Your browser is old and dusty. Try Google Chrome!

Details for sll5047

ORF sll5047
Accession NP_942203.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -164 -150 8.65272 0.0856
NP_441061.1_2 Reverse -373 -387 3.8345 0.159
NP_441061.1_2 Forward -152 -138 -2.26202 0.287
NP_440795.1_7 Forward -380 -373 14.6904 0.0123
NP_440795.1_7 Reverse -373 -380 14.6904 0.0123
NP_440795.1_7 Reverse -157 -164 5.74231 0.279
NP_441418.1_6 Forward -165 -146 -12.4886 0.066
NP_441418.1_6 Reverse -372 -391 -21.0434 0.136
NP_441418.1_6 Reverse -144 -163 -29.7948 0.238
NP_441418.1_6 Reverse -219 -238 -30.2865 0.267
NP_441418.1_6 Reverse -216 -235 -30.5815 0.286
NP_441453.1_4 Reverse -372 -380 16.539 0.00633
NP_441453.1_4 Forward -381 -373 16.539 0.00633
NP_441453.1_4 Forward -165 -157 6.80426 0.121
NP_441453.1_4 Reverse -156 -164 6.70593 0.121
NP_441453.1_4 Forward -267 -259 4.34598 0.257
NP_441453.1_4 Reverse -258 -266 4.24765 0.259
NP_442151.1_6 Reverse -372 -386 18.5841 0.0071
NP_442151.1_6 Reverse -156 -170 9.04604 0.159
NP_442151.1_6 Forward -381 -367 7.86607 0.188
NP_441818.1_9 Reverse -217 -236 -2.36049 0.203
NP_440226.1_1 Forward -381 -362 7.66927 0.102
NP_440226.1_1 Reverse -156 -175 3.83436 0.212
NP_442623.1_3 Forward -239 -220 -19.1751 0.281
NP_441098.1_3 Forward -347 -328 -4.30066 0.28
NP_442173.1_1 Forward -380 -372 15.4574 0.00633
NP_442173.1_1 Reverse -373 -381 15.4574 0.00633
NP_442173.1_1 Forward -164 -156 11.7208 0.034
NP_442173.1_1 Reverse -157 -165 5.62429 0.206
NP_442752.1_4 Forward -381 -374 13.8055 0.0199
NP_442752.1_4 Reverse -372 -379 13.8055 0.0199
NP_442752.1_4 Forward -165 -158 6.23397 0.161
NP_443027.1_4 Forward -383 -373 15.3197 0.0437
NP_443027.1_4 Reverse -154 -164 13.943 0.0452
NP_443027.1_4 Forward -269 -259 9.32148 0.166
NP_443027.1_4 Reverse -370 -380 7.25653 0.24
NP_443027.1_4 Reverse -312 -322 6.76487 0.269
NP_443027.1_4 Reverse -256 -266 5.78156 0.298
NP_442975.1_10 Forward -385 -371 19.9601 0.00259
NP_442975.1_10 Reverse -368 -382 10.6187 0.0541
NP_442975.1_10 Reverse -152 -166 9.34041 0.0722
NP_442975.1_10 Forward -169 -155 3.63724 0.252
NP_442975.1_10 Reverse -47 -61 2.06395 0.284
NP_440784.1_7 Forward -380 -373 15.9687 0.0123
NP_440784.1_7 Reverse -373 -380 15.9687 0.0123
NP_440784.1_7 Forward -164 -157 6.43063 0.218
NP_440784.1_7 Reverse -157 -164 6.23397 0.241
NP_442909.1_7 Forward -245 -231 5.50552 0.282
NP_440061.1_9 Reverse -370 -384 12.3887 0.0971
NP_440061.1_9 Forward -242 -228 8.25877 0.177
NP_440110.1_8 Reverse -217 -236 11.4058 0.0878
NP_441054.1_2 Forward -300 -281 16.2241 0.136
NP_441476.1_5 Forward -170 -151 11.8975 0.0933
NP_441476.1_5 Forward -29 -10 -4.42544 0.25
NP_441476.1_5 Reverse -151 -170 -4.81876 0.257
NP_442062.1_8 Reverse -372 -382 10.3048 0.0493
NP_442062.1_8 Forward -381 -371 10.3048 0.0493
NP_442062.1_8 Forward -165 -155 9.81313 0.0557
NP_442062.1_8 Reverse -156 -166 9.61647 0.0587
NP_440761.1_4 Forward -272 -253 -1.37718 0.0812
NP_440761.1_4 Reverse -367 -386 -3.24547 0.132
NP_441900.1_2 Forward -265 -247 -1.75153 0.273
NP_440839.1_8 Reverse -250 -263 17.6205 0.296
NP_441859.1_3 Forward -166 -147 9.53674 0.129
NP_441859.1_3 Reverse -143 -162 7.17681 0.164
NP_441859.1_3 Forward -138 -119 4.71854 0.215
NP_440304.1_4 Forward -383 -373 18.9579 0.00406
NP_440304.1_4 Reverse -370 -380 10.8948 0.051
NP_440304.1_4 Reverse -154 -164 7.64985 0.105
NP_442242.1_4 Forward -380 -373 14.3954 0.0124
NP_442242.1_4 Reverse -373 -380 14.3954 0.0124
NP_442242.1_4 Forward -164 -157 13.3138 0.027
NP_440044.1_8 Reverse -373 -392 11.0125 0.0527
NP_440044.1_8 Forward -120 -101 3.34271 0.132
NP_440044.1_8 Forward -380 -361 -2.65548 0.265
NP_440044.1_8 Reverse -19 -38 -3.04881 0.277
NP_440044.1_8 Reverse -60 -79 -3.24547 0.281
NP_441781.1_7 Reverse -231 -250 -0.983855 0.268
NP_440765.1_3 Forward -393 -374 6.98095 0.268
NP_442207.1_4 Forward -329 -310 10.5209 0.285
NP_441619.1_8 Reverse -366 -380 13.8636 0.114
NP_441208.1_1 Reverse -246 -265 0.0977854 0.25
NP_441208.1_9 Reverse -369 -383 15.8309 0.0752
NP_441208.1_9 Forward -384 -370 9.04604 0.219
NP_441594.1_6 Reverse -147 -166 7.37428 0.173
NP_441594.1_6 Forward -390 -371 2.3594 0.252
NP_441594.1_6 Reverse -255 -274 -0.000545616 0.294
NP_442110.1_7 Reverse -372 -386 18.9775 0.0138
NP_442110.1_7 Reverse -156 -170 6.98109 0.128
NP_441082.1_10 Forward -250 -237 8.9674 0.258
NP_441925.1_4 Forward -265 -246 -9.73604 0.227
NP_441925.1_5 Reverse -116 -130 12.4876 0.288
NP_440014.1_6 Forward -390 -371 12.2908 0.221
NP_440856.1_1 Forward -391 -372 -5.50708 0.276
NP_441083.1_5 Forward -381 -371 11.2881 0.0159
NP_441083.1_5 Reverse -372 -382 11.2881 0.0159
NP_441083.1_5 Forward -165 -155 8.53483 0.0342
NP_441083.1_5 Reverse -156 -166 2.04498 0.195
NP_442827.1_8 Forward -389 -370 8.06178 0.0882
NP_442827.1_8 Reverse -148 -167 -2.06626 0.267
NP_441434.1_7 Forward -379 -365 4.62115 0.225
NP_441738.1_2 Forward -379 -372 15.28 0.0102
NP_441738.1_2 Reverse -374 -381 15.28 0.0102
NP_441738.1_2 Forward -163 -156 13.3134 0.0335
NP_441558.1_5 Forward -383 -364 11.8975 0.0751
NP_441558.1_5 Forward -167 -148 6.19431 0.225
NP_440209.1_1 Reverse -372 -380 18.1123 0.00295
NP_440209.1_1 Forward -381 -373 18.1123 0.00295
NP_440209.1_1 Forward -165 -157 8.37755 0.0576
NP_440209.1_1 Reverse -156 -164 8.27922 0.0687
NP_440655.1_2 Reverse -16 -35 1.0811 0.293
NP_441713.1_1 Forward -273 -254 -5.80207 0.114
NP_441713.1_1 Forward -387 -368 -6.39206 0.118
NP_441713.1_1 Reverse -366 -385 -14.5535 0.259
NP_440178.1_7 Reverse -371 -390 -21.4367 0.223
NP_440178.1_7 Reverse -155 -174 -22.9117 0.282
NP_440053.1_9 Reverse -348 -367 15.3935 0.293
NP_441909.1_5 Reverse -8 -27 15.7316 0.262
NP_441716.1_1 Reverse -372 -386 4.12949 0.258
NP_442111.1_4 Reverse -371 -385 17.2075 0.0109
NP_442111.1_4 Forward -382 -368 6.88276 0.11
NP_442111.1_4 Reverse -236 -250 6.88276 0.11
NP_442111.1_4 Forward -166 -152 1.67122 0.296
NP_441163.1_1 Forward -389 -372 10.3628 0.217
NP_440343.1_3 Reverse -209 -227 10.5398 0.169
NP_440906.1_5 Forward -380 -373 15.8704 0.0124
NP_440906.1_5 Reverse -373 -380 15.8704 0.0124
NP_440906.1_5 Forward -164 -157 6.52896 0.199
NP_440906.1_5 Reverse -157 -164 6.0373 0.262
NP_440747.1_10 Reverse -369 -381 5.54551 0.0128
NP_440747.1_10 Forward -384 -372 -1.92764 0.0192
NP_440747.1_10 Forward -168 -156 -11.7607 0.142
NP_440747.1_10 Reverse -153 -165 -11.9574 0.178
NP_440747.1_10 Forward -259 -247 -12.0557 0.199
NP_441130.1_10 Reverse -154 -168 16.6175 0.0225
NP_442973.1_5 Forward -390 -371 15.5357 0.113
NP_441486.1_1 Reverse -109 -123 0.589577 0.132
NP_441486.1_1 Forward -384 -370 -2.16369 0.175
NP_441486.1_1 Reverse -369 -383 -2.75368 0.175
NP_441486.1_1 Forward -168 -154 -6.09693 0.278
NP_442634.1_4 Forward -383 -369 5.89945 0.051
NP_442634.1_4 Reverse -370 -384 5.80112 0.051
NP_442634.1_4 Reverse -256 -270 4.52282 0.0764
NP_440470.1_5 Reverse -330 -349 10.265 0.204
NP_440842.1_6 Reverse -202 -221 15.0432 0.15
NP_441014.1_5 Forward -392 -374 15.3588 0.2
NP_442848.1_1 Forward -387 -373 -1.77037 0.263
NP_442848.1_1 Forward -121 -107 -3.34366 0.265
NP_442848.1_1 Reverse -366 -380 -3.63866 0.268
NP_442848.1_5 Forward -19 -1 -0.570838 0.276
NP_442848.1_9 Forward -266 -247 23.2056 0.0554
NP_441012.1_4 Forward -232 -219 5.72248 0.291
NP_443018.1_3 Forward -380 -373 14.8871 0.0123
NP_443018.1_3 Reverse -373 -380 14.8871 0.0123
NP_443018.1_3 Forward -266 -259 12.5271 0.0523
NP_443018.1_3 Reverse -259 -266 12.5271 0.0523
NP_443018.1_3 Forward -164 -157 5.15232 0.226
NP_443018.1_3 Reverse -157 -164 5.05399 0.238
NP_441316.1_7 Forward -383 -368 -0.315096 0.2
NP_441634.1_8 Reverse -370 -384 -3.63866 0.295
NP_441634.1_8 Reverse -256 -270 -3.63866 0.295
NP_441634.1_8 Reverse -154 -168 -4.13031 0.295
NP_440376.1_1 Forward -381 -372 19.4693 0.000692
NP_440376.1_1 Reverse -372 -381 19.4693 0.000692
NP_440376.1_1 Forward -165 -156 9.93116 0.0331
NP_440376.1_1 Reverse -156 -165 9.63616 0.0385
NP_440376.1_1 Reverse -247 -256 2.06468 0.236
NP_441857.1_5 Forward -274 -256 2.0841 0.277
NP_441588.1_4 Forward -379 -369 16.2046 0.0369
NP_442687.1_7 Forward -382 -372 9.02648 0.0994
NP_442687.1_7 Reverse -371 -381 9.02648 0.0994
NP_442687.1_7 Forward -166 -156 6.76487 0.154
NP_442687.1_7 Reverse -155 -165 5.97822 0.179
NP_442687.1_7 Forward -116 -106 3.91327 0.278
NP_442191.1_4 Reverse -220 -234 11.7688 0.244
NP_442191.1_4 Forward -255 -241 10.8961 0.283
NP_441797.1_7 Reverse -109 -127 13.0972 0.238
NP_441846.1_10 Forward -210 -191 -14.5535 0.232
NP_441846.1_10 Forward -212 -193 -21.3384 0.256
NP_441846.1_10 Forward -239 -220 -21.9284 0.257
NP_442958.1_3 Forward -392 -373 -0.295539 0.267
NP_442958.1_3 Reverse -303 -322 -0.983855 0.268
NP_441422.1_7 Forward -167 -150 -3.5994 0.235
NP_441422.1_7 Reverse -370 -387 -6.25434 0.248
NP_441029.1_3 Forward -170 -151 0.491109 0.277
NP_442658.1_1 Forward -383 -373 15.9091 0.00966
NP_442658.1_1 Reverse -370 -380 13.0576 0.04
NP_442658.1_1 Reverse -154 -164 9.02601 0.169
NP_442658.1_1 Forward -167 -157 9.02601 0.169
NP_442658.1_1 Forward -123 -113 8.14104 0.199
NP_442658.1_1 Forward -269 -259 4.7978 0.297
NP_440446.1_6 Forward -293 -274 14.4541 0.298
NP_440141.1_8 Forward -130 -111 4.03102 0.294
NP_442782.1_2 Forward -115 -101 5.50613 0.242
NP_442782.1_2 Reverse -144 -158 -0.000409212 0.297
NP_442205.1_9 Forward -387 -371 10.1866 0.0927
NP_442205.1_9 Reverse -366 -382 -3.48138 0.283
NP_441414.1_9 Forward -381 -362 -10.9153 0.297
NP_440720.1_1 Reverse -361 -380 4.62101 0.255
NP_442937.1_5 Reverse -151 -170 11.9958 0.123
NP_442321.1_4 Reverse -210 -229 -8.65367 0.289
NP_441958.1_5 Forward -382 -372 21.2195 0.000805
NP_441958.1_5 Reverse -371 -381 21.2195 0.000805
NP_441958.1_5 Forward -166 -156 2.53664 0.0409
NP_441958.1_5 Reverse -155 -165 2.43831 0.0422
NP_441958.1_5 Reverse -257 -267 0.373358 0.154
NP_442836.1_5 Forward -387 -368 20.1573 0.0211
NP_440203.1_5 Reverse -375 -385 11.8776 0.171
NP_440203.1_5 Forward -131 -121 11.091 0.205
NP_439905.1_1 Reverse -373 -386 9.95071 0.216
NP_439905.1_1 Forward -266 -253 9.65572 0.216
NP_443001.1_7 Reverse -113 -132 3.93269 0.279
NP_443001.1_7 Reverse -373 -392 0.58944 0.296
NP_440984.1_7 Forward -386 -372 13.2743 0.116
NP_440984.1_7 Reverse -253 -267 7.76774 0.163
NP_440984.1_7 Reverse -215 -229 7.66941 0.166
NP_439990.1_5 Reverse -367 -380 6.80412 0.221
NP_442911.1_2 Forward -175 -156 10.1275 0.0155
NP_442911.1_2 Reverse -146 -165 5.60432 0.0325
NP_442911.1_2 Forward -391 -372 -3.73712 0.117
NP_441580.1_6 Reverse -220 -239 2.16274 0.117
NP_441580.1_6 Forward -176 -157 -4.22878 0.235
NP_440153.1_5 Reverse -373 -387 23.599 0.00965
NP_440153.1_5 Forward -266 -252 4.03116 0.199
NP_440153.1_8 Forward -267 -254 4.64084 0.196
NP_441591.1_10 Forward -383 -364 4.32602 0.297
NP_440993.1_2 Forward -386 -370 12.7432 0.0688
NP_440993.1_2 Forward -170 -154 11.2683 0.0821
NP_440993.1_2 Reverse -367 -383 3.69678 0.256
NP_440993.1_3 Forward -391 -372 -0.787962 0.273
NP_442210.1_5 Forward -167 -148 14.5524 0.19
NP_441099.1_5 Reverse -146 -165 -9.53865 0.226
NP_441099.1_5 Reverse -221 -240 -9.73531 0.231
NP_442002.1_9 Reverse -155 -162 10.7572 0.185
NP_441294.1_7 Reverse -368 -382 16.5458 0.0138
NP_441294.1_7 Forward -385 -371 11.2664 0.15
NP_441646.1_1 Reverse -149 -168 6.09597 0.174
NP_441646.1_1 Forward -268 -249 1.47442 0.231
NP_441646.1_1 Reverse -365 -384 -1.27885 0.281
NP_441646.1_7 Reverse -214 -228 16.0275 0.234
NP_442438.1_10 Forward -170 -156 17.2075 0.0203
NP_442438.1_10 Forward -386 -372 10.3243 0.0547
NP_442438.1_10 Reverse -151 -165 3.14618 0.166
NP_442438.1_10 Forward -158 -144 1.08123 0.206
NP_442431.1_10 Forward -71 -53 2.87075 0.228
NP_441000.1_6 Forward -382 -368 -4.32697 0.237
NP_441000.1_6 Reverse -155 -169 -4.7203 0.251
NP_442771.1_1 Forward -167 -149 -0.275845 0.105
NP_442771.1_1 Forward -67 -49 -11.0923 0.297
NP_440147.1_4 Reverse -370 -383 21.7504 0.00117
NP_440147.1_4 Reverse -154 -167 8.47575 0.0504
NP_440147.1_4 Reverse -256 -269 5.03416 0.139
NP_440147.1_4 Forward -383 -370 3.16588 0.193
NP_440147.1_4 Forward -167 -154 1.78924 0.22
NP_441550.1_8 Forward -383 -373 17.4824 0.00754
NP_441550.1_8 Reverse -370 -380 15.3192 0.0132
NP_441550.1_8 Reverse -218 -228 4.60114 0.299
NP_441916.1_7 Forward -381 -371 18.9579 0.00144
NP_441916.1_7 Reverse -372 -382 18.9579 0.00144
NP_441916.1_7 Forward -165 -155 8.73149 0.042
NP_441916.1_7 Reverse -156 -166 8.63316 0.0437
NP_441916.1_7 Forward -267 -257 7.05986 0.0779
NP_441916.1_7 Reverse -258 -268 4.3066 0.182
NP_441916.1_10 Forward -26 -7 5.80098 0.208
NP_440206.1_4 Reverse -215 -234 3.24359 0.282
NP_441041.1_4 Reverse -252 -271 -2.75381 0.117
NP_441041.1_4 Forward -381 -362 -9.53865 0.218
NP_441041.1_4 Forward -393 -374 -12.0953 0.258
NP_441041.1_7 Reverse -369 -381 17.7184 0.00706
NP_441041.1_7 Forward -168 -156 16.8438 0.0125
NP_441041.1_7 Forward -384 -372 8.97244 0.125
NP_442004.1_6 Reverse -372 -386 7.07942 0.165
NP_442004.1_6 Reverse -231 -245 1.86788 0.276
NP_441725.1_5 Reverse -373 -383 8.92815 0.0553
NP_441725.1_5 Forward -380 -370 1.94665 0.115
NP_441725.1_5 Forward -164 -154 -0.708283 0.267
NP_441725.1_5 Reverse -157 -167 -0.806614 0.271
NP_439966.1_7 Forward -383 -373 13.8442 0.0234
NP_439966.1_7 Reverse -154 -164 7.84605 0.149
NP_439966.1_7 Forward -167 -157 7.74772 0.15
NP_439966.1_7 Reverse -370 -380 6.27276 0.185
NP_439966.1_9 Forward -167 -158 1.1797 0.253
NP_439966.1_9 Forward -383 -374 0.983037 0.253
NP_439966.1_9 Reverse -154 -163 0.884706 0.253
NP_440736.1_3 Forward -383 -364 -1.47551 0.286
NP_440202.1_8 Reverse -238 -257 11.0707 0.282
NP_442941.1_3 Forward -380 -370 11.0914 0.0116
NP_442941.1_3 Reverse -373 -383 10.9931 0.0116
NP_442941.1_3 Forward -266 -256 -0.314959 0.256
NP_440289.1_2 Forward -168 -155 10.1474 0.0278
NP_440289.1_2 Reverse -369 -382 -2.144 0.251
NP_440289.1_2 Forward -384 -371 -4.50394 0.288
NP_440983.1_5 Forward -24 -5 3.73603 0.194
NP_440983.1_9 Reverse -238 -257 0.58944 0.292
NP_441554.1_4 Forward -122 -108 13.8289 0.28
NP_442281.1_1 Forward -170 -156 7.96378 0.089
NP_442281.1_1 Reverse -151 -165 6.29216 0.13
NP_442281.1_1 Forward -386 -372 6.29216 0.13
NP_441334.1_7 Reverse -370 -389 -11.5053 0.122
NP_441334.1_7 Forward -269 -250 -15.9302 0.275
NP_441334.1_7 Forward -383 -364 -20.65 0.277
NP_441079.1_7 Reverse -329 -348 -6.98278 0.286
NP_001035871.2_7 Reverse -122 -132 12.9597 0.237
NP_440437.1_1 Reverse -366 -385 -1.67217 0.205
NP_440437.1_1 Forward -235 -216 -3.14714 0.232
NP_442012.1_1 Forward -171 -152 8.55425 0.099
NP_442012.1_1 Reverse -106 -125 0.294447 0.241
NP_441457.1_7 Reverse -154 -173 8.45592 0.146
NP_441457.1_7 Reverse -370 -389 0.392778 0.287
NP_441457.1_7 Forward -269 -250 0.0977854 0.288
NP_441556.1_4 Forward -237 -218 12.9937 0.201
NP_441556.1_7 Forward -268 -249 -0.787962 0.3
NP_441556.1_7 Forward -112 -93 -0.787962 0.3
NP_441556.1_10 Reverse -4 -18 19.0795 0.0841
NP_440375.1_6 Reverse -203 -222 8.06259 0.244
NP_441644.1_6 Forward -381 -371 19.0557 0.000803
NP_441644.1_6 Reverse -372 -382 19.0557 0.000803
NP_441644.1_6 Forward -267 -257 13.2542 0.0212
NP_441644.1_6 Reverse -258 -268 6.17443 0.165
NP_441644.1_6 Forward -153 -143 4.99446 0.216
NP_442215.1_2 Reverse -154 -170 -2.20308 0.193
NP_442215.1_2 Reverse -110 -126 -4.75968 0.239
NP_442215.1_2 Forward -383 -367 -4.95634 0.242
NP_442215.1_2 Reverse -370 -386 -7.51295 0.297
NP_442029.1_1 Reverse -360 -379 -20.1584 0.297
NP_442029.1_6 Reverse -138 -157 2.45773 0.296
NP_442247.1_8 Reverse -370 -384 9.73436 0.247
NP_440253.1_2 Reverse -156 -174 3.65739 0.114
NP_440253.1_2 Forward -165 -147 0.609134 0.181
NP_440929.1_8 Forward -381 -372 19.2726 0.000701
NP_440929.1_8 Reverse -372 -381 19.2726 0.000701
NP_440929.1_8 Forward -165 -156 9.53783 0.0296
NP_440929.1_8 Reverse -156 -165 9.4395 0.0326
NP_440929.1_8 Forward -256 -247 2.65466 0.253
NP_442933.1_10 Forward -381 -372 17.601 0.00325
NP_442933.1_10 Reverse -372 -381 17.601 0.00325
NP_442933.1_10 Forward -165 -156 7.96454 0.0937
NP_442933.1_10 Reverse -156 -165 7.76787 0.11
NP_442933.1_10 Reverse -258 -267 4.42462 0.246
NP_442933.1_10 Forward -267 -258 4.42462 0.246
NP_441751.2_8 Forward -380 -366 4.71948 0.047
NP_441751.2_8 Reverse -373 -387 -1.96703 0.132
NP_442926.1_3 Forward -278 -259 5.99764 0.209
NP_442926.1_3 Reverse -145 -164 2.26107 0.295
NP_442554.1_8 Reverse -373 -383 19.1546 0.00369
NP_442554.1_8 Forward -380 -370 16.4013 0.0065
NP_442554.1_8 Forward -266 -256 15.123 0.00944
NP_442554.1_8 Forward -164 -154 13.353 0.0183
NP_442554.1_8 Reverse -259 -269 7.35486 0.0931
NP_442554.1_8 Reverse -157 -167 6.17489 0.125
NP_442554.1_8 Forward -23 -13 2.83163 0.253
NP_442554.1_8 Forward -101 -91 2.14332 0.281
NP_441762.1_7 Forward -166 -154 11.8387 0.0142
NP_441762.1_7 Reverse -155 -167 11.7404 0.0142
NP_441762.1_7 Reverse -371 -383 2.69391 0.0676
NP_441762.1_7 Forward -382 -370 0.432302 0.0747
NP_441762.1_7 Forward -226 -214 -6.2542 0.284
NP_442142.1_4 Reverse -369 -382 10.9334 0.0646
NP_442142.1_4 Forward -168 -155 6.70522 0.158
NP_442142.1_4 Forward -384 -371 4.34528 0.223
NP_442142.1_4 Forward -270 -257 3.85363 0.243
NP_442292.1_1 Forward -380 -371 17.5026 0.00435
NP_442292.1_1 Reverse -373 -382 17.5026 0.00435
NP_442292.1_1 Forward -164 -155 7.57121 0.0653
NP_442292.1_1 Forward -266 -257 4.81794 0.17
NP_442292.1_1 Reverse -157 -166 -0.196935 0.239
NP_442476.1_6 Forward -239 -225 0.196253 0.269
NP_442476.1_6 Reverse -232 -246 0.196253 0.269
NP_443009.1_5 Reverse -371 -382 15.7911 0.0107
NP_443009.1_5 Forward -382 -371 15.7911 0.0107
NP_443009.1_5 Reverse -143 -154 3.69644 0.282
NP_442406.1_9 Reverse -218 -237 1.76941 0.274
NP_441715.1_4 Forward -164 -154 8.04317 0.107
NP_441715.1_4 Forward -380 -370 7.35486 0.108
NP_441715.1_4 Reverse -373 -383 7.25653 0.108
NP_441715.1_4 Reverse -157 -167 6.76487 0.129
NP_440183.1_9 Forward -265 -246 5.30933 0.103
NP_441198.1_5 Reverse -374 -387 12.5067 0.224
NP_441198.1_8 Forward -383 -373 15.4199 0.0427
NP_441198.1_8 Reverse -370 -380 12.783 0.116
NP_441198.1_8 Forward -269 -259 12.0017 0.167
NP_441468.1_1 Forward -380 -373 15.8704 0.0124
NP_441468.1_1 Reverse -373 -380 15.8704 0.0124
NP_441468.1_1 Forward -164 -157 13.0188 0.0383
NP_441468.1_1 Reverse -157 -164 6.0373 0.223
NP_441468.1_1 Reverse -259 -266 3.97235 0.277
NP_441468.1_1 Forward -266 -259 3.97235 0.277
NP_441020.2_6 Forward -167 -150 9.87194 0.159
NP_441020.2_6 Reverse -154 -171 7.41366 0.232
NP_441020.2_6 Forward -383 -366 5.64371 0.293
NP_441015.1_10 Reverse -151 -170 -11.3086 0.294
NP_441673.1_1 Forward -381 -372 20.8459 0.000698
NP_441673.1_1 Reverse -372 -381 20.8459 0.000698
NP_441673.1_1 Forward -165 -156 11.1111 0.0121
NP_441673.1_1 Reverse -156 -165 11.0128 0.018
NP_441826.1_2 Forward -387 -373 14.9459 0.0196
NP_441826.1_2 Forward -171 -157 4.62115 0.101
NP_441826.1_2 Reverse -150 -164 -4.52363 0.296
NP_441826.1_5 Reverse -214 -233 5.30933 0.25
NP_441330.1_1 Forward -44 -25 -15.7335 0.294
NP_442490.1_9 Reverse -144 -163 -1.7705 0.196
NP_442490.1_9 Forward -165 -146 -8.06369 0.282
NP_442868.1_6 Forward -383 -373 8.63316 0.0555
NP_442868.1_6 Reverse -370 -380 0.963343 0.205
NP_442427.1_3 Forward -386 -368 3.85406 0.171
NP_442808.1_1 Forward -166 -156 8.92768 0.0481
NP_442808.1_1 Reverse -155 -165 8.82935 0.0481
NP_442808.1_1 Reverse -371 -381 8.73102 0.0481
NP_442808.1_1 Forward -382 -372 8.73102 0.0481
NP_442808.1_1 Reverse -29 -39 5.09279 0.173
NP_440871.1_2 Reverse -294 -313 15.8307 0.241
NP_440145.1_3 Reverse -362 -381 14.4541 0.0163
NP_442542.1_9 Forward -388 -374 10.2254 0.119
NP_442050.1_5 Forward -383 -373 17.1874 0.00812
NP_442050.1_5 Reverse -370 -380 9.22267 0.193
NP_442342.1_9 Forward -167 -151 6.74504 0.217
NP_442342.1_9 Forward -383 -367 4.48343 0.249
NP_440342.1_1 Reverse -244 -263 10.8159 0.279
NP_441114.1_3 Reverse -114 -123 13.2744 0.231
NP_440558.1_2 Forward -270 -251 1.17943 0.183
NP_440558.1_2 Reverse -254 -273 -5.80207 0.264
NP_441878.1_6 Forward -382 -372 10.5014 0.0176
NP_441878.1_6 Reverse -371 -381 10.5014 0.0176
NP_441878.1_6 Forward -268 -258 0.766681 0.134
NP_441878.1_6 Reverse -257 -267 0.668351 0.139
NP_441878.1_6 Forward -166 -156 0.668351 0.139
NP_441878.1_6 Reverse -155 -165 0.57002 0.14
NP_441036.1_8 Forward -166 -156 16.303 0.00588
NP_441036.1_8 Forward -382 -372 15.713 0.00724
NP_441036.1_8 Reverse -371 -381 15.713 0.00724
NP_441036.1_8 Forward -230 -220 9.61647 0.174
NP_441036.1_8 Reverse -246 -256 8.73149 0.174
NP_441036.1_8 Reverse -155 -165 7.94484 0.181
NP_442650.1_2 Reverse -231 -245 8.65272 0.13
NP_441557.1_5 Forward -381 -372 19.9609 0.000699
NP_441557.1_5 Reverse -372 -381 19.9609 0.000699
NP_441557.1_5 Forward -165 -156 10.2261 0.0144
NP_441557.1_5 Reverse -156 -165 10.1278 0.0188
NP_441557.1_5 Reverse -258 -267 -0.885252 0.26
NP_442066.2_4 Reverse -372 -391 8.65258 0.0828
NP_442066.2_9 Reverse -152 -165 11.0324 0.154
NP_442066.2_9 Forward -169 -156 6.70579 0.271
NP_442419.1_2 Forward -170 -151 -1.86883 0.246
NP_442419.1_2 Reverse -151 -170 -2.65548 0.247
NP_440744.1_2 Reverse -219 -238 15.5947 0.264
NP_441308.1_8 Forward -383 -373 12.4681 0.218
NP_441308.1_8 Forward -167 -157 9.91146 0.226
NP_441308.1_8 Forward -325 -315 9.7148 0.226
NP_442183.1_1 Forward -165 -151 16.3225 0.0151
NP_442183.1_1 Reverse -372 -386 8.45605 0.115
NP_441574.1_1 Forward -165 -146 11.9958 0.101
NP_441574.1_1 Reverse -144 -163 -1.27885 0.216
NP_442347.1_2 Reverse -157 -166 4.62128 0.274
NP_442347.1_2 Forward -164 -155 4.12963 0.284
NP_442347.1_2 Forward -380 -371 3.34298 0.284
NP_442347.1_2 Reverse -373 -382 3.34298 0.284
NP_442645.1_2 Reverse -364 -383 -22.2233 0.29
NP_442888.1_9 Reverse -144 -163 12.9791 0.295
NP_441037.1_4 Forward -383 -373 16.5761 0.0168
NP_441037.1_4 Reverse -370 -380 15.0168 0.028
NP_441037.1_4 Forward -167 -157 11.9956 0.121
NP_441037.1_4 Reverse -154 -164 6.73295 0.245
NP_442594.1_7 Forward -392 -373 9.24175 0.186
NP_440563.1_4 Reverse -113 -126 20.0788 0.0969
NP_441633.1_3 Forward -167 -154 3.95252 0.0699
NP_441633.1_3 Reverse -154 -167 3.85419 0.0699
NP_441633.1_3 Reverse -370 -383 3.65753 0.0699
NP_441633.1_3 Forward -139 -126 1.9859 0.109
NP_440136.1_2 Forward -380 -373 15.9687 0.0123
NP_440136.1_2 Reverse -373 -380 15.9687 0.0123
NP_440136.1_2 Forward -164 -157 6.52896 0.116
NP_440136.1_2 Reverse -157 -164 6.13563 0.193
NP_442590.1_10 Reverse -365 -384 9.93088 0.186
NP_442998.1_5 Forward -147 -137 8.53483 0.261
NP_442998.1_5 Reverse -132 -142 8.4365 0.263
NP_442998.1_10 Forward -379 -372 15.5754 0.0102
NP_442998.1_10 Reverse -374 -381 15.5754 0.0102
NP_442998.1_10 Forward -163 -156 12.3305 0.0564
NP_442998.1_10 Reverse -158 -165 5.74231 0.255
NP_440299.1_1 Reverse -152 -165 17.2266 0.00705
NP_440299.1_1 Forward -385 -372 10.3434 0.0573
NP_440299.1_1 Reverse -11 -24 6.21356 0.149
NP_440299.1_1 Reverse -108 -121 3.85363 0.228
NP_441799.1_1 Reverse -368 -382 17.0102 0.0123
NP_441799.1_1 Forward -385 -371 9.6354 0.0879
NP_441799.1_1 Reverse -254 -268 8.16044 0.122
NP_441799.1_1 Forward -271 -257 4.32555 0.255
NP_441799.1_1 Reverse -233 -247 3.44058 0.298
NP_441007.1_10 Forward -386 -373 11.1307 0.0646
NP_442201.1_10 Reverse -247 -266 -14.8485 0.291
NP_442333.2_5 Forward -132 -113 -11.2103 0.246
NP_440256.1_1 Reverse -369 -388 7.37428 0.0259
NP_440256.1_1 Forward -270 -251 -5.50708 0.184
NP_441512.1_4 Reverse -368 -387 7.66927 0.271
NP_441559.1_8 Forward -386 -372 1.17956 0.156
NP_441559.1_8 Reverse -367 -381 -0.393733 0.175
NP_441559.1_8 Reverse -242 -256 -7.08024 0.283
NP_441559.1_8 Reverse -88 -102 -7.76856 0.299
NP_440915.1_6 Forward -385 -371 14.6509 0.0183
NP_440915.1_6 Reverse -368 -382 10.7177 0.0301
NP_440915.1_6 Forward -169 -155 6.3911 0.0826
NP_440915.1_6 Reverse -152 -166 5.30946 0.091
NP_440915.1_6 Forward -271 -257 1.08123 0.147
NP_440915.1_6 Forward -233 -219 -3.24533 0.292
NP_440997.1_3 Reverse -366 -385 12.3892 0.264
NP_441179.1_9 Forward -26 -16 8.73102 0.284
NP_440717.1_2 Forward -111 -92 -10.4236 0.245
NP_442785.1_7 Reverse -91 -105 9.2427 0.27
NP_442452.1_8 Forward -182 -168 15.6336 0.273
NP_441464.1_1 Forward -260 -241 9.24257 0.24
NP_441464.1_8 Forward -381 -367 3.8345 0.287
NP_441939.1_3 Reverse -373 -392 10.4225 0.126
NP_441939.1_3 Forward -164 -145 8.94757 0.159
NP_441199.1_6 Forward -169 -150 2.75272 0.196
NP_441494.1_6 Forward -386 -373 15.8506 0.125
NP_442993.1_1 Forward -381 -365 0.0585348 0.0668
NP_442993.1_1 Reverse -258 -274 -12.2328 0.268
NP_442386.1_9 Forward -382 -373 6.39082 0.219
NP_442386.1_9 Reverse -371 -380 6.39082 0.219
NP_442386.1_9 Forward -166 -157 6.39082 0.219
NP_442386.1_9 Reverse -155 -164 6.09583 0.23
NP_441340.1_5 Forward -380 -373 15.6737 0.0124
NP_441340.1_5 Reverse -373 -380 15.6737 0.0124
NP_441340.1_5 Forward -164 -157 5.93897 0.198
NP_441340.1_5 Reverse -157 -164 5.84064 0.208
NP_441340.1_5 Reverse -259 -266 4.07068 0.239
NP_441340.1_5 Forward -266 -259 4.07068 0.239
NP_442484.1_2 Forward -132 -113 0.687771 0.244
NP_442240.1_2 Reverse -157 -176 -14.0619 0.174
NP_442240.1_2 Reverse -373 -392 -15.2418 0.205
NP_442240.1_2 Forward -322 -303 -16.7168 0.249
NP_440161.1_3 Forward -383 -364 9.3409 0.249
NP_441134.1_6 Forward -258 -240 6.50823 0.28
NP_440586.1_1 Forward -391 -372 4.42435 0.202
NP_440586.1_1 Reverse -140 -159 -3.3438 0.265
NP_440586.1_1 Reverse -149 -168 -3.54046 0.272
NP_440586.1_8 Forward -380 -373 13.2151 0.026
NP_440586.1_8 Reverse -373 -380 13.2151 0.026
NP_440586.1_8 Forward -266 -259 7.61025 0.227
NP_440586.1_8 Reverse -259 -266 7.61025 0.227
NP_440586.1_8 Reverse -16 -23 5.8403 0.283
NP_442251.1_6 Forward -380 -373 15.2804 0.0124
NP_442251.1_6 Reverse -373 -380 15.2804 0.0124
NP_442251.1_6 Forward -164 -157 13.0188 0.0408
NP_440192.1_4 Forward -114 -95 8.81548 0.289
NP_441262.1_3 Reverse -372 -379 14.7888 0.0223
NP_441262.1_3 Forward -381 -374 14.7888 0.0223
NP_440027.1_3 Forward -267 -249 3.8533 0.263
NP_440027.1_3 Forward -168 -150 1.5917 0.3
NP_443051.1_1 Reverse -371 -380 19.5676 0.00335
NP_443051.1_1 Forward -382 -373 19.5676 0.00335
NP_443051.1_1 Forward -166 -157 0.688044 0.134
NP_443051.1_1 Reverse -155 -164 0.589713 0.143
NP_443051.1_1 Reverse -257 -266 -0.000272808 0.245
NP_439937.1_8 Forward -167 -148 1.27776 0.229
NP_439937.1_9 Reverse -155 -172 -2.42012 0.151
NP_439937.1_9 Reverse -371 -388 -6.35334 0.157
NP_439937.1_9 Forward -230 -213 -9.69657 0.202
NP_439937.1_9 Forward -166 -149 -9.89323 0.215
NP_440408.1_7 Reverse -372 -391 13.2741 0.19
NP_440408.1_7 Forward -229 -210 10.9142 0.239
NP_440408.1_10 Reverse -150 -169 17.5024 0.0923
NP_440439.1_1 Forward -384 -371 19.4888 0.0105
NP_440439.1_1 Forward -232 -219 8.27909 0.0547
NP_440439.1_1 Reverse -369 -382 1.78924 0.143
NP_440439.1_1 Forward -168 -155 1.49425 0.153
NP_440439.1_1 Reverse -255 -268 1.19926 0.159
NP_440439.1_1 Reverse -153 -166 -0.275709 0.211
NP_440439.1_1 Forward -294 -281 -0.472371 0.221
NP_440372.1_2 Forward -380 -373 16.3621 0.0124
NP_440372.1_2 Reverse -373 -380 16.3621 0.0124
NP_440372.1_2 Forward -164 -157 6.62729 0.151
NP_440372.1_2 Reverse -157 -164 6.52896 0.188
NP_440372.1_3 Forward -345 -331 14.4309 0.198
NP_440316.1_10 Reverse -257 -267 6.27322 0.264
NP_441803.1_2 Reverse -151 -170 15.9291 0.0368
NP_441803.1_2 Forward -234 -215 0.294447 0.255
NP_439977.1_5 Forward -171 -152 8.35759 0.107
NP_439977.1_5 Reverse -366 -385 5.40766 0.15
NP_439977.1_5 Reverse -150 -169 0.491109 0.208
NP_441572.1_7 Forward -387 -368 7.07928 0.0785
NP_441572.1_7 Forward -273 -254 -1.08219 0.186
NP_441572.1_7 Forward -171 -152 -1.67217 0.19
NP_442887.1_5 Reverse -98 -117 3.83436 0.264
NP_442384.1_10 Reverse -372 -385 10.934 0.0399
NP_442384.1_10 Forward -267 -254 8.37742 0.0656
NP_442384.1_10 Forward -381 -368 7.09911 0.0875
NP_442384.1_10 Forward -165 -152 0.904263 0.275
NP_441877.1_7 Forward -170 -151 1.17865 0.242
NP_441018.1_7 Reverse -5 -24 12.3892 0.161
NP_441018.1_7 Forward -295 -276 9.83255 0.218
NP_442790.1_4 Forward -390 -371 -7.4737 0.153
NP_442790.1_4 Reverse -147 -166 -8.65367 0.173
NP_442262.1_10 Forward -380 -373 14.1988 0.0123
NP_442262.1_10 Reverse -373 -380 14.1988 0.0123
NP_442262.1_10 Forward -164 -157 10.6589 0.14
NP_442262.1_10 Forward -266 -259 10.4622 0.145
NP_442262.1_10 Reverse -259 -266 10.4622 0.145
NP_441689.1_5 Forward -383 -373 8.43603 0.132
NP_441689.1_5 Reverse -370 -380 8.3377 0.132
NP_440344.1_10 Forward -172 -155 1.21881 0.0311
NP_440344.1_10 Reverse -149 -166 0.137172 0.0369
NP_440282.1_10 Reverse -248 -267 -9.14533 0.272
NP_440531.1_6 Reverse -288 -307 -5.11376 0.293
NP_442917.1_4 Reverse -85 -104 7.37428 0.235
NP_441335.1_4 Reverse -220 -239 24.5822 0.0161
NP_440562.1_3 Reverse -259 -276 2.20212 0.298
NP_441965.1_3 Forward -391 -372 1.37609 0.221
NP_441965.1_7 Forward -152 -133 17.2065 0.233
NP_441965.1_10 Forward -384 -368 2.32015 0.288
NP_441640.1_8 Reverse -107 -126 -4.03212 0.26
NP_440297.1_9 Forward -380 -370 -0.216628 0.282
NP_440297.1_9 Forward -266 -256 -0.216628 0.282
NP_440297.1_9 Reverse -373 -383 -0.314959 0.282
NP_441592.1_4 Forward -233 -214 -1.57384 0.254
NP_441896.1_3 Forward -174 -155 4.12936 0.152
NP_441896.1_3 Reverse -147 -166 -0.983855 0.252
NP_440894.1_10 Reverse -151 -170 12.3892 0.129
NP_440894.1_10 Forward -170 -151 6.39097 0.215
NP_440999.1_2 Reverse -380 -399 8.45592 0.288
NP_440999.1_9 Forward -385 -371 9.43936 0.0639
NP_440999.1_9 Forward -169 -155 6.88276 0.0932
NP_440999.1_9 Reverse -152 -166 2.75286 0.144
NP_440999.1_9 Forward -157 -143 1.08123 0.171
NP_440999.1_9 Forward -271 -257 -3.34366 0.291
NP_440888.1_2 Reverse -372 -386 19.6651 0.00106
NP_440888.1_2 Reverse -156 -170 17.9935 0.00283
NP_440888.1_2 Forward -165 -151 15.6336 0.00976
NP_440888.1_2 Forward -381 -367 8.65209 0.152
NP_440888.1_2 Forward -267 -253 5.30886 0.284
NP_440600.1_4 Forward -389 -371 -1.45582 0.166
NP_440491.1_1 Forward -168 -149 13.4467 0.122
NP_440491.1_1 Reverse -217 -236 6.62464 0.293
NP_442225.1_10 Forward -186 -167 5.40686 0.287
NP_442948.1_2 Reverse -371 -390 4.71934 0.258
NP_440663.1_5 Reverse -204 -223 12.9791 0.206
NP_442277.1_4 Forward -390 -371 27.7279 0.000534
NP_442277.1_4 Reverse -249 -268 3.14526 0.228
NP_442033.1_10 Forward -383 -364 -14.2585 0.298
NP_441543.1_2 Forward -380 -371 15.9293 0.00518
NP_441543.1_2 Reverse -373 -382 15.9293 0.00518
NP_441543.1_2 Reverse -157 -166 8.84951 0.0968
NP_441543.1_2 Forward -164 -155 8.75118 0.0968
NP_441543.1_2 Forward -266 -257 4.12963 0.279
NP_442845.1_2 Forward -387 -373 14.5526 0.0796
NP_442845.1_2 Forward -273 -259 10.3243 0.154
NP_442845.1_2 Reverse -252 -266 6.6861 0.205
NP_442845.1_3 Forward -224 -205 18.1907 0.107
NP_441469.1_8 Forward -166 -157 14.2577 0.0516
NP_441469.1_8 Reverse -155 -164 7.27622 0.227
NP_441469.1_8 Forward -382 -373 6.5879 0.227
NP_441469.1_8 Reverse -371 -380 6.5879 0.227
NP_441469.1_8 Forward -324 -315 5.70292 0.257
NP_443064.1_6 Forward -381 -371 10.8217 0.13
NP_443064.1_6 Reverse -372 -382 10.8217 0.13
NP_442578.1_7 Forward -380 -373 14.5921 0.026
NP_442578.1_7 Reverse -373 -380 14.5921 0.026
NP_442578.1_7 Reverse -157 -164 5.15232 0.291
NP_441462.1_2 Forward -381 -371 20.2362 0.000805
NP_441462.1_2 Reverse -372 -382 20.2362 0.000805
NP_441462.1_2 Forward -165 -155 1.84832 0.081
NP_441462.1_2 Reverse -156 -166 1.74999 0.0811
NP_441462.1_2 Reverse -258 -268 -0.314959 0.206
NP_441621.1_7 Forward -167 -153 6.19444 0.068
NP_441621.1_7 Reverse -154 -168 5.99778 0.068
NP_441621.1_7 Forward -383 -369 -5.11362 0.248
NP_441621.1_7 Reverse -370 -384 -5.21195 0.248
NP_443062.1_1 Forward -267 -249 6.49827 0.198
NP_443062.1_1 Forward -381 -363 5.81572 0.218
NP_441410.1_3 Reverse -363 -382 5.40766 0.241
NP_442204.1_1 Forward -385 -374 10.1868 0.0736
NP_442204.1_1 Reverse -254 -265 0.746988 0.281
NP_442204.1_5 Forward -391 -372 5.80098 0.154
NP_442204.1_9 Forward -28 -10 16.9376 0.235
NP_441560.1_10 Forward -320 -301 12.5858 0.146
NP_442487.1_5 Forward -382 -363 8.16011 0.198
NP_440516.1_2 Forward -108 -90 3.85406 0.143
NP_440516.1_8 Forward -381 -372 16.9127 0.00442
NP_440516.1_8 Reverse -372 -381 16.9127 0.00442
NP_440516.1_8 Forward -165 -156 7.17789 0.0754
NP_440516.1_8 Reverse -156 -165 7.07956 0.0867
NP_442428.1_5 Forward -380 -373 15.8704 0.0124
NP_442428.1_5 Reverse -373 -380 15.8704 0.0124
NP_442428.1_5 Forward -322 -315 7.90559 0.0969
NP_442428.1_5 Forward -164 -157 6.3323 0.193
NP_442428.1_5 Reverse -157 -164 6.13563 0.209
NP_442428.1_5 Forward -266 -259 4.36568 0.271
NP_442428.1_5 Reverse -259 -266 4.36568 0.271
NP_440783.1_5 Forward -234 -215 -1.18052 0.246
NP_441790.1_3 Reverse -157 -176 1.57275 0.181
NP_442120.1_10 Reverse -150 -169 -12.2919 0.27
NP_442823.1_8 Forward -44 -25 11.2092 0.288
NP_440673.1_2 Reverse -102 -121 12.3406 0.149
NP_440673.1_2 Reverse -5 -24 8.5361 0.266
NP_440673.1_3 Forward -379 -372 12.4288 0.0426
NP_440673.1_3 Reverse -374 -381 12.4288 0.0426
NP_440673.1_3 Reverse -20 -27 6.3323 0.283
NP_440673.1_7 Forward -392 -373 14.5524 0.0925
NP_440718.1_2 Forward -44 -25 10.2259 0.29
NP_440865.1_9 Reverse -150 -169 -7.67036 0.248
NP_441052.1_2 Forward -381 -371 10.4031 0.0285
NP_441052.1_2 Reverse -372 -382 10.4031 0.0285
NP_441052.1_2 Reverse -156 -166 1.16001 0.25
NP_441052.1_2 Forward -165 -155 1.06167 0.252
NP_442219.1_9 Forward -380 -371 8.25953 0.0681
NP_442219.1_9 Reverse -373 -382 8.25953 0.0681
NP_440436.1_4 Forward -380 -371 9.24241 0.0871
NP_440436.1_4 Reverse -373 -382 9.24241 0.0871
NP_440436.1_4 Reverse -157 -166 8.55409 0.0997
NP_440436.1_4 Forward -164 -155 8.45576 0.105
NP_440436.1_4 Forward -152 -143 7.76745 0.124
NP_440436.1_4 Reverse -113 -122 5.21086 0.214
NP_441884.1_9 Reverse -153 -172 -12.4886 0.138
NP_441884.1_9 Reverse -369 -388 -12.8819 0.138
NP_441884.1_9 Reverse -246 -265 -22.5183 0.281
NP_441884.1_9 Forward -168 -149 -22.5183 0.281
NP_441884.1_9 Reverse -132 -151 -23.895 0.284
NP_442086.1_6 Forward -165 -146 21.4356 0.0613
NP_441336.1_3 Forward -388 -374 19.6658 0.136
NP_441336.1_3 Reverse -251 -265 14.1593 0.298
NP_442864.1_2 Forward -239 -220 10.0292 0.278
NP_441719.1_4 Forward -380 -373 16.3621 0.0124
NP_441719.1_4 Reverse -373 -380 16.3621 0.0124
NP_441719.1_4 Forward -164 -157 6.62729 0.151
NP_441719.1_4 Reverse -157 -164 6.52896 0.188
NP_441733.1_10 Reverse -153 -166 15.6539 0.0564
NP_441733.1_10 Forward -168 -155 10.8357 0.106
NP_441004.1_1 Reverse -138 -157 -2.95047 0.15
NP_441004.1_1 Reverse -150 -169 -8.65367 0.201
NP_442366.1_3 Reverse -2 -20 -1.35749 0.211
NP_442366.1_3 Reverse -371 -389 -1.94747 0.219
NP_442366.1_3 Forward -382 -364 -4.60241 0.274
NP_442366.1_3 Forward -154 -136 -4.70074 0.275
NP_442366.1_3 Reverse -105 -123 -5.09406 0.281
NP_442366.1_5 Reverse -369 -379 14.8275 0.0375
NP_442139.1_7 Reverse -139 -158 9.53756 0.245
NP_442873.1_5 Forward -235 -216 9.63507 0.248
NP_441115.1_4 Reverse -371 -389 22.7328 0.000825
NP_441115.1_4 Reverse -257 -275 16.4396 0.0279
NP_441115.1_4 Forward -382 -364 15.7513 0.0354
NP_441115.1_4 Forward -268 -250 7.29487 0.291
NP_442206.1_8 Forward -218 -202 15.6593 0.278
NP_440328.1_4 Forward -387 -368 1.0811 0.234
NP_443054.1_2 Reverse -154 -168 3.34284 0.24
NP_443054.1_2 Forward -383 -369 1.76955 0.245
NP_441851.1_2 Reverse -148 -167 3.6377 0.193
NP_441851.1_10 Forward -382 -372 8.53483 0.114
NP_441851.1_10 Reverse -371 -381 8.53483 0.114
NP_441851.1_10 Forward -166 -156 6.76487 0.156
NP_441851.1_10 Reverse -155 -165 6.56821 0.161
NP_441668.1_4 Reverse -134 -153 -0.590531 0.259
NP_441668.1_4 Forward -397 -378 -1.08219 0.267
NP_442515.1_1 Forward -19 -5 -3.04867 0.285
NP_442515.1_1 Reverse -371 -385 -4.03198 0.298
NP_440593.1_3 Forward -170 -151 5.89931 0.118
NP_440593.1_3 Reverse -139 -158 -5.9004 0.268
NP_440593.1_3 Forward -29 -10 -6.39206 0.273
NP_440593.1_3 Forward -126 -107 -6.68705 0.28
NP_440593.1_3 Forward -392 -373 -7.37537 0.293
NP_440165.1_5 Forward -382 -363 -7.4737 0.265
NP_441349.1_10 Reverse -362 -381 10.0292 0.0234
NP_441349.1_10 Forward -391 -372 0.392778 0.0889
NP_441349.1_10 Reverse -248 -267 -9.63698 0.297
NP_440432.1_9 Reverse -157 -172 -4.34667 0.207
NP_440432.1_9 Forward -59 -44 -6.31328 0.296
NP_442843.1_1 Forward -120 -101 -2.85214 0.212
NP_440474.1_8 Reverse -52 -66 7.86545 0.196
NP_440474.1_8 Reverse -373 -387 7.57046 0.204
NP_441477.1_9 Reverse -163 -182 14.4541 0.269
NP_441124.1_5 Forward -147 -137 14.0586 0.215
NP_442450.1_5 Reverse -370 -380 7.64985 0.13
NP_442168.1_5 Forward -239 -220 -0.983855 0.264
NP_440588.1_2 Forward -390 -371 8.94757 0.0446
NP_442243.1_1 Forward -387 -369 3.16499 0.204
NP_441570.1_1 Forward -381 -363 -8.43732 0.112
NP_441570.1_1 Reverse -231 -249 -15.5171 0.231
NP_441570.1_1 Reverse -372 -390 -17.2871 0.269
NP_441078.1_4 Forward -381 -372 19.6659 0.0007
NP_441078.1_4 Reverse -372 -381 19.6659 0.0007
NP_441078.1_4 Reverse -156 -165 10.0295 0.0167
NP_441078.1_4 Forward -165 -156 9.93116 0.0203
NP_441078.1_4 Forward -267 -258 -1.6719 0.266
NP_441078.1_4 Reverse -258 -267 -1.77023 0.266
NP_442729.1_8 Reverse -152 -165 18.6038 0.0312
NP_441663.1_8 Forward -235 -216 -3.04881 0.276
NP_442443.1_1 Forward -224 -205 -5.99873 0.289
NP_440526.1_3 Reverse -60 -71 5.36805 0.249
NP_440526.1_3 Reverse -187 -198 4.28642 0.267
NP_440526.1_3 Reverse -157 -168 2.71313 0.267
NP_440526.1_3 Reverse -373 -384 2.31981 0.267
NP_440526.1_3 Forward -380 -369 1.92649 0.267
NP_441432.1_8 Reverse -371 -380 16.8143 0.00595
NP_441432.1_8 Forward -382 -373 16.8143 0.00595
NP_441432.1_8 Reverse -257 -266 6.19458 0.118
NP_441432.1_8 Reverse -143 -152 5.3096 0.17
NP_442320.1_4 Forward -278 -259 21.6314 0.085
NP_442320.1_8 Forward -171 -157 14.5526 0.0132
NP_442320.1_8 Reverse -150 -164 6.98109 0.0223
NP_442320.1_8 Forward -387 -373 -2.75368 0.0966
NP_442344.1_7 Forward -380 -361 -6.09707 0.17
NP_441732.1_2 Reverse -368 -384 3.00846 0.0141
NP_441732.1_2 Forward -385 -369 -6.52964 0.0495
NP_441732.1_2 Forward -169 -153 -15.1828 0.145
NP_441732.1_2 Forward -22 -6 -17.5427 0.27
NP_442540.1_5 Reverse -74 -93 13.175 0.233
NP_442815.1_2 Reverse -133 -151 2.28076 0.296
NP_440760.1_1 Reverse -156 -175 -21.535 0.238
NP_440760.1_1 Forward -165 -146 -21.83 0.245
NP_442797.1_6 Reverse -5 -24 7.35242 0.294
NP_442797.1_7 Forward -230 -212 6.31233 0.21
NP_442797.1_7 Forward -247 -229 6.11567 0.21
NP_442797.1_7 Forward -166 -148 4.9357 0.217
NP_442797.1_7 Reverse -224 -242 -0.177514 0.282
NP_442797.1_7 Forward -236 -218 -0.964162 0.291
NP_441057.1_4 Reverse -134 -152 -1.06249 0.272
NP_441072.1_2 Reverse -361 -380 15.5357 0.129
NP_440713.1_4 Forward -391 -372 2.55606 0.26
NP_440713.1_4 Forward -250 -231 1.27776 0.289
NP_442489.1_2 Forward -278 -259 0.687771 0.297
NP_442489.1_7 Forward -381 -372 20.1576 0.000695
NP_442489.1_7 Reverse -372 -381 20.1576 0.000695
NP_442489.1_7 Forward -165 -156 10.4228 0.0151
NP_442489.1_7 Reverse -156 -165 10.3245 0.0193
NP_442489.1_7 Forward -267 -258 -1.6719 0.235
NP_442489.1_7 Reverse -258 -267 -1.77023 0.247
NP_440757.1_7 Forward -233 -215 1.19912 0.269
NP_440559.1_1 Reverse -373 -382 8.65285 0.0586
NP_440559.1_1 Forward -380 -371 8.65285 0.0586
NP_441659.2_8 Forward -381 -371 20.9245 0.000805
NP_441659.2_8 Reverse -372 -382 20.9245 0.000805
NP_441659.2_8 Forward -267 -257 6.8632 0.0663
NP_441659.2_8 Forward -165 -155 2.24165 0.207
NP_441659.2_8 Reverse -156 -166 2.14332 0.211
NP_441659.2_8 Forward -153 -143 0.668351 0.26
NP_442913.1_9 Reverse -150 -169 7.96426 0.272
NP_442913.1_10 Reverse -363 -382 10.2259 0.0421
NP_442913.1_10 Forward -390 -371 6.68596 0.058
NP_441040.1_2 Forward -389 -370 -14.7502 0.286
NP_442008.1_2 Reverse -164 -183 7.66927 0.207
NP_442008.1_2 Reverse -369 -388 4.71934 0.232
NP_442776.1_1 Reverse -113 -132 12.8808 0.127
NP_442776.1_6 Forward -383 -364 10.5209 0.207
NP_441185.1_6 Reverse -108 -127 12.4875 0.177
NP_442346.1_5 Forward -382 -372 16.303 0.00248
NP_442346.1_5 Reverse -371 -381 16.303 0.00248
NP_442346.1_5 Reverse -257 -267 13.8447 0.0194
NP_442346.1_5 Forward -268 -258 12.1731 0.0475
NP_440545.1_3 Reverse -368 -385 17.5418 0.0108
NP_440545.1_3 Forward -385 -368 8.10198 0.0463
NP_440545.1_3 Reverse -254 -271 -4.48438 0.227
NP_440545.1_5 Reverse -368 -385 9.67528 0.21
NP_440486.1_2 Forward -170 -151 10.6192 0.23
NP_440486.1_6 Forward -109 -90 6.09597 0.283
NP_440459.1_2 Reverse -376 -393 12.3302 0.151
NP_440459.1_2 Forward -231 -214 7.61033 0.285
NP_441653.1_2 Forward -164 -145 2.85318 0.284
NP_440010.1_4 Forward -28 -9 -2.55791 0.284
NP_441943.1_8 Forward -237 -218 -13.3736 0.265
NP_442311.1_5 Reverse -240 -259 0.884433 0.27
NP_442603.1_7 Reverse -372 -386 12.782 0.0948
NP_442603.1_7 Forward -229 -215 6.0955 0.259
NP_441888.1_7 Reverse -151 -165 1.17956 0.263
NP_440449.1_6 Forward -389 -371 28.3893 0.0000419
NP_441948.1_4 Reverse -365 -383 0.805796 0.135
NP_441047.1_2 Forward -216 -197 3.44104 0.231
NP_441502.1_3 Reverse -142 -161 8.06259 0.228
NP_441833.1_4 Forward -380 -373 15.9687 0.0124
NP_441833.1_4 Reverse -373 -380 15.9687 0.0124
NP_441833.1_4 Forward -164 -157 12.9205 0.0393
NP_441833.1_4 Reverse -157 -164 6.13563 0.198
NP_442162.1_9 Forward -380 -373 16.2637 0.0124
NP_442162.1_9 Reverse -373 -380 16.2637 0.0124
NP_442162.1_9 Forward -164 -157 6.52896 0.178
NP_442162.1_9 Reverse -157 -164 6.43063 0.208
NP_443015.1_4 Reverse -144 -163 16.8141 0.287
NP_440671.1_2 Reverse -375 -389 18.4858 0.0965
NP_440671.1_4 Forward -206 -192 11.111 0.141
NP_442404.1_9 Forward -162 -148 10.717 0.263
NP_442821.1_7 Forward -218 -199 17.3057 0.274
NP_442199.1_5 Reverse -148 -167 -2.26216 0.185
NP_442199.1_5 Forward -275 -256 -4.6221 0.229
NP_442199.1_5 Forward -161 -142 -5.70374 0.253
NP_442140.1_3 Reverse -16 -26 10.8948 0.0893
NP_442140.1_3 Reverse -373 -383 7.94484 0.124
NP_442140.1_3 Forward -164 -154 7.74818 0.13
NP_442140.1_3 Reverse -157 -167 7.64985 0.133
NP_442140.1_3 Forward -380 -370 6.66654 0.159
NP_440875.1_9 Reverse -374 -384 14.5042 0.0411
NP_440875.1_9 Reverse -146 -156 10.5134 0.212
NP_440875.1_9 Forward -265 -255 9.63741 0.233
NP_440875.1_9 Reverse -260 -270 9.3454 0.233
NP_440875.1_9 Reverse -158 -168 7.88535 0.255
NP_440875.1_9 Forward -379 -369 7.69067 0.255
NP_442547.1_7 Forward -232 -213 10.417 0.279
NP_441813.1_5 Forward -383 -373 8.73149 0.0367
NP_441813.1_5 Reverse -370 -380 8.63316 0.0367
NP_441813.1_5 Forward -167 -157 0.275027 0.206
NP_441813.1_5 Reverse -154 -164 0.176696 0.215
NP_440590.1_4 Reverse -373 -386 12.999 0.013
NP_440590.1_4 Reverse -157 -170 11.9173 0.0173
NP_440590.1_4 Forward -164 -151 10.934 0.0235
NP_440590.1_4 Forward -380 -367 2.96921 0.0783
NP_440590.1_4 Forward -228 -215 1.88757 0.108
NP_440567.1_1 Reverse -373 -387 16.6175 0.0166
NP_440567.1_1 Reverse -157 -171 9.04604 0.0501
NP_440567.1_1 Forward -164 -150 6.6861 0.0816
NP_440567.1_1 Forward -380 -366 0.392915 0.246
NP_442497.1_10 Forward -380 -371 17.601 0.00813
NP_442497.1_10 Reverse -373 -382 17.601 0.00813
NP_442497.1_10 Forward -164 -155 0.688044 0.141
NP_442497.1_10 Reverse -157 -166 0.589713 0.153
NP_440821.1_4 Forward -383 -373 10.7964 0.0146
NP_440821.1_4 Forward -167 -157 9.22315 0.0334
NP_440821.1_4 Reverse -154 -164 8.92815 0.0382
NP_440821.1_4 Reverse -370 -380 2.24165 0.131
NP_441239.1_9 Forward -383 -371 14.887 0.0247
NP_441239.1_9 Forward -167 -155 14.4936 0.0272
NP_441239.1_9 Forward -269 -257 13.412 0.037
NP_441239.1_9 Reverse -370 -382 11.1504 0.0648
NP_441239.1_9 Reverse -256 -268 8.9871 0.117
NP_441239.1_9 Reverse -154 -166 8.79043 0.122
NP_440400.1_1 Reverse -283 -302 5.2102 0.22
NP_441892.1_1 Forward -390 -373 2.59545 0.14
NP_442270.1_9 Forward -392 -373 -7.27704 0.213
NP_442270.1_9 Forward -126 -107 -8.06369 0.216
NP_440354.1_5 Reverse -369 -388 15.7324 0.103
NP_442052.1_7 Reverse -215 -229 14.2576 0.22
NP_442052.1_8 Forward -123 -113 14.828 0.253
NP_440546.1_4 Reverse -372 -382 13.5365 0.0459
NP_440546.1_4 Forward -381 -371 13.5365 0.0459
NP_440546.1_4 Reverse -258 -268 12.9547 0.0572
NP_440546.1_4 Forward -267 -257 12.0821 0.0679
NP_440546.1_4 Reverse -156 -166 8.30077 0.196
NP_439974.1_4 Forward -164 -145 7.47261 0.294
NP_440462.1_6 Forward -383 -373 19.4496 0.00371
NP_440462.1_6 Reverse -370 -380 10.5014 0.0396
NP_440462.1_6 Forward -167 -157 8.63316 0.0588
NP_440462.1_6 Reverse -154 -164 8.1415 0.0699
NP_440868.1_2 Forward -157 -143 20.6889 0.0943
NP_440868.1_4 Forward -385 -373 9.97041 0.0405
NP_440868.1_4 Reverse -368 -380 6.23383 0.0878
NP_441879.1_3 Reverse -373 -392 3.24438 0.261
NP_440653.1_10 Reverse -113 -132 8.55425 0.198
NP_440696.1_3 Reverse -248 -266 -1.94747 0.269
NP_440696.1_6 Reverse -360 -379 16.5191 0.142
NP_442039.1_4 Forward -380 -373 15.1821 0.0124
NP_442039.1_4 Reverse -373 -380 15.1821 0.0124
NP_442039.1_4 Forward -164 -157 11.3472 0.086
NP_442039.1_7 Forward -119 -109 14.0414 0.211
NP_442039.1_7 Forward -22 -12 13.648 0.211
NP_441811.1_4 Forward -167 -148 -0.295539 0.295
NP_441811.1_8 Forward -71 -57 17.6008 0.0748
NP_441926.1_3 Forward -381 -365 5.95839 0.17
NP_442837.1_3 Forward -380 -373 15.7721 0.0124
NP_442837.1_3 Reverse -373 -380 15.7721 0.0124
NP_442837.1_3 Forward -164 -157 6.52896 0.2
NP_442837.1_3 Reverse -157 -164 6.0373 0.25
NP_439994.1_3 Forward -382 -363 12.3406 0.153
NP_439994.1_3 Reverse -371 -390 8.43855 0.291
NP_442053.1_1 Forward -381 -372 18.3876 0.0007
NP_442053.1_1 Reverse -372 -381 18.3876 0.0007
NP_442053.1_1 Reverse -156 -165 14.7494 0.0109
NP_442053.1_1 Forward -165 -156 8.75118 0.0728
NP_440505.1_3 Forward -383 -373 15.418 0.0114
NP_440505.1_3 Reverse -229 -239 9.41981 0.122
NP_440505.1_3 Reverse -370 -380 8.04317 0.147
NP_440505.1_3 Reverse -176 -186 7.25653 0.16
NP_440505.1_3 Forward -167 -157 5.09324 0.246
NP_440505.1_3 Reverse -154 -164 4.40493 0.292
NP_441959.1_10 Reverse -219 -237 11.8138 0.225
NP_440207.2_2 Forward -167 -148 18.7003 0.258
NP_442532.1_7 Reverse -51 -65 10.1277 0.171
NP_442532.1_7 Forward -165 -151 7.9644 0.171
NP_442532.1_7 Reverse -372 -386 6.29277 0.171
NP_440914.1_1 Forward -381 -371 16.3248 0.00196
NP_440914.1_1 Reverse -372 -382 16.3248 0.00196
NP_440914.1_1 Forward -121 -111 9.39583 0.186
NP_440914.1_1 Reverse -282 -292 7.44401 0.237
NP_440914.1_1 Reverse -156 -166 6.17532 0.293
NP_440914.1_2 Forward -114 -95 17.6007 0.255
NP_441699.1_5 Forward -167 -148 10.4225 0.194
NP_441011.1_8 Forward -380 -371 16.6177 0.00602
NP_441011.1_8 Reverse -373 -382 16.6177 0.00602
NP_441011.1_8 Forward -322 -313 8.35786 0.144
NP_441011.1_8 Forward -164 -155 7.37455 0.172
NP_441011.1_8 Reverse -157 -166 7.17789 0.179
NP_442533.1_6 Forward -381 -372 17.2076 0.00137
NP_442533.1_6 Reverse -372 -381 17.2076 0.00137
NP_442533.1_6 Reverse -258 -267 14.4544 0.013
NP_442533.1_6 Reverse -156 -165 8.25953 0.0776
NP_442533.1_6 Forward -165 -156 7.47288 0.0898
NP_442533.1_6 Forward -267 -258 6.78456 0.103
NP_442541.1_10 Forward -267 -253 4.42388 0.252
NP_442232.1_3 Forward -389 -370 -13.7669 0.283
NP_442232.1_3 Reverse -148 -167 -14.5535 0.288
NP_442232.1_3 Reverse -229 -248 -15.3402 0.291
NP_442229.1_1 Forward -383 -369 9.14375 0.184
NP_442229.1_1 Reverse -154 -168 8.65209 0.184
NP_441482.1_7 Forward -387 -373 -10.1285 0.209
NP_441482.1_7 Reverse -366 -380 -10.5218 0.209
NP_441482.1_7 Reverse -150 -164 -10.6202 0.211
NP_441482.1_7 Forward -24 -10 -11.3085 0.254
NP_439944.1_9 Reverse -373 -383 17.7779 0.00341
NP_439944.1_9 Forward -380 -370 9.12481 0.1
NP_439944.1_9 Reverse -157 -167 6.56821 0.175
NP_440116.1_8 Forward -380 -361 -1.67217 0.12
NP_440116.1_8 Reverse -373 -392 -8.85033 0.261
NP_441527.1_4 Forward -352 -333 -12.6531 0.292
NP_440115.1_6 Forward -384 -374 16.008 0.0325
NP_440115.1_6 Forward -30 -20 7.15819 0.158
NP_440007.1_9 Reverse -368 -382 0.589577 0.294
NP_441602.1_3 Reverse -151 -170 19.174 0.0354
NP_441602.1_3 Reverse -10 -29 0.392778 0.217
NP_441602.1_3 Forward -170 -151 -1.27885 0.226
NP_441602.1_3 Forward -245 -226 -2.65548 0.235
NP_441972.1_5 Forward -239 -220 -5.21209 0.215
NP_441972.1_5 Reverse -145 -164 -9.83364 0.293
NP_441106.1_1 Reverse -371 -380 18.486 0.0028
NP_441106.1_1 Forward -382 -373 18.486 0.0028
NP_441106.1_1 Forward -166 -157 8.45619 0.0548
NP_441106.1_1 Reverse -155 -164 8.35786 0.0585
NP_441106.1_1 Reverse -257 -266 5.50626 0.145
NP_441106.1_1 Forward -268 -259 4.62128 0.213
NP_440429.1_2 Reverse -151 -170 10.6192 0.267
NP_441825.1_4 Forward -292 -282 13.4514 0.249
NP_442249.1_5 Forward -254 -235 10.0292 0.19
NP_442588.1_1 Reverse -160 -179 8.35759 0.231
NP_442306.1_10 Reverse -367 -386 -20.3551 0.208
NP_441286.1_1 Reverse -371 -383 5.25052 0.0259
NP_441286.1_1 Forward -382 -370 -3.50094 0.145
NP_441286.1_1 Forward -166 -154 -4.48425 0.161
NP_441286.1_1 Reverse -155 -167 -4.58258 0.165
NP_440670.1_8 Forward -381 -372 18.3876 0.000699
NP_440670.1_8 Reverse -372 -381 18.3876 0.000699
NP_440670.1_8 Reverse -156 -165 15.1427 0.00768
NP_440670.1_8 Forward -165 -156 8.65285 0.0627
NP_440886.1_7 Reverse -155 -165 15.9091 0.0203
NP_440886.1_7 Forward -375 -365 11.3859 0.0805
NP_440886.1_7 Forward -382 -372 8.04271 0.0805
NP_440886.1_7 Reverse -371 -381 8.04271 0.0805
NP_440886.1_7 Forward -166 -156 8.04271 0.0805
NP_439940.1_1 Reverse -33 -52 -2.36049 0.135
NP_442072.1_9 Reverse -371 -389 -3.12744 0.0334
NP_442072.1_9 Reverse -155 -173 -4.01242 0.0399
NP_442072.1_9 Forward -382 -364 -13.4522 0.112
NP_442072.1_9 Forward -166 -148 -13.9439 0.126
NP_442072.1_9 Reverse -250 -268 -14.7305 0.156
NP_442072.1_9 Reverse -364 -382 -15.6155 0.184
NP_440513.1_6 Reverse -248 -267 12.4867 0.222
NP_440028.1_3 Reverse -113 -132 20.9509 0.0576
NP_440907.2_8 Reverse -373 -383 19.1541 0.00362
NP_440907.2_8 Forward -380 -370 15.9091 0.0161
NP_440907.2_8 Reverse -157 -167 8.23937 0.117
NP_440907.2_8 Forward -164 -154 7.94438 0.117
NP_442264.1_2 Forward -163 -146 5.15205 0.284
NP_441021.1_1 Forward -164 -145 -5.70374 0.177
NP_441021.1_1 Reverse -373 -392 -7.57203 0.184
NP_441463.1_3 Reverse -146 -165 -8.752 0.273
NP_441626.1_2 Forward -380 -373 15.7721 0.0124
NP_441626.1_2 Reverse -373 -380 15.7721 0.0124
NP_441626.1_2 Forward -164 -157 6.0373 0.212
NP_441626.1_2 Reverse -157 -164 5.93897 0.231
NP_440107.1_5 Reverse -251 -270 3.14605 0.175
NP_442794.1_1 Reverse -140 -152 2.89058 0.286
NP_442615.1_1 Reverse -363 -381 23.8152 0.00208
NP_442615.1_1 Forward -390 -372 5.72234 0.0374
NP_442615.1_1 Reverse -147 -165 -2.43913 0.144
NP_442615.1_1 Forward -276 -258 -2.83245 0.151
NP_441962.1_4 Reverse -151 -170 -0.688862 0.117
NP_441962.1_4 Forward -158 -139 -4.52377 0.158
NP_441962.1_4 Reverse -232 -251 -6.68705 0.18
NP_441962.1_4 Forward -170 -151 -8.26035 0.198
NP_441962.1_4 Reverse -54 -73 -11.9969 0.25
NP_441962.1_4 Forward -167 -148 -12.8819 0.265
NP_441962.1_4 Forward -29 -10 -13.8652 0.279
NP_440387.1_1 Reverse -372 -388 9.20332 0.0281
NP_440387.1_1 Forward -165 -149 7.43336 0.0282
NP_440387.1_1 Forward -381 -365 6.9417 0.0282
NP_441431.1_2 Forward -384 -370 16.6169 0.0341
NP_441431.1_2 Reverse -255 -269 9.6354 0.181
NP_441431.1_2 Forward -156 -142 8.75042 0.207
NP_441431.1_2 Reverse -293 -307 8.16044 0.222
NP_441431.1_2 Reverse -369 -383 7.76712 0.234
NP_441431.1_2 Forward -168 -154 5.60385 0.294
NP_441488.1_7 Reverse -150 -169 6.68596 0.139
NP_441836.1_2 Reverse -252 -271 -3.63879 0.242
NP_441836.1_2 Forward -30 -11 -4.03212 0.251
NP_441993.1_1 Reverse -150 -169 6.81956 0.177
NP_441993.1_1 Forward -387 -368 6.23481 0.184
NP_441993.1_1 Forward -326 -307 5.94244 0.192
NP_441993.1_1 Reverse -153 -172 3.31109 0.237
NP_441993.1_1 Forward -400 -381 2.33652 0.26
NP_441993.1_1 Reverse -9 -28 0.972113 0.288
NP_441174.1_2 Forward -384 -370 13.5693 0.196
NP_440814.1_4 Reverse -363 -382 -13.5702 0.293
NP_440114.1_10 Forward -381 -367 15.6342 0.0243
NP_440114.1_10 Forward -267 -253 11.3077 0.118
NP_440114.1_10 Reverse -258 -272 9.04604 0.186
NP_440114.1_10 Reverse -372 -386 8.35772 0.207
NP_442437.1_8 Reverse -145 -164 6.39097 0.242
NP_442698.1_10 Forward -37 -18 -1.47551 0.299
NP_442323.1_7 Forward -234 -215 1.47364 0.279
NP_441510.2_7 Forward -24 -10 11.307 0.28
NP_440287.1_6 Reverse -363 -382 8.84924 0.151
NP_441272.1_4 Forward -390 -371 8.45592 0.189
NP_440766.1_4 Forward -169 -155 16.4209 0.0256
NP_440766.1_4 Forward -385 -371 6.78443 0.0973
NP_441979.1_5 Reverse -150 -169 -12.5869 0.228
NP_439910.1_2 Forward -173 -156 -22.0856 0.207
NP_440457.1_1 Forward -204 -192 8.59377 0.101
NP_440457.1_1 Forward -385 -373 7.31547 0.105
NP_440457.1_1 Reverse -368 -380 0.923956 0.25
NP_440987.1_4 Forward -350 -331 11.1109 0.15
NP_440798.1_6 Reverse -373 -386 11.524 0.0592
NP_440798.1_6 Forward -380 -367 2.96921 0.158
NP_441436.1_2 Forward -210 -191 -5.21209 0.294
NP_442509.1_9 Forward -165 -155 13.3526 0.0571
NP_442509.1_9 Reverse -372 -382 8.04271 0.192
NP_442509.1_9 Forward -381 -371 8.04271 0.192
NP_442509.1_9 Reverse -156 -166 7.0594 0.24
NP_440081.1_1 Reverse -352 -371 14.0608 0.281
NP_442439.1_8 Forward -25 -6 10.1275 0.246
NP_442514.1_5 Forward -129 -110 -8.16275 0.285
NP_440554.1_4 Reverse -373 -383 15.418 0.0199
NP_440554.1_4 Forward -164 -154 10.6981 0.0449
NP_440554.1_4 Forward -380 -370 8.82982 0.0646
NP_440554.1_4 Forward -266 -256 5.28991 0.153
NP_440554.1_4 Reverse -259 -269 4.79825 0.175
NP_440554.1_4 Reverse -157 -167 4.10993 0.201
NP_441761.1_2 Forward -260 -241 16.4207 0.28
NP_441885.1_5 Forward -381 -371 11.3864 0.00668
NP_441885.1_5 Reverse -372 -382 11.3864 0.00668
NP_441885.1_5 Reverse -156 -166 1.94665 0.0935
NP_441885.1_5 Forward -165 -155 1.74999 0.0991
NP_440478.1_4 Forward -233 -214 18.3873 0.059
NP_442341.1_7 Reverse -155 -169 20.1574 0.00702
NP_442341.1_7 Forward -166 -152 11.996 0.049
NP_442341.1_7 Reverse -371 -385 3.93283 0.208
NP_442341.1_7 Forward -375 -361 2.75286 0.247
NP_442341.1_9 Forward -383 -369 8.55376 0.168
NP_442341.1_9 Reverse -370 -384 5.99717 0.247
NP_442341.1_9 Forward -231 -217 5.60385 0.263
NP_441756.1_5 Reverse -216 -235 4.52268 0.199
NP_441756.1_5 Forward -231 -212 -2.36049 0.276
NP_441756.1_5 Reverse -214 -233 -2.75381 0.283
NP_442395.2_4 Forward -166 -147 11.2084 0.0919
NP_442395.2_4 Reverse -236 -255 0.981987 0.255
NP_440423.1_10 Forward -122 -103 12.0942 0.206
NP_443000.1_7 Forward -383 -373 10.7964 0.0345
NP_443000.1_7 Reverse -370 -380 10.6981 0.0345
NP_443000.1_7 Reverse -256 -266 0.766681 0.29
NP_441842.1_1 Reverse -374 -387 16.7349 0.0433
NP_441842.1_10 Forward -388 -374 13.1759 0.0809
NP_441842.1_10 Forward -172 -158 8.35772 0.225
NP_441842.1_10 Reverse -149 -163 6.6861 0.278
NP_440275.1_3 Forward -383 -373 18.6629 0.0082
NP_440275.1_3 Reverse -370 -380 9.02648 0.0563
NP_440275.1_3 Forward -167 -157 8.23984 0.0602
NP_440275.1_3 Reverse -154 -164 8.1415 0.0602
NP_440091.1_1 Reverse -368 -380 3.2839 0.163
NP_440091.1_1 Forward -169 -157 2.89058 0.181
NP_440091.1_1 Forward -28 -16 1.02229 0.218
NP_440091.1_1 Forward -385 -373 0.825626 0.227
NP_440679.1_10 Forward -72 -53 -20.7484 0.286
NP_443010.1_10 Forward -384 -367 9.63179 0.135
NP_441359.1_5 Forward -232 -213 1.86774 0.285
NP_442451.1_2 Forward -173 -154 -0.590531 0.159
NP_441122.1_1 Reverse -108 -123 13.0579 0.153
NP_439962.1_4 Reverse -217 -236 -0.39387 0.199
NP_439962.1_4 Reverse -214 -233 -5.50708 0.28
NP_439962.1_4 Reverse -148 -167 -8.16202 0.292
NP_442495.1_5 Forward -266 -247 9.43923 0.287
NP_440149.1_8 Forward -165 -146 -2.55715 0.172
NP_441105.1_3 Forward -392 -373 6.19431 0.0624
NP_441105.1_3 Reverse -145 -164 5.60432 0.0669
NP_441105.1_3 Forward -164 -145 -6.58872 0.236
NP_440216.1_1 Reverse -372 -386 8.25939 0.0061
NP_440216.1_1 Forward -381 -367 7.47274 0.00942
NP_440216.1_1 Reverse -156 -170 -1.5737 0.034
NP_440216.1_1 Forward -267 -253 -2.06536 0.0458
NP_440216.1_1 Forward -165 -151 -12.2918 0.256
NP_440216.1_6 Forward -388 -372 6.64671 0.189
NP_440216.1_9 Forward -22 -13 7.76787 0.286
NP_440216.1_9 Forward -119 -110 7.17789 0.286
NP_440172.1_1 Forward -381 -371 17.5813 0.00421
NP_440172.1_1 Reverse -372 -382 17.5813 0.00421
NP_440172.1_1 Reverse -258 -268 7.45319 0.0789
NP_440172.1_1 Reverse -156 -166 6.8632 0.0991
NP_442290.1_8 Reverse -14 -28 15.2409 0.288
NP_442015.1_10 Forward -385 -372 4.93583 0.156
NP_441226.1_7 Forward -380 -373 14.4934 0.0123
NP_441226.1_7 Reverse -373 -380 14.4934 0.0123
NP_442446.1_3 Forward -165 -146 9.24257 0.288
NP_441111.1_7 Forward -380 -372 18.7023 0.00294
NP_441111.1_7 Reverse -373 -381 18.7023 0.00294
NP_441111.1_7 Forward -164 -156 8.96754 0.0463
NP_441111.1_7 Reverse -157 -165 8.86921 0.0589
NP_442379.1_10 Forward -388 -371 7.41366 0.102
NP_439971.2_9 Forward -171 -152 16.0274 0.27
NP_441766.1_2 Forward -381 -372 17.5026 0.00297
NP_441766.1_2 Reverse -372 -381 17.5026 0.00297
NP_441766.1_2 Reverse -156 -165 13.6677 0.0121
NP_441766.1_2 Forward -165 -156 7.76787 0.0714
NP_442417.1_5 Forward -225 -211 4.81781 0.288
NP_440416.1_9 Forward -183 -164 -19.6667 0.276
NP_443052.1_8 Forward -175 -156 -8.752 0.179
NP_443052.1_9 Forward -182 -163 2.0644 0.177
NP_443052.1_9 Forward -94 -75 -6.1954 0.279
NP_441135.1_4 Forward -378 -359 3.04771 0.284
NP_440591.1_9 Reverse -149 -167 20.2753 0.0286
NP_440261.1_5 Reverse -373 -386 6.70579 0.0318
NP_440261.1_5 Forward -266 -253 -6.37223 0.201
NP_440261.1_5 Reverse -157 -170 -10.8955 0.221
NP_440261.1_5 Forward -228 -215 -12.3704 0.284
NP_440261.1_5 Forward -380 -367 -12.4687 0.297
NP_440988.1_4 Reverse -162 -181 6.98095 0.295
NP_440988.1_10 Forward -20 -6 7.12552 0.221
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GCAATTTACCTTTGCCGGAGGCGATCGCCTATCATCACAAAGTTGCTCAGGAGAAGTTAAAAGAAATTTATGCAAGCTGTGATGCCTGGCTGTTTACCAGTCGGTTGGAGGGGTTTGGTTTACCTATTTTAGAAGCCATGGCCTGCCGCACCCCTGTGATTGGGACCCCCACGGGAGCGGCCCCGGAACTGATAGAGCAGGGAGGTGGGATTTTAGTACCCCCTGAAGATCCAGCGGAGATCGCCGCAGCCATTGTCAAAATCTGCACTCAACCCCTTGAACAATGGCAAACGTTGTCGGACAAGGCCTACCAGACTGCCAGTTGCTACAGTTGGGATGATGCCACCACCTTATTTGAACAGGCTTTAGAGGAAGCAACCATGGCAACAGCAAACGATCC

CDS

ATGACCCCCCAAGCCCAACTGGTTCTCCTGCTGTGGTTACCAGTTATTCTGTATTTCTTTCGACGCTACCCTCCCCGTACCGCTGTCATGGTCAGCTTTTTGGGAGGCTTACTTTTTCTGCCGCAACGTACTGGCTTTGCTTTGCCGCTTATCCCCGACTATCAGGGCATGGTCGCCACCTGTTACGGCATTGTGGTGGGGCTTTGTATCCATGATTTGGAACGGCTGAAAAAATTTCGGATTGAATGGCTGGATATACCCATGATGTTGTGGTGTATTTCTCCATTTATGTCCTCTGTTACCAATGGTTTAGGGGCCTATGACGGCGTTAATGAATCCATCACTCAAACTGTGGTTTGGGGCTTACCCTATATGTTGGGCAAGCTGTACTTTAATCGCCTAATTTATCTCAAACAATTGGCTGAAGGCATTATTAAAGCAGGTTTAATTTATGTGCCCATCTGCCTCTGGGAAGGACGCATGAGTCCCAATTTGCACCTGATTGTTTATGGCTATTATGCCCATCCTTCCGGCATTAGTCAGGCCATTCGCTACGGTGGCTATCGTCCCAATGGGTTTATGCAACATGGCTTGATGGTGGGGATGTGGATGATGACAGTAGCATTAATTACCATCTGGCTCTGGCAGTCCAAAACCTTTACCAAAATTTGGAATTACGAAATTAAATCATTGATTCCGGTCCTGGTGTTTACCGTGATCTGGTGCCGCTCGACAGGGGCCTATGGTTATTTTTTCTATGGCTTGATTATTCTCTTTACTGCTAAATTTCTAAAATCAAACTTGCCCCTACTCATTTTAATTTTTGGCCTTGGCTGGTTCCTCTATATGAATGTGACCGGTCAGTTCCATGGGGATAAAATTCTCGCTTTTTTAAGTGAATATACCAATCCTGATCGCATTCAATCCCTGGGCTTTCGCTGGATAAATGAGGAGATTTTAGCGGAAAAAGCCCGAGAGCGATTTTGGTTTGGTTGGGCGGGCTGGAAACGCAATCGGGTCTATGAAGAAAACTGGATCGGCGAAATTGTCGATGTGTCTGTGACCGATAGCCTCTGGATTATTGCCTTTGGCATTCAAGGAGCCTTTGGCCTGCTGAACTTAACCCTAGCCCTGCTCTTACCCCCGGCCGTTTTTGCCACATTTCGCTATCCCGCTAAGTTATGGCTCCATCCGAAAGTTGCCCCCGCCGCCGCCCTGGCCACCTGTCTGGTGCTGTTTAAGTTGGATTCTGTGATTAACAATATGTATAATCCGATTTTTCCCCTGATTAGTGGTGGTTTAGCGGGATTATGTTTACAACCACCGGAATCTTTAAAGCCCCAGTCCCGATCGCCAGCGGTTAAACAGGTAAAAAAACAGAAGCAGAAATCTAGTGAGCAGGGGAAACTCAAAACCAAGCCGGGGCGCTCAAAGTCAGGGTCAGGCAAAAGGTCTAAAGTTAGACGCAAAGTTGTACATAGGGCAGGCACGAAATCAGACAGCGATCCATCAAGCTAA

Protein

No sequence available