226 -214 5.25052 0.0259
NP_441286.1_1 Reverse -215 -227 4.95553 0.027
NP_440670.1_8 Forward -225 -216 18.3876 0.000699
NP_440670.1_8 Reverse -216 -225 18.3876 0.000699
NP_440886.1_7 Forward -226 -216 17.7774 0.0011
NP_440886.1_7 Reverse -215 -225 17.7774 0.0011
NP_442614.1_2 Forward -225 -211 5.89945 0.296
NP_439995.1_5 Reverse -206 -225 9.53756 0.235
NP_442072.1_9 Forward -226 -208 -21.8103 0.212
NP_441753.1_10 Forward -234 -215 3.24438 0.219
NP_440907.2_8 Forward -224 -214 17.4824 0.00685
NP_440907.2_8 Reverse -217 -227 7.84605 0.117
NP_442264.1_2 Reverse -15 -32 6.82368 0.25
NP_442264.1_2 Reverse -9 -26 5.25038 0.281
NP_441021.1_1 Forward -209 -190 -7.86702 0.192
NP_441021.1_1 Reverse -310 -329 -12.9802 0.3
NP_441021.1_8 Forward -230 -212 12.9988 0.0938
NP_441021.1_8 Reverse -211 -229 2.96908 0.237
NP_441463.1_3 Forward -235 -216 8.94757 0.0481
NP_441463.1_3 Reverse -206 -225 -1.08219 0.135
NP_441463.1_6 Forward -227 -213 6.6092 0.267
NP_441626.1_2 Forward -224 -217 15.7721 0.0124
NP_441626.1_2 Reverse -217 -224 15.7721 0.0124
NP_442615.1_1 Reverse -207 -225 -1.25915 0.127
NP_441962.1_4 Reverse -211 -230 -8.45701 0.2
NP_440387.1_1 Forward -225 -209 7.53169 0.0282
NP_440387.1_1 Reverse -216 -232 -1.12144 0.142
NP_440387.1_1 Forward -210 -194 -5.64466 0.243
NP_441431.1_2 Reverse -213 -227 11.307 0.141
NP_441431.1_2 Forward -228 -214 6.39049 0.272
NP_441993.1_1 Forward -97 -78 1.06957 0.285
NP_441993.1_4 Forward -225 -206 13.7649 0.197
NP_440814.1_4 Reverse -174 -193 -10.0303 0.221
NP_440114.1_10 Reverse -216 -230 15.7325 0.0234
NP_440114.1_10 Reverse -176 -190 11.406 0.115
NP_440114.1_10 Forward -225 -211 10.3243 0.148
NP_441853.1_5 Forward -150 -131 1.57275 0.279
NP_442323.1_7 Reverse -171 -190 1.57197 0.278
NP_441510.2_2 Forward -229 -210 10.4217 0.16
NP_441510.2_7 Forward -231 -217 12.3887 0.28
NP_440287.1_6 Forward -281 -262 -0.197208 0.298
NP_440766.1_4 Forward -229 -215 8.35772 0.0871
NP_440766.1_4 Reverse -212 -226 7.9644 0.0871
NP_441237.1_9 Forward -27 -17 10.5998 0.224
NP_442743.1_4 Forward -224 -205 -8.35868 0.291
NP_442743.1_5 Forward -317 -298 6.19431 0.194
NP_439910.1_2 Forward -233 -216 -11.8592 0.0788
NP_439911.1_7 Forward -299 -280 15.2408 0.147
NP_440457.1_1 Reverse -212 -224 9.77374 0.092
NP_440457.1_1 Forward -229 -217 0.0389777 0.25
NP_440798.1_6 Forward -224 -211 12.409 0.0468
NP_440801.1_8 Reverse -127 -146 0.392778 0.253
NP_441984.1_3 Forward -196 -178 5.32902 0.287
NP_440054.1_4 Forward -233 -214 14.8474 0.135
NP_440473.1_9 Forward -236 -217 -9.14533 0.26
NP_442509.1_9 Forward -225 -215 16.2041 0.00739
NP_442509.1_9 Reverse -216 -226 16.2041 0.00739
NP_440554.1_4 Reverse -217 -227 14.6313 0.02
NP_440554.1_4 Forward -224 -214 13.943 0.0218
NP_440554.1_4 Forward -317 -307 4.79825 0.175
NP_441885.1_5 Forward -225 -215 11.4848 0.00668
NP_441885.1_5 Reverse -216 -226 11.4848 0.00668
NP_440478.1_10 Reverse -181 -195 6.48943 0.291
NP_442703.1_9 Reverse -272 -290 4.6407 0.248
NP_442341.1_7 Forward -226 -212 11.8976 0.0502
NP_442341.1_7 Reverse -215 -229 10.0294 0.0682
NP_440423.1_6 Forward -233 -214 -15.6352 0.229
NP_443000.1_7 Forward -227 -217 8.73149 0.0437
NP_443000.1_7 Reverse -214 -224 2.04498 0.226
NP_440507.2_3 Forward -234 -215 9.63507 0.218
NP_441842.1_1 Forward -223 -210 18.7999 0.0142
NP_441842.1_10 Forward -232 -218 15.0442 0.0474
NP_441842.1_10 Reverse -209 -223 9.73436 0.182
NP_440275.1_3 Reverse -214 -224 17.9746 0.0082
NP_440275.1_3 Forward -227 -217 8.4365 0.0602
NP_440091.1_1 Reverse -212 -224 19.6068 0.0114
NP_440091.1_1 Forward -229 -217 18.3285 0.0114
NP_442275.1_1 Forward -225 -206 1.37609 0.284
NP_443010.1_10 Forward -228 -211 14.2702 0.0608
NP_443010.1_10 Reverse -213 -230 10.2116 0.125
NP_441207.1_7 Forward -239 -225 9.93309 0.272
NP_439951.1_3 Reverse -293 -310 16.3618 0.0937
NP_439962.1_4 Reverse -208 -227 -6.58872 0.283
NP_440175.1_7 Forward -189 -171 8.48479 0.297
NP_442495.1_4 Reverse -205 -215 11.3864 0.278
NP_441105.1_3 Forward -236 -217 -6.58872 0.236
NP_440216.1_1 Forward -225 -211 7.9644 0.00737
NP_440216.1_1 Reverse -216 -230 6.29277 0.0156
NP_440172.1_1 Forward -225 -215 8.73149 0.0586
NP_440172.1_1 Reverse -216 -226 8.73149 0.0586
NP_441350.1_3 Forward -312 -293 14.8474 0.277
NP_440167.1_3 Forward -391 -372 7.7676 0.294
NP_442015.1_10 Reverse -212 -225 3.16588 0.185
NP_442015.1_10 Forward -229 -216 0.904263 0.216
NP_441045.1_4 Forward -51 -32 11.2092 0.274
NP_441226.1_7 Forward -224 -217 14.4934 0.0123
NP_441226.1_7 Reverse -217 -224 14.4934 0.0123
NP_441111.1_7 Forward -224 -216 18.7023 0.00294
NP_441111.1_7 Reverse -217 -225 18.7023 0.00294
NP_441766.1_2 Forward -225 -216 17.5026 0.00297
NP_441766.1_2 Reverse -216 -225 17.5026 0.00297
NP_441766.1_9 Forward -224 -205 2.16274 0.246
NP_442252.1_3 Forward -232 -214 24.1102 0.0285
NP_440416.1_9 Forward -232 -213 -4.6221 0.0783
NP_440416.1_9 Reverse -302 -321 -14.8485 0.18
NP_443052.1_8 Forward -235 -216 -1.67217 0.081
NP_443052.1_8 Reverse -206 -225 -4.81876 0.122
NP_440591.1_9 Forward -232 -214 4.14905 0.288
NP_442154.1_1 Forward -98 -80 -11.4856 0.215
NP_440261.1_5 Forward -224 -211 4.8375 0.0516
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TAAATCCCGTTCCTGAGGTTTTGAAGGCTGATCAGCTAGAAGAGAACCTAGTCTTGGATCTATCCATTTTGACGGGGATTCGTGAGATGGCAGGGCCAGACGGAGCAACCTTTTTGCAGGTTATTATTGGGGATTATTTACACACAACCCCCTCTTTGCTAGAAAAACTCAAAACGGCGATCGCCGCCCAGGAGATTGATACAGTGCGAGCTACAGCCCATAGTCTGGGGTCAAGCAGTGCTAATTTAGGGGCAGTGGAATTTGCCAAACAGTGTAAGCAGCTTGAAAATTTGGCTCGCTCTGGCATGTTATCGGGGGTTGATGGACAATATATCCAGTTAGAGAAGGAATATGAGAAAGTGAGTCAAGCATTGGCATTGCAACTAAATCCAAATTGACG

CDS

ATGACTGAGACTTCTCCGACGGTTGATGAACAGCGATCCCCCCTAATATTAGTTACCGACGATGATAATTCGTTGCGTTCCCTGTTAGTGATGGCATTACGGGCGGATGGTTATGTCATTGAAGAAGCCGTCAATGGGCAGGAATGTCTGGCGAAATACCAACGGTTACAGCCGGATTTGGTGATTTTGGATGCCATGATGCCAGAAATGGATGGCTTTACCTGTTGTCAGCAATTGCGACAGTTTCCCCAAAGCCTAAACATCCCCATTTTGATGATTACCTTTCTCGACGATCGTGAGTCCATTGAACAGGCTTTTACCGCAGGGGCAACGGATTACATTACTAAACCGATTCACTGGTCAGTGCTGAAACAACGGGTGCGATATCTGCTCTCCGCTTCCCAGTCTTTGAAACAGGGGGCGATTCAACAGCAACAATTAGACCGTCAACTAATCTGGCAGGAGGATTGGAGTGAATTGTTAGCTCAATTGGCAGCAGTGAAATCGTTAACGACGGATCTGGTTTCTGGGTTAGAACCATTGCGGGAAGGTTTAGGTATTGATCGTTTCGTGGTTTACGGTGCAGATTTGACTCCCCAGTTAGAATCCGTGGCGGCTAACTCCCCTTCGGCCCTGAATTATTCTTTATTGGATCTAGGGTTAAATCAATTGTTGCCATCGGGGGAAATTTTGGCGATCGCCGATATTCCCCAAAGTTCCCTGTCCCCAGCGAGTAAAACAAAACTCAAAGATCTCCAGACTACCGCATTGTTACTGATCCCCATCGGTTCCTCATCCAAACCCCTCGGTTGGCTAGGTCTGTATCGTCAATTTACCGGGGAATGGGACAGTTTTGTCCAAGGGAGATGTCAGGATTTAGCTAACCTTTTCGCCCTGGTCATGGGGTAG

Protein

No sequence available