Your browser is old and dusty. Try Google Chrome!

Details for sll5046

ORF sll5046
Accession NP_942202.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_2 Reverse -203 -222 15.2408 0.286
NP_441061.1_2 Forward -362 -348 8.75105 0.0846
NP_441061.1_2 Forward -20 -6 5.60446 0.132
NP_441061.1_2 Forward -29 -15 2.75286 0.172
NP_441061.1_2 Reverse -209 -223 1.76955 0.183
NP_441418.1_6 Reverse -342 -361 -19.3717 0.0876
NP_441418.1_6 Reverse -208 -227 -20.4534 0.114
NP_441418.1_6 Forward -139 -120 -29.5982 0.23
NP_441480.1_8 Reverse -347 -366 12.0942 0.279
NP_442291.1_5 Forward -218 -202 -3.67804 0.249
NP_440897.1_6 Forward -217 -198 5.01354 0.125
NP_441453.1_4 Reverse -208 -216 6.80426 0.121
NP_441453.1_4 Reverse -12 -20 6.70593 0.121
NP_441453.1_4 Forward -217 -209 6.11594 0.121
NP_442151.1_6 Reverse -208 -222 16.6175 0.0139
NP_441818.1_1 Forward -216 -205 14.4145 0.0502
NP_441818.1_9 Reverse -340 -359 -2.85214 0.209
NP_440226.1_1 Reverse -208 -227 3.53937 0.221
NP_440226.1_1 Reverse -27 -46 2.65439 0.256
NP_441630.1_3 Forward -29 -10 12.7825 0.0624
NP_441630.1_3 Reverse -200 -219 -0.688862 0.288
NP_440259.1_4 Reverse -181 -195 16.9268 0.117
NP_440120.1_4 Reverse -276 -290 16.5192 0.273
NP_442173.1_1 Forward -216 -208 12.0158 0.0316
NP_442173.1_1 Forward -20 -12 5.82095 0.2
NP_442173.1_1 Reverse -209 -217 4.83764 0.241
NP_442173.1_4 Reverse -339 -358 17.699 0.167
NP_442752.1_4 Reverse -208 -215 13.8055 0.0199
NP_442752.1_4 Reverse -12 -19 13.8055 0.0199
NP_443027.1_4 Reverse -10 -20 10.9931 0.109
NP_441812.1_3 Forward -22 -8 6.98109 0.287
NP_442975.1_10 Forward -221 -207 3.04726 0.263
NP_440784.1_7 Reverse -209 -216 6.23397 0.241
NP_440784.1_7 Forward -20 -13 6.23397 0.241
NP_440784.1_7 Forward -216 -209 6.13563 0.241
NP_440784.1_7 Reverse -13 -20 6.13563 0.241
NP_442909.1_7 Forward -222 -208 5.21053 0.296
NP_440110.1_4 Reverse -197 -216 1.86774 0.267
NP_440110.1_8 Reverse -340 -359 0.392778 0.211
NP_439979.1_2 Forward -21 -2 6.58763 0.292
NP_442062.1_8 Reverse -27 -37 5.38824 0.172
NP_442062.1_8 Reverse -53 -63 3.51995 0.267
NP_440304.1_4 Reverse -25 -35 5.78156 0.19
NP_440304.1_4 Reverse -346 -356 4.99491 0.239
NP_442242.1_4 Reverse -13 -20 12.4288 0.0393
NP_442762.1_10 Reverse -337 -356 -9.53865 0.227
NP_441594.1_6 Reverse -351 -370 3.93269 0.224
NP_441594.1_6 Reverse -339 -358 3.44104 0.23
NP_442110.1_7 Reverse -208 -222 12.9793 0.0586
NP_442110.1_7 Reverse -202 -216 0.392915 0.261
NP_441925.1_4 Forward -359 -340 -16.4225 0.282
NP_441925.1_4 Forward -224 -205 -16.9142 0.287
NP_441083.1_5 Forward -217 -207 17.7779 0.00336
NP_441083.1_5 Reverse -208 -218 8.04317 0.046
NP_441083.1_5 Reverse -12 -22 0.963343 0.218
NP_441083.1_5 Forward -21 -11 0.865012 0.218
NP_442827.1_8 Reverse -122 -141 -3.04956 0.296
NP_441738.1_2 Forward -215 -208 15.28 0.0102
NP_441738.1_2 Forward -19 -12 15.28 0.0102
NP_441738.1_5 Reverse -275 -289 20.3541 0.177
NP_441558.1_5 Forward -219 -200 7.27595 0.185
NP_440209.1_1 Reverse -12 -20 14.8674 0.012
NP_440209.1_1 Reverse -208 -216 8.57422 0.0425
NP_440209.1_1 Forward -21 -13 5.62429 0.0821
NP_440209.1_1 Forward -217 -209 5.52596 0.0821
NP_442398.1_3 Forward -288 -269 16.9617 0.298
NP_440178.1_7 Reverse -26 -45 -4.52377 0.0569
NP_441909.1_5 Reverse -39 -58 15.5349 0.262
NP_442570.1_3 Reverse -144 -163 -4.42544 0.23
NP_441598.1_3 Forward -136 -117 12.1891 0.277
NP_442111.1_4 Forward -218 -204 12.0943 0.0451
NP_441163.1_4 Forward -361 -342 16.3089 0.236
NP_440343.1_3 Forward -223 -205 4.54162 0.266
NP_440906.1_5 Forward -20 -13 12.0355 0.0724
NP_440906.1_5 Reverse -13 -20 12.0355 0.0724
NP_440906.1_5 Reverse -390 -397 8.79057 0.149
NP_440906.1_5 Reverse -209 -216 6.23397 0.234
NP_440906.1_5 Forward -216 -209 6.13563 0.241
NP_440747.1_10 Reverse -205 -217 -2.61596 0.0556
NP_440747.1_10 Forward -24 -12 -2.81262 0.0713
NP_440747.1_10 Forward -220 -208 -12.1541 0.227
NP_441130.1_10 Forward -219 -205 14.8476 0.0398
NP_441130.1_10 Forward -353 -339 5.30946 0.236
NP_442973.1_7 Reverse -349 -368 18.9773 0.149
NP_441486.1_1 Forward -65 -51 2.85119 0.074
NP_441486.1_1 Reverse -9 -23 -4.62196 0.204
NP_441486.1_1 Forward -39 -25 -6.19526 0.283
NP_442145.1_4 Forward -310 -291 3.96249 0.283
NP_440403.1_10 Reverse -339 -358 6.39097 0.22
NP_440403.1_10 Reverse -342 -361 2.26107 0.279
NP_441014.1_8 Forward -359 -340 2.3594 0.214
NP_441014.1_8 Forward -224 -205 0.687771 0.218
NP_442848.1_1 Reverse -202 -216 -0.885388 0.263
NP_441012.1_4 Forward -361 -348 8.27909 0.272
NP_443018.1_3 Forward -216 -209 11.7405 0.0655
NP_443018.1_3 Reverse -209 -216 5.44732 0.193
NP_443018.1_3 Forward -20 -13 5.34899 0.212
NP_443018.1_3 Reverse -13 -20 5.34899 0.212
NP_441634.1_8 Reverse -206 -220 5.30946 0.114
NP_441634.1_8 Reverse -340 -354 -3.54032 0.295
NP_441634.1_8 Forward -23 -9 -3.63866 0.295
NP_441634.1_9 Reverse -137 -156 12.0933 0.219
NP_440376.1_1 Reverse -208 -217 5.99792 0.111
NP_440376.1_1 Reverse -12 -21 -0.000272808 0.285
NP_440376.1_1 Forward -21 -12 -0.0986038 0.285
NP_440376.1_1 Forward -217 -208 -0.196935 0.285
NP_442687.1_7 Reverse -11 -21 5.19158 0.217
NP_442485.1_3 Forward -362 -343 0.884433 0.234
NP_442485.1_3 Reverse -337 -356 -2.0655 0.261
NP_442485.1_3 Reverse -1 -20 -5.11376 0.287
NP_441846.1_10 Reverse -341 -360 -4.42544 0.165
NP_441846.1_10 Reverse -343 -362 -22.42 0.259
NP_442958.1_3 Reverse -197 -216 0.491109 0.267
NP_440642.1_10 Reverse -156 -170 10.422 0.172
NP_440642.1_10 Reverse -155 -169 1.37564 0.293
NP_440533.1_9 Forward -21 -2 12.8808 0.0866
NP_440667.1_2 Reverse -351 -370 3.6377 0.189
NP_442658.1_1 Reverse -10 -20 6.0761 0.238
NP_442782.1_2 Reverse -348 -362 6.6861 0.22
NP_441414.1_9 Forward -217 -198 -8.06369 0.229
NP_441414.1_9 Reverse -12 -31 -10.817 0.296
NP_440607.1_4 Reverse -139 -158 2.45773 0.217
NP_440607.1_5 Reverse -345 -364 9.63589 0.127
NP_441487.1_9 Reverse -26 -45 0.392778 0.233
NP_442937.1_5 Reverse -337 -356 6.29264 0.282
NP_442321.1_1 Reverse -340 -359 -8.55534 0.292
NP_441958.1_5 Reverse -207 -217 0.865012 0.12
NP_441958.1_5 Reverse -11 -21 -6.41148 0.28
NP_441127.1_1 Reverse -351 -365 22.0257 0.00677
NP_442836.1_5 Forward -42 -23 4.81767 0.202
NP_440269.1_1 Forward -365 -347 15.4571 0.286
NP_439905.1_1 Forward -216 -203 10.049 0.216
NP_439905.1_2 Forward -356 -342 22.6157 0.0346
NP_439905.1_2 Forward -362 -348 7.86607 0.289
NP_440984.1_7 Reverse -337 -351 5.80112 0.24
NP_440984.1_7 Forward -26 -12 5.70279 0.245
NP_442911.1_2 Forward -46 -27 -5.60541 0.163
NP_442911.1_2 Forward -227 -208 -10.3253 0.276
NP_440153.1_5 Forward -216 -202 11.3077 0.0763
NP_440153.1_8 Forward -363 -350 -1.65234 0.225
NP_440153.1_8 Forward -360 -347 -2.34066 0.235
NP_442064.1_4 Forward -361 -342 6.88182 0.246
NP_443055.1_6 Forward -29 -11 12.2114 0.111
NP_443055.1_6 Forward -225 -207 2.77167 0.203
NP_440993.1_3 Forward -227 -208 0.883656 0.244
NP_441099.1_5 Forward -227 -208 -2.0655 0.117
NP_441099.1_5 Forward -358 -339 -10.6203 0.258
NP_441099.1_5 Forward -31 -12 -11.6036 0.287
NP_441099.1_5 Forward -361 -342 -11.7019 0.288
NP_441099.1_5 Forward -23 -4 -12.1936 0.296
NP_442002.1_9 Reverse -26 -33 11.3472 0.185
NP_442002.1_9 Reverse -11 -18 10.7572 0.185
NP_441294.1_7 Forward -221 -207 12.5142 0.0944
NP_441646.1_1 Reverse -201 -220 -1.27885 0.281
NP_441646.1_1 Reverse -20 -39 -1.86883 0.296
NP_442438.1_10 Reverse -7 -21 3.04785 0.166
NP_441000.1_6 Forward -218 -204 -4.7203 0.251
NP_441110.1_1 Reverse -205 -224 8.25926 0.198
NP_440147.1_4 Reverse -206 -219 7.00078 0.0778
NP_440147.1_4 Reverse -25 -38 0.904263 0.244
NP_441550.1_8 Reverse -206 -216 13.8442 0.0207
NP_441550.1_8 Forward -219 -209 12.1726 0.0361
NP_441916.1_7 Reverse -53 -63 4.10993 0.19
NP_440206.1_4 Forward -361 -342 2.35861 0.289
NP_440206.1_4 Forward -355 -336 -1.96793 0.293
NP_440465.1_10 Reverse -339 -358 -1.27885 0.291
NP_441041.1_4 Reverse -336 -355 -2.95047 0.118
NP_441041.1_4 Reverse -342 -361 -7.96535 0.194
NP_441041.1_7 Reverse -24 -36 6.44582 0.21
NP_440569.1_10 Reverse -159 -178 2.43462 0.293
NP_442004.1_6 Forward -21 -7 3.73617 0.232
NP_441725.1_5 Forward -20 -10 1.55333 0.133
NP_441725.1_5 Forward -35 -25 0.668351 0.156
NP_441725.1_5 Forward -397 -387 -0.41329 0.251
NP_441725.1_5 Forward -356 -346 -0.511621 0.26
NP_439966.1_7 Forward -219 -209 14.5325 0.0203
NP_439966.1_7 Reverse -10 -20 8.63269 0.132
NP_439966.1_7 Forward -23 -13 7.0594 0.157
NP_439966.1_7 Reverse -206 -216 5.58445 0.216
NP_439966.1_9 Reverse -10 -19 0.983037 0.253
NP_442941.1_3 Forward -216 -206 9.41981 0.0319
NP_442941.1_3 Forward -20 -10 1.74999 0.147
NP_442941.1_3 Reverse -13 -23 -0.0199663 0.244
NP_440289.1_2 Forward -220 -207 1.39592 0.128
NP_440289.1_2 Reverse -9 -22 0.805932 0.148
NP_440289.1_2 Reverse -386 -399 -0.964025 0.218
NP_442281.1_1 Forward -34 -20 10.2254 0.0608
NP_442281.1_1 Forward -222 -208 4.8172 0.18
NP_442847.1_3 Forward -356 -337 3.44025 0.299
NP_442256.1_2 Forward -219 -201 8.67227 0.0965
NP_442256.1_2 Reverse -4 -22 -2.73412 0.214
NP_442256.1_2 Forward -23 -5 -6.07737 0.214
NP_440723.1_4 Forward -220 -201 -10.7186 0.284
NP_440723.1_8 Reverse -347 -361 13.6676 0.178
NP_440498.1_1 Reverse -3 -21 -3.02911 0.255
NP_441644.1_6 Forward -217 -207 14.4342 0.0126
NP_441644.1_6 Reverse -12 -22 9.321 0.0799
NP_441644.1_6 Reverse -208 -218 4.01116 0.253
NP_443049.1_6 Reverse -207 -217 14.4711 0.114
NP_440867.1_10 Forward -360 -341 7.27595 0.251
NP_442215.1_2 Forward -38 -22 -0.728113 0.171
NP_442215.1_2 Forward -314 -298 -5.34967 0.249
NP_442029.1_1 Reverse -340 -359 -19.2734 0.288
NP_442029.1_6 Reverse -342 -361 5.99764 0.246
NP_440253.1_2 Reverse -12 -30 6.90232 0.0752
NP_440253.1_2 Reverse -208 -226 5.62401 0.0906
NP_440929.1_8 Forward -217 -208 7.07956 0.0713
NP_442933.1_2 Forward -199 -181 9.74216 0.257
NP_442933.1_2 Forward -201 -183 5.63601 0.291
NP_442933.1_10 Reverse -53 -62 5.50626 0.181
NP_442933.1_10 Reverse -12 -21 5.40793 0.19
NP_441751.2_8 Forward -35 -21 -4.22864 0.166
NP_442926.1_1 Reverse -336 -355 -6.58872 0.297
NP_442926.1_3 Reverse -337 -356 13.2741 0.108
NP_442926.1_5 Reverse -48 -67 12.3088 0.19
NP_442554.1_8 Reverse -21 -31 9.22315 0.0617
NP_442554.1_8 Forward -350 -340 6.37155 0.12
NP_442554.1_8 Forward -216 -206 6.37155 0.12
NP_442554.1_8 Reverse -209 -219 6.17489 0.125
NP_442554.1_8 Forward -20 -10 4.10993 0.198
NP_441762.1_7 Reverse -207 -219 -4.9759 0.185
NP_441762.1_7 Reverse -11 -23 -5.36923 0.203
NP_442142.1_4 Forward -24 -11 9.75346 0.0873
NP_442142.1_4 Forward -354 -341 6.80355 0.154
NP_442142.1_4 Forward -220 -207 6.31189 0.169
NP_442292.1_1 Forward -216 -207 8.65285 0.0335
NP_442292.1_1 Reverse -209 -218 -0.0986038 0.239
NP_442292.1_1 Forward -20 -11 -0.0986038 0.239
NP_442292.1_1 Reverse -13 -22 -0.196935 0.239
NP_442476.1_6 Forward -216 -202 0.982901 0.233
NP_442381.1_8 Reverse -9 -28 -12.8819 0.267
NP_441711.1_4 Forward -226 -207 10.5209 0.125
NP_443009.1_5 Forward -22 -11 5.66304 0.193
NP_443009.1_5 Reverse -26 -37 5.07306 0.218
NP_443009.1_5 Reverse -52 -63 3.99143 0.268
NP_442301.1_2 Forward -358 -339 12.4867 0.159
NP_441715.1_4 Forward -216 -206 7.55152 0.108
NP_441715.1_4 Forward -20 -10 6.56821 0.138
NP_441448.1_1 Reverse -334 -353 7.17762 0.236
NP_440183.1_9 Forward -358 -339 -21.1417 0.296
NP_441198.1_1 Reverse -328 -347 4.62101 0.217
NP_440379.1_5 Forward -360 -341 8.75091 0.133
NP_440379.1_5 Reverse -339 -358 -8.65367 0.253
NP_440464.1_10 Forward -104 -94 12.0532 0.262
NP_441468.1_1 Reverse -209 -216 6.13563 0.209
NP_441468.1_1 Forward -20 -13 6.13563 0.209
NP_441468.1_1 Reverse -13 -20 6.0373 0.223
NP_441468.1_1 Forward -216 -209 6.0373 0.223
NP_441618.1_10 Reverse -331 -350 9.43923 0.294
NP_441015.1_10 Reverse -337 -356 9.93088 0.0713
NP_441015.1_10 Reverse -203 -222 -3.04881 0.184
NP_441015.1_10 Reverse -342 -361 -5.80207 0.232
NP_441015.1_10 Reverse -343 -362 -8.45701 0.273
NP_441015.1_10 Reverse -7 -26 -11.1119 0.291
NP_441673.1_1 Reverse -208 -217 1.37636 0.114
NP_441673.1_1 Forward -21 -12 1.27803 0.155
NP_441673.1_1 Reverse -12 -21 1.27803 0.155
NP_441673.1_1 Forward -217 -208 1.1797 0.163
NP_441731.1_9 Reverse -338 -355 13.8052 0.223
NP_442253.1_5 Forward -170 -153 -2.61609 0.282
NP_441826.1_2 Forward -223 -209 4.52282 0.102
NP_441826.1_2 Reverse -202 -216 3.24451 0.113
NP_441826.1_2 Reverse -21 -35 -0.885388 0.228
NP_442868.1_6 Reverse -206 -216 9.51814 0.0447
NP_442868.1_6 Forward -23 -13 9.22315 0.0527
NP_442868.1_6 Forward -219 -209 7.35486 0.0808
NP_442227.1_2 Forward -358 -339 6.39097 0.198
NP_442227.1_2 Forward -361 -342 5.60432 0.202
NP_443058.1_9 Forward -362 -344 16.6371 0.137
NP_442808.1_1 Forward -218 -208 9.616 0.0481
NP_442808.1_1 Forward -22 -12 7.74772 0.0697
NP_442542.1_2 Forward -219 -206 4.54251 0.3
NP_442542.1_9 Reverse -5 -19 8.06211 0.173
NP_442113.1_10 Forward -364 -345 9.53756 0.119
NP_442050.1_5 Forward -219 -209 12.4676 0.0617
NP_440038.1_4 Forward -364 -345 0.982764 0.275
NP_442739.1_2 Forward -116 -97 14.6903 0.246
NP_440342.1_1 Reverse -344 -363 14.8474 0.19
NP_440342.1_2 Reverse -351 -370 11.7992 0.214
NP_441114.1_3 Forward -34 -25 7.37455 0.239
NP_440558.1_2 Forward -39 -20 8.75091 0.108
NP_440558.1_2 Forward -354 -335 -7.17871 0.289
NP_440111.2_2 Reverse -197 -216 -2.0655 0.247
NP_442789.1_4 Forward -141 -122 -3.3438 0.25
NP_441518.1_3 Forward -373 -354 -15.3402 0.291
NP_441878.1_6 Forward -352 -342 -0.118297 0.167
NP_441878.1_6 Reverse -347 -357 -6.90313 0.198
NP_441878.1_6 Reverse -26 -36 -6.90313 0.198
NP_441100.1_3 Reverse -263 -282 18.0953 0.0911
NP_441036.1_6 Forward -354 -336 16.1454 0.185
NP_441036.1_6 Reverse -350 -368 7.88563 0.295
NP_442721.1_4 Forward -153 -134 15.7324 0.291
NP_441557.1_5 Reverse -208 -217 1.08137 0.0794
NP_441557.1_5 Reverse -12 -21 0.983037 0.0911
NP_441557.1_5 Forward -21 -12 0.688044 0.128
NP_441557.1_5 Forward -217 -208 0.589713 0.134
NP_441557.1_8 Forward -360 -350 12.4676 0.236
NP_441445.1_1 Reverse -3 -22 6.58763 0.146
NP_441445.1_1 Reverse -339 -358 -0.590531 0.297
NP_441433.1_8 Reverse -377 -396 -1.86883 0.263
NP_442579.1_9 Forward -362 -343 -0.787193 0.281
NP_442419.1_2 Forward -26 -7 2.26107 0.238
NP_442419.1_2 Reverse -337 -356 1.76941 0.238
NP_442419.1_2 Forward -356 -337 0.687771 0.24
NP_442419.1_2 Forward -362 -343 -3.83545 0.271
NP_442241.1_9 Reverse -255 -274 6.78429 0.286
NP_440101.1_5 Reverse -5 -24 1.17943 0.26
NP_442183.1_1 Reverse -208 -222 4.42448 0.261
NP_441407.1_5 Forward -31 -12 7.86593 0.173
NP_442397.1_9 Forward -42 -23 11.4058 0.244
NP_440276.1_8 Reverse -138 -157 8.06259 0.27
NP_442347.1_2 Forward -216 -207 10.3245 0.058
NP_441037.1_4 Reverse -10 -20 5.95329 0.289
NP_440151.1_5 Reverse -352 -371 9.63589 0.201
NP_441633.1_3 Reverse -128 -141 -4.30728 0.191
NP_441633.1_3 Forward -38 -25 -5.48725 0.236
NP_441633.1_3 Reverse -206 -219 -6.2739 0.242
NP_441633.1_3 Forward -23 -10 -6.47056 0.253
NP_440136.1_2 Forward -20 -13 6.23397 0.171
NP_440136.1_2 Reverse -209 -216 6.23397 0.171
NP_440136.1_2 Forward -216 -209 6.13563 0.193
NP_440136.1_2 Reverse -13 -20 6.13563 0.193
NP_440136.1_2 Reverse -390 -397 4.26735 0.218
NP_442590.1_9 Forward -361 -342 17.109 0.188
NP_442590.1_10 Reverse -134 -153 8.16093 0.213
NP_442590.1_10 Reverse -202 -221 4.71934 0.272
NP_442998.1_5 Reverse -279 -289 13.7464 0.157
NP_442998.1_5 Reverse -278 -288 13.1564 0.158
NP_442998.1_10 Forward -215 -208 15.5754 0.0102
NP_442998.1_10 Forward -19 -12 15.5754 0.0102
NP_440731.1_2 Reverse -342 -361 2.94938 0.297
NP_440299.1_1 Forward -349 -336 3.26365 0.251
NP_441007.1_10 Reverse -7 -20 1.39592 0.203
NP_441007.1_10 Forward -222 -209 -0.964025 0.296
NP_440256.1_1 Reverse -205 -224 -8.94866 0.27
NP_440087.1_1 Reverse -3 -22 -5.31042 0.249
NP_441559.1_8 Forward -16 -2 -2.55701 0.192
NP_440915.1_5 Reverse -206 -225 14.9085 0.283
NP_440915.1_6 Reverse -204 -218 1.27789 0.142
NP_440748.1_1 Forward -242 -223 23.5989 0.0384
NP_440748.1_5 Forward -33 -14 -2.65548 0.281
NP_441939.1_3 Forward -216 -197 7.27595 0.206
NP_441494.1_6 Reverse -355 -368 8.9674 0.227
NP_442993.1_1 Forward -21 -5 -11.3479 0.244
NP_442386.1_9 Forward -218 -209 11.9957 0.0754
NP_442386.1_9 Forward -22 -13 6.19416 0.23
NP_442386.1_9 Reverse -11 -20 5.89917 0.233
NP_442386.1_9 Forward -352 -343 4.62087 0.294
NP_440570.1_5 Reverse -332 -351 -3.44213 0.289
NP_441750.1_4 Reverse -204 -223 0.58944 0.297
NP_441750.1_7 Reverse -351 -361 13.8447 0.254
NP_441340.1_5 Reverse -209 -216 13.5105 0.0314
NP_441340.1_5 Reverse -13 -20 6.13563 0.175
NP_441340.1_5 Forward -20 -13 5.93897 0.198
NP_441340.1_5 Forward -216 -209 5.84064 0.208
NP_442484.1_2 Forward -356 -337 4.71934 0.184
NP_442484.1_2 Forward -222 -203 -1.37718 0.288
NP_440168.1_8 Forward -357 -338 9.43923 0.179
NP_442240.1_2 Forward -216 -197 -2.85214 0.0731
NP_442240.1_2 Reverse -131 -150 -18.0934 0.279
NP_440586.1_8 Reverse -13 -20 11.4451 0.0645
NP_440586.1_8 Forward -216 -209 9.47853 0.146
NP_440586.1_8 Reverse -209 -216 5.74197 0.283
NP_440586.1_9 Reverse -353 -372 9.14423 0.263
NP_442251.1_6 Forward -20 -13 12.0355 0.0627
NP_440192.1_5 Reverse -341 -360 4.03102 0.268
NP_441262.1_3 Reverse -208 -215 14.7888 0.0223
NP_441262.1_3 Reverse -12 -19 14.7888 0.0223
NP_440027.1_3 Forward -361 -343 3.06666 0.28
NP_440027.1_8 Forward -360 -341 6.09517 0.277
NP_443051.1_1 Reverse -207 -216 7.47288 0.0571
NP_443051.1_1 Reverse -11 -20 0.786375 0.125
NP_439996.1_6 Reverse -341 -360 9.6625 0.233
NP_439937.1_8 Reverse -340 -359 -2.45882 0.259
NP_439937.1_8 Reverse -1 -20 -2.85214 0.262
NP_441657.1_6 Forward -279 -260 12.1925 0.241
NP_441740.2_8 Forward -35 -21 17.7975 0.24
NP_440408.1_10 Reverse -348 -367 5.70265 0.25
NP_442239.1_8 Reverse -342 -361 7.86593 0.255
NP_440372.1_2 Reverse -209 -216 13.8055 0.0214
NP_440372.1_2 Reverse -13 -20 6.72562 0.0929
NP_440372.1_2 Forward -20 -13 6.62729 0.151
NP_440372.1_2 Forward -216 -209 6.52896 0.188
NP_442783.1_10 Forward -221 -211 16.6958 0.149
NP_440819.1_5 Reverse -278 -286 7.68924 0.266
NP_440316.1_10 Reverse -347 -357 6.76487 0.253
NP_439977.1_5 Forward -363 -344 7.17762 0.123
NP_439977.1_5 Forward -357 -338 -3.14714 0.296
NP_442384.1_10 Forward -217 -204 10.344 0.0461
NP_442384.1_10 Forward -21 -8 3.06754 0.203
NP_442114.1_4 Forward -21 -10 8.12181 0.217
NP_442572.1_10 Forward -363 -344 17.34 0.248
NP_442262.1_10 Forward -216 -209 13.2155 0.0213
NP_440163.1_10 Reverse -345 -355 7.84651 0.299
NP_440344.1_10 Forward -224 -207 -0.747806 0.0454
NP_440344.1_10 Forward -358 -341 -11.4659 0.215
NP_440282.1_10 Forward -140 -121 -4.13045 0.25
NP_440487.1_1 Forward -142 -123 -5.01543 0.214
NP_441965.1_10 Forward -24 -8 4.48343 0.238
NP_442693.1_7 Reverse -340 -359 7.07928 0.295
NP_440297.1_9 Forward -356 -346 0.471689 0.282
NP_440297.1_9 Forward -20 -10 -0.41329 0.283
NP_440350.1_5 Reverse -177 -196 -4.91709 0.288
NP_442187.1_3 Reverse -207 -217 15.6147 0.105
NP_442280.1_10 Reverse -137 -155 10.6166 0.223
NP_442280.1_10 Forward -355 -337 4.87002 0.292
NP_441103.1_9 Reverse -155 -165 12.6848 0.29
NP_443036.1_8 Reverse -343 -362 18.289 0.202
NP_440999.1_9 Forward -361 -347 6.29277 0.0991
NP_440999.1_9 Forward -221 -207 4.03116 0.119
NP_440999.1_9 Forward -355 -341 1.17956 0.169
NP_440999.1_9 Forward -16 -2 -2.65535 0.273
NP_440888.1_2 Forward -217 -203 15.8302 0.00862
NP_440600.1_4 Forward -29 -11 -5.48739 0.28
NP_440491.1_1 Reverse -205 -224 17.15 0.0567
NP_442033.1_10 Forward -219 -200 -12.5869 0.273
NP_442033.1_10 Forward -353 -334 -13.0786 0.281
NP_441123.1_4 Forward -217 -203 20.1568 0.0308
NP_441543.1_2 Forward -20 -11 8.75118 0.0968
NP_441543.1_2 Forward -216 -207 7.07956 0.131
NP_441543.1_2 Reverse -377 -386 4.52295 0.234
NP_441469.1_8 Reverse -11 -20 6.29291 0.227
NP_442578.1_5 Reverse -257 -276 0.294447 0.278
NP_442578.1_7 Reverse -209 -216 6.0373 0.18
NP_442578.1_7 Reverse -13 -20 5.93897 0.183
NP_442578.1_7 Forward -61 -54 5.25066 0.251
NP_440071.1_1 Reverse -334 -351 8.00291 0.295
NP_441462.1_2 Reverse -208 -218 7.55152 0.0543
NP_441462.1_2 Reverse -12 -22 -0.118297 0.184
NP_441621.1_7 Reverse -340 -354 -2.16369 0.188
NP_441621.1_7 Forward -365 -351 -5.31028 0.25
NP_441621.1_7 Forward -362 -348 -6.29359 0.283
NP_441601.1_4 Forward -355 -336 -0.39387 0.275
NP_441601.1_4 Forward -361 -342 -3.44213 0.293
NP_442204.1_1 Reverse -204 -215 9.79344 0.0736
NP_442204.1_5 Reverse -2 -21 6.09597 0.147
NP_440504.1_7 Reverse -21 -40 -4.91709 0.297
NP_442780.1_3 Reverse -292 -311 5.96782 0.276
NP_442537.1_3 Forward -351 -332 21.8289 0.153
NP_440516.1_8 Reverse -208 -217 18.9776 0.00442
NP_440516.1_8 Reverse -12 -21 17.6993 0.00442
NP_440516.1_8 Forward -217 -208 5.01461 0.118
NP_442428.1_5 Reverse -209 -216 6.13563 0.209
NP_442428.1_5 Forward -20 -13 6.13563 0.209
NP_442428.1_5 Forward -216 -209 6.0373 0.212
NP_442428.1_5 Reverse -13 -20 6.0373 0.212
NP_440783.1_5 Reverse -342 -361 -1.67217 0.251
NP_440673.1_3 Forward -215 -208 12.4288 0.0426
NP_440673.1_3 Forward -19 -12 12.4288 0.0426
NP_440865.1_9 Reverse -342 -361 1.57275 0.118
NP_441052.1_2 Forward -217 -207 10.6981 0.0285
NP_441052.1_2 Forward -351 -341 4.79825 0.145
NP_441052.1_2 Forward -21 -11 1.35667 0.248
NP_441052.1_2 Reverse -208 -218 0.668351 0.256
NP_441052.1_2 Reverse -12 -22 0.57002 0.256
NP_442219.1_8 Reverse -8 -27 9.23007 0.234
NP_442219.1_9 Reverse -209 -218 8.65285 0.0681
NP_442219.1_9 Reverse -13 -22 8.55452 0.0681
NP_442219.1_9 Forward -216 -207 7.96454 0.0696
NP_440436.1_4 Forward -20 -11 14.9456 0.0103
NP_440436.1_4 Forward -216 -207 7.57079 0.124
NP_440436.1_4 Reverse -13 -22 4.81753 0.239
NP_441884.1_9 Reverse -205 -224 -11.8986 0.133
NP_441884.1_9 Forward -142 -123 -20.65 0.199
NP_441884.1_9 Reverse -9 -28 -21.535 0.25
NP_441884.1_9 Forward -220 -201 -23.1083 0.284
NP_442864.1_7 Reverse -353 -371 6.01734 0.274
NP_442414.1_9 Forward -357 -338 10.1275 0.292
NP_441719.1_4 Reverse -209 -216 6.82395 0.0855
NP_441719.1_4 Reverse -13 -20 6.72562 0.093
NP_441719.1_4 Forward -20 -13 6.62729 0.151
NP_441719.1_4 Forward -216 -209 6.52896 0.188
NP_441004.1_1 Reverse -342 -361 2.65439 0.106
NP_441004.1_1 Reverse -339 -358 -12.5869 0.247
NP_441004.1_1 Reverse -336 -355 -15.9302 0.279
NP_441004.1_1 Reverse -354 -373 -16.8151 0.287
NP_441004.1_2 Reverse -349 -368 2.26107 0.215
NP_442813.1_4 Forward -284 -265 -8.55534 0.299
NP_442366.1_3 Reverse -19 -37 -2.14413 0.221
NP_442873.1_3 Forward -358 -339 4.42355 0.265
NP_442873.1_9 Forward -227 -208 5.70185 0.259
NP_440094.1_6 Reverse -1 -20 7.47261 0.272
NP_441851.1_9 Reverse -339 -358 7.66927 0.279
NP_441851.1_10 Reverse -26 -36 5.87989 0.196
NP_442208.1_5 Reverse -345 -364 -10.522 0.299
NP_441545.1_2 Reverse -38 -57 3.93269 0.188
NP_442856.1_7 Reverse -3 -22 -3.44213 0.243
NP_442515.1_1 Reverse -26 -40 5.50613 0.107
NP_441683.1_7 Reverse -214 -233 -12.8819 0.3
NP_440593.1_3 Forward -222 -203 5.30933 0.124
NP_440593.1_3 Forward -368 -349 -2.55715 0.227
NP_440593.1_3 Reverse -337 -356 -2.85214 0.228
NP_440463.1_8 Forward -358 -339 10.8883 0.203
NP_440463.1_8 Forward -361 -342 9.14571 0.247
NP_442689.1_8 Reverse -173 -190 -8.71262 0.296
NP_441409.1_6 Reverse -130 -149 -15.5368 0.297
NP_442314.1_1 Reverse -340 -358 -4.8974 0.272
NP_440432.1_9 Reverse -13 -28 -3.06836 0.179
NP_439960.1_10 Reverse -341 -359 -1.94747 0.246
NP_440474.1_8 Forward -20 -6 4.32555 0.284
NP_440726.1_2 Forward -358 -339 -0.885524 0.296
NP_442168.1_5 Forward -367 -348 1.37609 0.241
NP_440588.1_5 Forward -152 -138 16.1563 0.208
NP_442335.1_3 Reverse -14 -33 3.93269 0.296
NP_442006.1_2 Reverse -342 -359 4.46374 0.0741
NP_441003.1_9 Forward -360 -341 15.2408 0.207
NP_441003.1_9 Forward -21 -2 4.22769 0.285
NP_441003.1_9 Reverse -106 -125 3.24438 0.295
NP_442243.1_1 Reverse -202 -220 3.8533 0.2
NP_441570.1_1 Reverse -208 -226 -9.91228 0.153
NP_441570.1_1 Reverse -12 -30 -17.5821 0.283
NP_441078.1_4 Reverse -208 -217 0.196389 0.205
NP_441078.1_4 Reverse -12 -21 0.0980582 0.205
NP_441078.1_4 Forward -21 -12 0.0980582 0.205
NP_441078.1_4 Forward -217 -208 -0.000272808 0.205
NP_442729.1_6 Reverse -343 -361 23.6849 0.0247
NP_440526.1_3 Reverse -209 -220 1.53316 0.267
NP_441432.1_8 Reverse -207 -216 14.0611 0.0258
NP_442320.1_8 Forward -223 -209 -5.21195 0.209
NP_442320.1_8 Forward -68 -54 -5.60527 0.236
NP_441732.1_2 Reverse -204 -220 -16.3627 0.165
NP_440497.1_2 Reverse -337 -356 7.17762 0.242
NP_440760.1_1 Reverse -130 -149 -14.6519 0.134
NP_440760.1_1 Forward -62 -43 -23.305 0.293
NP_442797.1_1 Forward -361 -342 -2.55715 0.257
NP_442797.1_6 Forward -361 -342 7.64329 0.281
NP_442797.1_7 Forward -352 -334 0.412472 0.274
NP_440199.1_10 Reverse -9 -19 13.2547 0.108
NP_440578.1_8 Forward -276 -257 12.0942 0.246
NP_441057.1_4 Reverse -341 -359 -3.52077 0.29
NP_440913.1_1 Reverse -206 -224 15.3588 0.103
NP_442751.1_2 Forward -22 -3 4.03023 0.262
NP_442489.1_7 Forward -21 -12 0.786375 0.152
NP_442489.1_7 Forward -217 -208 0.688044 0.152
NP_442489.1_7 Reverse -208 -217 0.688044 0.152
NP_442489.1_7 Reverse -12 -21 0.589713 0.17
NP_442489.1_7 Reverse -27 -36 -1.86856 0.259
NP_442489.1_7 Forward -36 -27 -1.96689 0.28
NP_440559.1_1 Forward -216 -207 7.76787 0.0918
NP_440559.1_1 Reverse -209 -218 6.48957 0.134
NP_440559.1_1 Forward -20 -11 5.50626 0.14
NP_440559.1_1 Forward -61 -52 4.52295 0.26
NP_440559.1_1 Forward -35 -26 4.22796 0.292
NP_441659.2_8 Forward -217 -207 5.48657 0.106
NP_441659.2_8 Reverse -12 -22 5.28991 0.112
NP_441659.2_8 Forward -29 -19 0.963343 0.254
NP_442913.1_10 Forward -45 -26 -1.7705 0.176
NP_442913.1_10 Reverse -199 -218 -1.86883 0.178
NP_442913.1_10 Forward -226 -207 -5.50708 0.268
NP_441040.1_2 Reverse -200 -219 -13.7669 0.284
NP_442008.1_2 Reverse -344 -363 9.3409 0.181
NP_440335.1_9 Forward -191 -173 11.8189 0.273
NP_442346.1_5 Reverse -26 -36 4.79825 0.272
NP_442346.1_5 Forward -386 -376 4.69992 0.276
NP_442346.1_10 Forward -38 -19 -1.96717 0.294
NP_440352.1_5 Reverse -268 -287 12.5584 0.229
NP_440545.1_3 Reverse -338 -355 0.825489 0.131
NP_440545.1_3 Forward -367 -350 -1.92778 0.177
NP_440545.1_3 Forward -143 -126 -6.54933 0.283
NP_440831.1_3 Forward -362 -343 10.2702 0.179
NP_440831.1_3 Reverse -339 -358 7.06668 0.265
NP_440831.1_3 Reverse -3 -22 5.51345 0.28
NP_441629.1_3 Reverse -256 -275 -3.83621 0.288
NP_441629.1_3 Forward -28 -9 -4.22953 0.29
NP_440486.1_6 Reverse -346 -365 16.4207 0.207
NP_440459.1_2 Forward -219 -202 9.18362 0.233
NP_440010.1_4 Forward -25 -6 8.16011 0.185
NP_440010.1_4 Reverse -338 -357 4.52188 0.22
NP_440010.1_4 Forward -361 -342 -2.95123 0.293
NP_440847.1_3 Forward -28 -14 10.8154 0.282
NP_442603.1_7 Forward -217 -203 16.7152 0.0291
NP_442603.1_7 Reverse -208 -222 13.9619 0.0758
NP_442603.1_7 Forward -398 -384 5.89884 0.269
NP_442603.1_9 Forward -358 -340 5.23069 0.293
NP_441233.1_9 Forward -248 -229 11.8975 0.283
NP_441833.1_4 Forward -20 -13 14.1004 0.0258
NP_441833.1_4 Forward -216 -209 6.52896 0.0924
NP_441833.1_4 Reverse -209 -216 6.23397 0.163
NP_441833.1_4 Reverse -13 -20 6.13563 0.198
NP_441329.1_6 Forward -191 -172 -0.716613 0.281
NP_442162.1_9 Forward -216 -209 12.9205 0.0282
NP_442162.1_9 Reverse -209 -216 12.9205 0.0282
NP_442162.1_9 Forward -20 -13 6.62729 0.142
NP_442162.1_9 Reverse -13 -20 6.52896 0.178
NP_440671.1_4 Reverse -342 -356 14.8476 0.0546
NP_441044.1_4 Forward -371 -353 7.09898 0.223
NP_442140.1_3 Reverse -13 -23 10.5998 0.0902
NP_442140.1_3 Forward -216 -206 8.23984 0.122
NP_442140.1_3 Reverse -209 -219 6.07655 0.184
NP_442140.1_3 Reverse -343 -353 4.99491 0.232
NP_441813.1_5 Forward -23 -13 8.63316 0.0367
NP_441813.1_5 Reverse -206 -216 8.4365 0.0432
NP_441813.1_5 Reverse -10 -20 7.35486 0.0762
NP_441813.1_5 Forward -219 -209 5.5849 0.118
NP_441490.1_2 Forward -230 -218 22.3595 0.174
NP_442089.1_6 Forward -344 -325 4.12936 0.262
NP_440590.1_4 Forward -216 -203 11.7207 0.0187
NP_440590.1_4 Reverse -209 -222 10.934 0.0235
NP_440590.1_4 Forward -20 -7 0.805932 0.143
NP_440567.1_1 Reverse -209 -223 7.66941 0.067
NP_440567.1_1 Forward -20 -6 6.98109 0.0795
NP_442497.1_10 Forward -20 -11 0.688044 0.141
NP_442497.1_10 Forward -216 -207 0.589713 0.153
NP_442497.1_10 Forward -35 -26 0.29472 0.199
NP_440821.1_4 Reverse -10 -20 9.22315 0.0334
NP_440821.1_4 Forward -219 -209 5.78156 0.106
NP_440821.1_4 Reverse -387 -397 4.60159 0.127
NP_440821.1_4 Reverse -206 -216 -0.314959 0.251
NP_441239.1_9 Forward -353 -341 14.887 0.0247
NP_441239.1_9 Forward -219 -207 5.54551 0.217
NP_441951.1_9 Forward -359 -340 20.4523 0.0402
NP_442568.1_5 Forward -192 -173 13.7658 0.177
NP_441892.1_1 Forward -360 -343 -0.354483 0.182
NP_441892.1_1 Forward -148 -131 -5.95935 0.294
NP_442193.1_1 Forward -345 -327 8.67227 0.264
NP_442193.1_1 Reverse -342 -360 7.19731 0.295
NP_442193.1_8 Forward -220 -201 9.53674 0.292
NP_441017.1_8 Forward -39 -24 9.02635 0.233
NP_440833.1_6 Forward -38 -24 8.3571 0.277
NP_440354.1_7 Reverse -6 -24 9.65558 0.224
NP_442052.1_7 Reverse -338 -352 15.4376 0.198
NP_442052.1_8 Reverse -25 -35 13.353 0.253
NP_440546.1_4 Reverse -208 -218 12.1791 0.0679
NP_440546.1_4 Reverse -12 -22 9.17338 0.151
NP_442041.1_5 Forward -362 -343 6.58763 0.213
NP_441230.1_5 Forward -362 -343 7.27595 0.166
NP_441230.1_5 Forward -26 -7 2.3594 0.215
NP_440462.1_6 Forward -219 -209 6.37155 0.118
NP_440462.1_6 Reverse -10 -20 5.78156 0.138
NP_440462.1_6 Forward -64 -54 1.65166 0.294
NP_442340.1_3 Forward -358 -339 -6.88371 0.227
NP_440868.1_4 Reverse -8 -20 10.6587 0.0364
NP_440868.1_4 Reverse -204 -216 8.00379 0.0602
NP_440868.1_4 Forward -25 -13 -0.256015 0.255
NP_442402.1_2 Forward -290 -276 15.4369 0.263
NP_442402.1_4 Forward -295 -276 -7.27777 0.272
NP_441848.1_4 Forward -200 -184 7.07321 0.297
NP_442358.1_1 Forward -29 -11 13.4905 0.28
NP_442039.1_4 Reverse -209 -216 11.6422 0.0747
NP_442679.1_1 Forward -209 -190 -4.91709 0.286
NP_442409.1_5 Reverse -341 -360 17.0107 0.216
NP_442837.1_3 Reverse -54 -61 9.18389 0.144
NP_442837.1_3 Forward -20 -13 6.13563 0.25
NP_442837.1_3 Forward -216 -209 6.0373 0.25
NP_442837.1_3 Reverse -209 -216 6.0373 0.25
NP_442837.1_3 Reverse -13 -20 5.93897 0.265
NP_440160.1_2 Reverse -329 -348 -4.91709 0.269
NP_440160.1_2 Reverse -341 -360 -9.34199 0.293
NP_442053.1_1 Forward -217 -208 14.4544 0.0114
NP_442053.1_1 Reverse -208 -217 7.86621 0.0863
NP_442053.1_1 Reverse -12 -21 7.76787 0.0895
NP_442053.1_1 Forward -21 -12 7.17789 0.104
NP_440505.1_3 Reverse -206 -216 16.7946 0.00614
NP_440505.1_3 Reverse -10 -20 12.5664 0.0482
NP_441959.1_9 Reverse -345 -364 20.059 0.0584
NP_441536.1_7 Forward -224 -205 16.7149 0.188
NP_440914.1_1 Forward -217 -207 13.1043 0.0386
NP_440914.1_1 Reverse -208 -218 12.1284 0.0654
NP_440914.1_1 Reverse -12 -22 6.56569 0.273
NP_441011.1_8 Forward -20 -11 7.17789 0.179
NP_441011.1_8 Forward -384 -375 6.5879 0.186
NP_441011.1_8 Forward -397 -388 6.48957 0.191
NP_442533.1_1 Reverse -205 -224 -14.3569 0.242
NP_442533.1_1 Reverse -336 -355 -16.0285 0.262
NP_442533.1_6 Reverse -342 -351 4.52295 0.179
NP_442533.1_6 Forward -217 -208 4.42462 0.179
NP_442533.1_6 Reverse -354 -363 1.57302 0.294
NP_442541.1_10 Forward -351 -337 11.4053 0.182
NP_442541.1_10 Forward -225 -211 6.0955 0.248
NP_442232.1_3 Reverse -340 -359 -14.8485 0.288
NP_442322.1_4 Forward -359 -342 9.18288 0.141
NP_442322.1_4 Forward -363 -346 -3.40342 0.247
NP_442229.1_1 Forward -38 -24 7.27547 0.196
NP_441482.1_7 Forward -145 -131 -9.04686 0.193
NP_441482.1_7 Reverse -342 -356 -9.14519 0.194
NP_441482.1_7 Reverse -202 -216 -10.2268 0.209
NP_441482.1_7 Reverse -47 -61 -10.9151 0.222
NP_441028.1_6 Forward -285 -275 5.48612 0.255
NP_441028.1_6 Forward -286 -276 5.38779 0.255
NP_442202.1_4 Forward -23 -9 13.611 0.252
NP_441527.1_4 Forward -200 -181 5.0129 0.109
NP_441527.1_4 Forward -191 -172 1.38421 0.134
NP_441527.1_4 Forward -194 -175 0.811258 0.134
NP_441527.1_4 Forward -201 -182 -8.06949 0.24
NP_440115.1_6 Reverse -205 -215 15.0247 0.0505
NP_440115.1_6 Forward -142 -132 6.8632 0.167
NP_440007.1_9 Reverse -204 -218 5.21113 0.263
NP_441602.1_3 Reverse -203 -222 0.884433 0.217
NP_441106.1_1 Reverse -11 -20 8.35786 0.0585
NP_441106.1_1 Reverse -353 -362 2.85133 0.255
NP_441420.1_1 Reverse -207 -226 -3.3438 0.291
NP_441286.1_1 Reverse -207 -219 11.2487 0.013
NP_441286.1_1 Reverse -11 -23 -0.157684 0.126
NP_441286.1_1 Forward -22 -10 -4.48425 0.161
NP_441286.1_1 Forward -37 -25 -5.36923 0.197
NP_441286.1_1 Forward -399 -387 -5.95921 0.235
NP_441286.1_1 Forward -218 -206 -6.15587 0.251
NP_442674.1_3 Forward -359 -340 5.40686 0.269
NP_440670.1_8 Reverse -208 -217 8.75118 0.0606
NP_440670.1_8 Forward -21 -12 6.8829 0.0907
NP_440670.1_8 Forward -217 -208 6.19458 0.124
NP_440670.1_8 Reverse -27 -36 3.34298 0.275
NP_440886.1_7 Reverse -11 -21 12.5659 0.0805
NP_440886.1_7 Forward -358 -348 7.0594 0.106
NP_440886.1_7 Forward -218 -208 6.66608 0.115
NP_440886.1_7 Forward -361 -351 5.78111 0.163
NP_440886.1_7 Forward -399 -389 3.42118 0.282
NP_440828.1_4 Forward -22 -3 -1.77127 0.206
NP_442614.1_2 Reverse -208 -222 6.19444 0.291
NP_442072.1_9 Reverse -207 -225 -22.4986 0.241
NP_441753.1_10 Reverse -327 -346 0.58944 0.289
NP_440907.2_8 Forward -61 -51 9.12434 0.113
NP_442264.1_2 Reverse -2 -19 6.92201 0.25
NP_441021.1_1 Forward -362 -343 0.884433 0.0848
NP_441021.1_1 Forward -216 -197 -9.24366 0.212
NP_440841.1_4 Forward -83 -64 -8.65367 0.25
NP_441626.1_2 Reverse -209 -216 12.2322 0.0511
NP_441626.1_2 Forward -20 -13 6.0373 0.212
NP_441626.1_2 Reverse -13 -20 6.0373 0.212
NP_441626.1_2 Forward -216 -209 5.93897 0.231
NP_442221.1_4 Reverse -344 -363 10.4225 0.296
NP_441589.1_5 Reverse -347 -366 15.4968 0.267
NP_440107.1_5 Reverse -207 -226 0.0977854 0.178
NP_440107.1_5 Forward -22 -3 -1.18052 0.178
NP_442794.1_1 Forward -25 -13 7.11881 0.148
NP_442794.1_1 Forward -221 -209 2.49725 0.288
NP_441962.1_4 Reverse -349 -368 -7.86702 0.195
NP_441962.1_9 Forward -223 -204 7.27595 0.258
NP_440387.1_1 Forward -21 -5 2.12349 0.0871
NP_440855.1_1 Reverse -339 -358 7.27595 0.127
NP_441431.1_2 Forward -354 -340 9.6354 0.181
NP_441488.1_8 Reverse -203 -217 17.5018 0.0865
NP_441993.1_1 Reverse -342 -361 14.7136 0.0768
NP_441993.1_1 Reverse -336 -355 6.52718 0.179
NP_440143.1_1 Forward -139 -120 17.7974 0.205
NP_441174.1_2 Reverse -339 -353 14.8476 0.15
NP_440114.1_10 Forward -21 -7 11.5043 0.111
NP_442323.1_7 Reverse -203 -222 2.06362 0.273
NP_440293.1_3 Reverse -340 -359 1.96607 0.206
NP_440766.1_4 Reverse -204 -218 3.34284 0.15
NP_441237.1_9 Reverse -209 -219 11.7798 0.156
NP_442743.1_4 Forward -216 -197 -6.29373 0.279
NP_441246.1_7 Reverse -210 -229 8.25926 0.197
NP_440324.1_4 Forward -312 -293 11.9948 0.274
NP_439910.1_2 Forward -70 -53 -13.3342 0.162
NP_442867.1_8 Forward -358 -339 10.1275 0.214
NP_442867.1_8 Forward -359 -340 7.86593 0.242
NP_440457.1_1 Reverse -204 -216 10.4621 0.092
NP_440457.1_1 Reverse -344 -356 3.77555 0.186
NP_441332.1_6 Forward -361 -351 13.6798 0.184
NP_441332.1_6 Forward -358 -348 11.2595 0.261
NP_442509.1_9 Forward -21 -11 12.3692 0.0947
NP_442509.1_9 Reverse -250 -260 8.23937 0.192
NP_443037.1_8 Reverse -138 -157 7.57094 0.242
NP_441440.1_8 Reverse -348 -361 19.0955 0.138
NP_440554.1_4 Forward -216 -206 5.97822 0.128
NP_440554.1_4 Forward -20 -10 5.09324 0.162
NP_442862.1_3 Forward -288 -271 6.92201 0.263
NP_441885.1_5 Reverse -208 -218 9.51814 0.0206
NP_441885.1_5 Reverse -12 -22 2.24165 0.0822
NP_441885.1_5 Forward -217 -207 1.25834 0.11
NP_442703.1_9 Forward -192 -174 3.55906 0.288
NP_442341.1_7 Reverse -207 -221 7.17775 0.11
NP_442341.1_9 Forward -359 -345 7.07881 0.204
NP_441756.1_5 Forward -360 -341 3.53937 0.199
NP_441756.1_5 Forward -355 -336 -0.0988766 0.242
NP_441756.1_5 Forward -352 -333 -1.08219 0.253
NP_441756.1_5 Forward -221 -202 -3.93378 0.29
NP_441756.1_5 Reverse -332 -351 -4.22878 0.294
NP_441756.1_5 Reverse -352 -371 -4.72043 0.295
NP_440423.1_6 Reverse -4 -23 -15.6352 0.229
NP_443000.1_7 Reverse -206 -216 10.2065 0.0355
NP_443000.1_7 Forward -23 -13 1.16001 0.271
NP_440507.2_3 Forward -24 -5 10.3234 0.208
NP_441842.1_10 Reverse -5 -19 16.2242 0.0322
NP_440275.1_3 Reverse -206 -216 12.5664 0.0316
NP_440275.1_3 Forward -23 -13 3.61828 0.219
NP_441307.1_4 Forward -281 -262 12.9791 0.122
NP_440679.1_10 Reverse -338 -357 -12.0953 0.189
NP_442451.1_2 Forward -44 -25 -7.96535 0.241
NP_442451.1_2 Reverse -200 -219 -9.24366 0.259
NP_439962.1_4 Forward -359 -340 5.99764 0.163
NP_439962.1_4 Forward -362 -343 3.6377 0.187
NP_439962.1_4 Forward -225 -206 -2.26216 0.226
NP_439962.1_4 Reverse -343 -362 -3.14714 0.246
NP_439962.1_4 Forward -356 -337 -6.49039 0.283
NP_440175.1_4 Reverse -4 -23 -13.7669 0.261
NP_440175.1_7 Reverse -11 -29 10.5342 0.253
NP_440149.1_8 Forward -21 -2 -4.03212 0.201
NP_440149.1_8 Reverse -336 -355 -4.6221 0.211
NP_441105.1_3 Reverse -337 -356 -3.04881 0.172
NP_440216.1_1 Forward -217 -203 -1.8687 0.0412
NP_440216.1_1 Reverse -12 -26 -2.75368 0.0574
NP_440172.1_1 Reverse -208 -218 6.27322 0.107
NP_440172.1_1 Reverse -12 -22 6.17489 0.11
NP_440172.1_1 Forward -217 -207 2.24165 0.279
NP_440172.1_1 Reverse -27 -37 2.14332 0.283
NP_442015.1_3 Forward -31 -12 13.0766 0.233
NP_442015.1_10 Reverse -204 -217 2.2809 0.196
NP_441226.1_7 Reverse -209 -216 12.7234 0.0312
NP_441226.1_7 Forward -216 -209 11.5435 0.0757
NP_440198.1_3 Forward -366 -347 18.7798 0.231
NP_441111.1_7 Forward -20 -12 8.96754 0.0463
NP_441111.1_7 Forward -216 -208 8.86921 0.0589
NP_441766.1_2 Forward -217 -208 14.7494 0.00772
NP_441766.1_2 Forward -21 -12 8.65285 0.0495
NP_442252.1_4 Reverse -342 -361 13.8641 0.254
NP_442179.1_7 Forward -344 -325 24.6805 0.00178
NP_440416.1_9 Forward -352 -333 -12.2919 0.156
NP_440416.1_9 Forward -364 -345 -15.1435 0.186
NP_443052.1_8 Reverse -2 -21 -4.52377 0.118
NP_443052.1_9 Forward -358 -339 -1.96717 0.231
NP_443052.1_9 Forward -361 -342 -6.68705 0.287
NP_440885.1_7 Forward -32 -13 16.9124 0.167
NP_440591.1_9 Reverse -341 -359 8.37728 0.18
NP_442154.1_1 Reverse -343 -361 -5.58572 0.127
NP_442154.1_1 Reverse -4 -22 -16.5005 0.241
NP_441430.1_2 Forward -364 -345 -4.81876 0.285
NP_440261.1_5 Forward -216 -203 -4.60227 0.158
NP_440261.1_5 Forward -20 -7 -12.3704 0.284
NP_440988.1_10 Forward -219 -205 16.6132 0.112
NP_440988.1_10 Forward -353 -339 5.28608 0.243
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTCGCTATCCCGCTAAGTTATGGCTCCATCCGAAAGTTGCCCCCGCCGCCGCCCTGGCCACCTGTCTGGTGCTGTTTAAGTTGGATTCTGTGATTAACAATATGTATAATCCGATTTTTCCCCTGATTAGTGGTGGTTTAGCGGGATTATGTTTACAACCACCGGAATCTTTAAAGCCCCAGTCCCGATCGCCAGCGGTTAAACAGGTAAAAAAACAGAAGCAGAAATCTAGTGAGCAGGGGAAACTCAAAACCAAGCCGGGGCGCTCAAAGTCAGGGTCAGGCAAAAGGTCTAAAGTTAGACGCAAAGTTGTACATAGGGCAGGCACGAAATCAGACAGCGATCCATCAAGCTAAGAACAGGTTGCAATTGCCCATCTCACGATCGCCGTCACGCCCCC

CDS

ATGAACACTTCTTTCCTCGAATCCCCCACCTTTCTCATCGGTGCCGAACGTTCTGGCACAACTCTGCTACGCTTGATGCTGTCTCACCATTCGCAAATTGCCTGGTGTAATGAGTTTGAATATGTCATCGATCAGGTAAGTGATAATGCTCAATTTCCCAAAGTATCTGACTATCAGGATTGGTTAAAGACCCATCGTATTTTTCAGGCTACTGGGTTTGAGGTTTCCCCTAACTTGACCTATGGGGAATTGGTGCAAAGCTTTTTACAGCAAAAACAAGCTCAGGAACAGAAGCCAGTGGTGGGGGCAACGGTACACCGACACTTCGATCGCCTGTTGGCCATTTGGCCCAATGCCCGTTTTATTCATATTGTGCGGGATCCCCGGGATGTGGCCCGCTCCTGCATCGGTATGGGCTGGGCGGGTAATGTGTGGACTGGTTCCCAACGCTGGCTGGAAGCAGAGCAAGATTGGGAGGCGTTGAAGCAAACTCTACCGGTTAATAACTACGTTGAGATCAGTTACGAAAACCTAATTCGTGAGCCCCAAACTGTATTGACCCAACTGGCCAATTTTTTAGGGGTCGCCTACGACCCGGCGATGTTGCAGTACAACCAAGACACAACCTATGACCAACCCGATAGTAGTTTTCTCAATCAATGGCGACGCAAATTAGGCGATCGGGAAATTCAACTGGTGGAATCCCGAGTTGGGGATTTGTTGTTGCAACGCGGCTATGAAGCCAGTGGACTGCCCACGATCCAGCTTACAAGTAGTCAAATAAAATCTCTTAAATTGCAGGATTGGTGGGCCCGGGCAAACTTTCGTTTACAGCGTTACGGGGCAGTCTTGTTTACTTTAAATTACATTACCAGTCGTTTACCACTTCGGGCGTGGCGGGACAGAATACAACTGAAAATCAACCAAATTGACTTGGAATATATCAAATAG

Protein

No sequence available