Your browser is old and dusty. Try Google Chrome!

Details for sll5044

ORF sll5044
Accession NP_942200.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -17 -3 -1.5737 0.265
NP_440557.1_3 Reverse -149 -168 11.0125 0.12
NP_440795.1_7 Reverse -10 -17 14.1988 0.0267
NP_441418.1_6 Forward -27 -8 -19.6667 0.093
NP_441418.1_6 Reverse -9 -28 -21.1417 0.139
NP_440897.1_6 Forward -321 -302 2.35861 0.165
NP_441453.1_4 Reverse -9 -17 6.80426 0.121
NP_441453.1_4 Forward -18 -10 6.70593 0.121
NP_442151.1_6 Forward -18 -4 8.35772 0.175
NP_442151.1_6 Reverse -9 -23 6.29277 0.24
NP_440226.1_1 Reverse -9 -28 2.75272 0.253
NP_441098.1_3 Reverse -336 -355 -3.53503 0.28
NP_442655.1_10 Forward -21 -2 -9.83364 0.22
NP_441721.1_6 Forward -241 -222 7.57094 0.281
NP_442173.1_1 Forward -17 -9 5.72262 0.203
NP_442173.1_1 Reverse -10 -18 5.72262 0.203
NP_442752.1_4 Forward -18 -11 13.5105 0.0314
NP_442752.1_4 Reverse -9 -16 4.26735 0.293
NP_443027.1_4 Reverse -7 -17 13.8447 0.049
NP_443027.1_4 Forward -20 -10 5.87989 0.294
NP_439997.1_4 Forward -148 -129 10.0292 0.189
NP_441812.1_3 Reverse -8 -22 12.9793 0.185
NP_442975.1_10 Reverse -5 -19 12.5853 0.0477
NP_440784.1_7 Forward -17 -10 13.2155 0.0365
NP_440784.1_7 Reverse -10 -17 12.1338 0.0604
NP_440061.1_9 Reverse -7 -21 6.29216 0.251
NP_440110.1_8 Forward -20 -1 -2.0655 0.258
NP_439979.1_2 Reverse -312 -331 6.29264 0.292
NP_442062.1_8 Forward -18 -8 9.7148 0.0559
NP_440304.1_4 Forward -20 -10 9.12481 0.0626
NP_442242.1_4 Reverse -10 -17 12.0355 0.0521
NP_442242.1_4 Forward -17 -10 11.5438 0.089
NP_440916.1_1 Forward -233 -219 8.25939 0.273
NP_442602.1_3 Forward -172 -153 7.07928 0.115
NP_441208.1_9 Forward -21 -7 14.8476 0.093
NP_441594.1_6 Forward -27 -8 0.196116 0.291
NP_442110.1_7 Forward -18 -4 1.57289 0.222
NP_442896.1_7 Forward -191 -172 8.94757 0.0865
NP_440769.1_8 Reverse -105 -124 7.66927 0.255
NP_440856.1_7 Forward -21 -2 -9.63698 0.294
NP_441083.1_5 Reverse -9 -19 8.73149 0.0307
NP_441083.1_5 Forward -18 -8 1.74999 0.198
NP_442827.1_8 Reverse -1 -20 14.6499 0.0402
NP_441434.1_1 Reverse -256 -270 6.98253 0.291
NP_441738.1_2 Reverse -136 -143 8.29857 0.176
NP_440209.1_1 Reverse -9 -17 8.37755 0.0576
NP_440209.1_1 Forward -18 -10 8.27922 0.0687
NP_442889.1_8 Reverse -42 -56 11.9953 0.0713
NP_440053.1_2 Forward -151 -132 10.0292 0.291
NP_439953.1_1 Reverse -224 -243 19.0757 0.163
NP_440331.1_5 Forward -212 -193 10.7175 0.00196
NP_440331.1_5 Reverse -105 -124 -8.752 0.142
NP_441716.1_1 Forward -18 -4 4.62115 0.254
NP_441716.1_1 Reverse -9 -23 3.14618 0.278
NP_442111.1_4 Forward -19 -5 4.81781 0.189
NP_440343.1_3 Reverse -305 -323 7.68819 0.205
NP_440906.1_5 Forward -17 -10 13.3138 0.0268
NP_440906.1_5 Reverse -10 -17 6.13563 0.241
NP_440747.1_10 Forward -21 -9 -2.02597 0.0196
NP_440747.1_10 Reverse -6 -18 -11.7607 0.142
NP_441486.1_1 Reverse -6 -20 -5.01529 0.218
NP_442634.1_4 Forward -20 -6 3.63784 0.102
NP_442634.1_4 Reverse -7 -21 -2.75368 0.156
NP_440403.1_10 Reverse -9 -28 0.58944 0.3
NP_440842.1_6 Forward -335 -316 12.4867 0.25
NP_443018.1_3 Reverse -10 -17 5.15232 0.226
NP_443018.1_3 Forward -17 -10 5.05399 0.238
NP_441316.1_7 Reverse -7 -22 6.17475 0.107
NP_440376.1_1 Forward -18 -9 9.83282 0.0339
NP_440376.1_1 Reverse -9 -18 9.73449 0.0365
NP_442687.1_7 Forward -19 -9 8.04317 0.116
NP_442687.1_7 Reverse -8 -18 6.07655 0.179
NP_442687.1_7 Forward -396 -386 3.71661 0.292
NP_442191.1_4 Forward -17 -3 11.187 0.268
NP_442485.1_3 Forward -332 -313 -5.9004 0.296
NP_442485.1_3 Reverse -7 -26 -6.09707 0.299
NP_441846.1_10 Reverse -183 -202 -16.7168 0.256
NP_441422.1_7 Reverse -7 -24 -5.46769 0.247
NP_440181.1_2 Reverse -169 -187 8.47561 0.297
NP_440533.1_9 Reverse -359 -378 5.80098 0.19
NP_442658.1_1 Reverse -7 -17 6.27276 0.234
NP_442658.1_1 Forward -20 -10 6.0761 0.238
NP_442205.1_9 Forward -24 -8 -1.71142 0.264
NP_440607.1_8 Forward -323 -304 4.32602 0.209
NP_442937.1_5 Forward -23 -4 6.39097 0.28
NP_441958.1_5 Forward -19 -9 11.3864 0.0074
NP_441958.1_5 Reverse -8 -18 2.53664 0.0409
NP_440203.1_5 Forward -284 -274 8.92768 0.281
NP_439905.1_5 Reverse -226 -240 14.4542 0.288
NP_440153.1_5 Forward -17 -3 11.6026 0.0763
NP_440153.1_5 Reverse -10 -24 8.25939 0.149
NP_440153.1_6 Reverse -8 -27 13.9625 0.222
NP_443055.1_3 Forward -27 -8 15.7062 0.087
NP_440993.1_2 Forward -23 -7 2.12349 0.269
NP_442002.1_1 Reverse -175 -193 8.86894 0.0827
NP_442002.1_9 Forward -396 -389 12.2322 0.185
NP_442002.1_9 Reverse -8 -15 10.7572 0.185
NP_441294.1_7 Reverse -5 -19 10.2105 0.205
NP_442438.1_10 Reverse -4 -18 16.5192 0.0212
NP_441000.1_1 Reverse -273 -291 12.0363 0.229
NP_442771.1_1 Forward -20 -2 -8.73231 0.204
NP_440147.1_4 Reverse -7 -20 9.16406 0.0428
NP_441550.1_8 Forward -20 -10 14.9258 0.0132
NP_441916.1_7 Reverse -9 -19 9.22315 0.0383
NP_441916.1_7 Forward -18 -8 8.63316 0.0437
NP_440345.1_3 Reverse -165 -179 16.8182 0.165
NP_441041.1_7 Forward -21 -9 5.37687 0.26
NP_440569.1_10 Forward -110 -91 10.9334 0.219
NP_441725.1_5 Forward -17 -7 1.455 0.135
NP_441725.1_5 Reverse -10 -20 -0.806614 0.271
NP_439966.1_7 Reverse -7 -17 8.92768 0.125
NP_439966.1_7 Forward -20 -10 4.01116 0.295
NP_442941.1_3 Reverse -10 -20 8.4365 0.0356
NP_442941.1_3 Forward -17 -7 1.94665 0.147
NP_440289.1_2 Reverse -6 -19 -4.60227 0.29
NP_440983.1_9 Forward -27 -8 1.76941 0.292
NP_442281.1_1 Forward -23 -9 6.19383 0.133
NP_442281.1_1 Reverse -4 -18 1.96562 0.282
NP_441334.1_7 Forward -20 -1 -20.945 0.284
NP_441079.1_7 Forward -264 -245 -2.36125 0.217
NP_440018.1_3 Forward -381 -362 3.04771 0.28
NP_442256.1_2 Forward -20 -2 -7.25734 0.214
NP_441644.1_6 Reverse -9 -19 15.8108 0.0048
NP_442215.1_2 Forward -20 -4 -4.1697 0.228
NP_442215.1_2 Forward -229 -213 -5.15301 0.246
NP_442029.1_6 Forward -140 -121 12.3892 0.155
NP_440929.1_8 Reverse -9 -18 9.53783 0.0296
NP_440929.1_8 Forward -18 -9 9.4395 0.0326
NP_442933.1_10 Forward -18 -9 13.9627 0.0192
NP_442933.1_10 Reverse -9 -18 7.86621 0.103
NP_440576.1_10 Forward -239 -220 20.0581 0.174
NP_441751.2_8 Reverse -10 -24 6.48943 0.0354
NP_442554.1_4 Forward -183 -164 5.89931 0.291
NP_442554.1_8 Reverse -10 -20 9.41981 0.0594
NP_442554.1_8 Forward -17 -7 4.3066 0.189
NP_441762.1_7 Reverse -8 -20 2.0056 0.0705
NP_441762.1_7 Forward -19 -7 -6.84419 0.284
NP_442142.1_4 Forward -21 -8 5.62358 0.187
NP_442142.1_4 Reverse -6 -19 4.54195 0.217
NP_442292.1_1 Reverse -10 -19 7.76787 0.0615
NP_442292.1_1 Forward -17 -8 0.196389 0.234
NP_441264.1_3 Reverse -120 -139 -1.57384 0.262
NP_443009.1_5 Forward -19 -8 15.9877 0.0107
NP_441726.1_7 Reverse -199 -218 5.60432 0.248
NP_441715.1_4 Reverse -10 -20 7.25653 0.108
NP_441715.1_4 Forward -17 -7 7.05986 0.118
NP_440620.1_4 Reverse -235 -249 15.5768 0.236
NP_440835.1_1 Reverse -178 -197 -9.83364 0.287
NP_440379.1_5 Forward -330 -311 -8.752 0.254
NP_441468.1_1 Forward -17 -10 6.3323 0.202
NP_441468.1_1 Reverse -10 -17 6.13563 0.209
NP_441015.1_10 Forward -23 -4 8.65258 0.0838
NP_441673.1_1 Reverse -9 -18 11.1111 0.0121
NP_441673.1_1 Forward -18 -9 11.0128 0.018
NP_441826.1_2 Forward -24 -10 2.2612 0.132
NP_441826.1_2 Reverse -3 -17 2.2612 0.132
NP_442719.1_3 Forward -242 -229 17.8166 0.292
NP_442427.1_3 Forward -23 -5 0.117479 0.275
NP_442427.1_8 Reverse -54 -73 8.45592 0.203
NP_442808.1_1 Reverse -8 -18 8.92768 0.0481
NP_442808.1_1 Reverse -310 -320 3.51951 0.238
NP_440145.1_3 Forward -28 -9 0.884433 0.133
NP_442050.1_5 Forward -20 -10 7.64939 0.243
NP_442789.1_4 Reverse -7 -26 -0.787193 0.209
NP_440923.1_1 Forward -361 -343 10.5398 0.293
NP_441518.1_3 Forward -28 -9 -15.7335 0.299
NP_441878.1_6 Forward -19 -9 0.668351 0.139
NP_441878.1_6 Reverse -8 -18 0.668351 0.139
NP_441036.1_3 Reverse -221 -240 7.27595 0.126
NP_441036.1_8 Reverse -8 -18 8.04317 0.177
NP_441036.1_8 Forward -19 -9 6.8632 0.213
NP_441557.1_5 Reverse -9 -18 10.2261 0.0144
NP_441557.1_5 Forward -18 -9 10.1278 0.0188
NP_441445.1_1 Forward -27 -8 5.01433 0.181
NP_442066.2_4 Reverse -9 -28 -8.85033 0.296
NP_441308.1_8 Forward -20 -10 14.4347 0.218
NP_442183.1_1 Reverse -9 -23 6.58777 0.168
NP_441238.1_10 Forward -184 -170 9.73436 0.292
NP_442347.1_2 Forward -17 -8 13.3727 0.056
NP_442645.1_2 Forward -20 -1 -18.3884 0.272
NP_441037.1_4 Forward -20 -10 6.83041 0.239
NP_441633.1_3 Reverse -7 -20 3.65753 0.0699
NP_440136.1_2 Forward -17 -10 6.43063 0.154
NP_440136.1_2 Reverse -10 -17 6.23397 0.171
NP_442998.1_5 Forward -133 -123 12.9597 0.158
NP_442998.1_5 Reverse -221 -231 10.7964 0.204
NP_442998.1_10 Forward -16 -9 5.93897 0.206
NP_442998.1_10 Reverse -11 -18 5.84064 0.235
NP_440899.1_8 Reverse -291 -310 1.57275 0.147
NP_440899.1_8 Forward -76 -57 -0.0988766 0.189
NP_440299.1_1 Reverse -5 -18 8.2785 0.0962
NP_441799.1_1 Forward -22 -8 6.39049 0.174
NP_441007.1_10 Forward -23 -10 1.10092 0.209
NP_440256.1_1 Forward -21 -2 9.0459 0.0213
NP_440709.1_1 Forward -357 -338 0.392004 0.26
NP_441559.1_8 Reverse -4 -18 -4.7203 0.236
NP_441559.1_8 Forward -341 -327 -5.90027 0.271
NP_442756.1_1 Forward -215 -196 6.4893 0.194
NP_441395.1_4 Reverse -267 -286 18.1898 0.163
NP_440915.1_6 Reverse -5 -19 -2.55701 0.276
NP_440306.1_8 Forward -238 -219 8.06178 0.202
NP_442453.1_6 Forward -195 -181 15.8853 0.285
NP_441199.1_6 Reverse -5 -24 16.2241 0.0308
NP_442386.1_9 Reverse -8 -17 6.19416 0.23
NP_442386.1_10 Reverse -185 -198 4.24752 0.265
NP_441340.1_5 Reverse -10 -17 5.93897 0.198
NP_441340.1_5 Forward -17 -10 5.84064 0.208
NP_441254.1_1 Forward -164 -151 19.4882 0.0951
NP_440211.1_4 Forward -145 -135 13.5497 0.296
NP_440586.1_8 Reverse -10 -17 11.1501 0.0845
NP_440586.1_8 Reverse -46 -53 10.7568 0.128
NP_440586.1_8 Forward -26 -19 7.31526 0.265
NP_442251.1_6 Reverse -10 -17 13.7071 0.0268
NP_443051.1_1 Forward -19 -10 9.73449 0.0265
NP_443051.1_1 Reverse -8 -17 0.688044 0.134
NP_439937.1_4 Forward -232 -213 9.14423 0.278
NP_439937.1_8 Reverse -313 -332 3.34271 0.204
NP_439937.1_8 Reverse -7 -26 -3.44213 0.268
NP_439937.1_9 Forward -197 -180 -10.8765 0.236
NP_440836.1_6 Reverse -119 -133 14.2576 0.214
NP_440398.1_6 Reverse -166 -185 3.14605 0.294
NP_440398.1_6 Reverse -134 -153 2.65439 0.294
NP_440439.1_1 Forward -21 -8 9.2624 0.0465
NP_440439.1_1 Reverse -6 -19 7.78743 0.0599
NP_440372.1_2 Reverse -10 -17 6.62729 0.151
NP_440372.1_2 Forward -17 -10 6.52896 0.188
NP_441181.1_3 Reverse -304 -323 18.4857 0.103
NP_440819.1_5 Reverse -220 -228 7.98423 0.228
NP_440819.1_5 Reverse -221 -229 7.68924 0.266
NP_441803.1_2 Forward -23 -4 1.67108 0.228
NP_441572.1_7 Forward -24 -5 -1.37718 0.188
NP_440267.1_2 Forward -23 -9 10.422 0.14
NP_442384.1_10 Forward -18 -5 16.2439 0.00903
NP_440472.1_6 Forward -242 -223 21.116 0.0757
NP_442790.1_4 Forward -27 -8 -10.1286 0.201
NP_440344.1_10 Reverse -2 -19 -6.94266 0.115
NP_440487.1_1 Forward -21 -2 -3.04881 0.214
NP_440297.1_9 Forward -17 -7 -0.511621 0.289
NP_440350.1_5 Forward -85 -66 -4.03212 0.273
NP_440999.1_9 Reverse -5 -19 0.0979218 0.193
NP_440888.1_2 Forward -18 -4 17.2068 0.00437
NP_441543.1_2 Reverse -10 -19 12.8811 0.0311
NP_441543.1_2 Forward -17 -8 8.65285 0.0968
NP_441543.1_3 Reverse -130 -144 10.3237 0.212
NP_442845.1_2 Forward -18 -4 8.94771 0.183
NP_442845.1_2 Reverse -210 -224 4.42448 0.259
NP_441319.1_8 Reverse -3 -21 7.29564 0.261
NP_441469.1_8 Reverse -8 -17 12.8811 0.0929
NP_443064.1_6 Reverse -9 -19 14.7 0.0796
NP_443064.1_6 Forward -336 -326 9.07643 0.247
NP_442578.1_7 Reverse -10 -17 12.5271 0.0544
NP_441462.1_2 Reverse -9 -19 10.5014 0.00824
NP_441462.1_2 Forward -18 -8 1.74999 0.0811
NP_441621.1_7 Reverse -7 -21 4.32615 0.0934
NP_442204.1_1 Forward -22 -11 0.353664 0.281
NP_442204.1_1 Forward -31 -20 -0.432984 0.299
NP_442780.1_3 Reverse -88 -107 5.68135 0.291
NP_440516.1_8 Reverse -9 -18 7.17789 0.0754
NP_440516.1_8 Forward -18 -9 7.07956 0.0867
NP_440516.1_8 Forward -27 -18 -0.983583 0.299
NP_442428.1_5 Forward -17 -10 13.1171 0.038
NP_442428.1_5 Reverse -10 -17 6.23397 0.201
NP_441443.1_2 Reverse -304 -323 -6.39206 0.29
NP_441867.1_2 Reverse -176 -195 -12.5869 0.262
NP_440673.1_3 Forward -16 -9 10.1672 0.149
NP_440865.1_9 Forward -24 -5 -2.16383 0.182
NP_441052.1_2 Forward -18 -8 8.23984 0.0482
NP_441052.1_2 Reverse -9 -19 7.35486 0.0742
NP_442219.1_9 Forward -17 -8 5.11294 0.186
NP_440436.1_4 Forward -17 -8 8.35743 0.109
NP_441884.1_8 Reverse -8 -27 -11.0136 0.268
NP_441884.1_9 Forward -21 -2 -22.3217 0.277
NP_441719.1_4 Reverse -10 -17 6.62729 0.151
NP_441719.1_4 Forward -17 -10 6.52896 0.188
NP_441733.1_10 Forward -21 -8 6.4108 0.188
NP_441004.1_1 Forward -149 -130 -15.0452 0.271
NP_441004.1_1 Reverse -179 -198 -17.7001 0.294
NP_442813.1_4 Reverse -168 -187 -9.047 0.299
NP_442366.1_3 Forward -19 -1 -2.3408 0.226
NP_442366.1_3 Reverse -17 -35 -4.8974 0.278
NP_442366.1_5 Reverse -181 -191 10.6976 0.245
NP_441115.1_4 Forward -19 -1 9.16315 0.223
NP_440328.1_4 Reverse -3 -22 15.0441 0.0338
NP_440328.1_10 Forward -78 -60 17.1279 0.216
NP_441851.1_10 Reverse -8 -18 6.66654 0.159
NP_442622.1_8 Reverse -9 -27 -19.1554 0.296
NP_442011.1_1 Reverse -8 -27 6.58763 0.186
NP_442515.1_1 Reverse -8 -22 -4.13031 0.298
NP_442689.1_8 Forward -251 -234 -0.551145 0.202
NP_441409.1_6 Reverse -3 -22 -10.0303 0.198
NP_441394.1_2 Forward -323 -304 16.2241 0.251
NP_440432.1_9 Reverse -10 -25 -0.413427 0.164
NP_442843.1_1 Forward -149 -130 -1.18052 0.192
NP_440474.1_8 Reverse -10 -24 6.39049 0.227
NP_440431.1_3 Reverse -330 -349 -5.99873 0.188
NP_439950.1_1 Forward -144 -135 16.0277 0.145
NP_440954.1_4 Forward -142 -123 -3.44213 0.275
NP_442335.1_7 Forward -71 -57 12.6836 0.267
NP_442006.1_2 Reverse -312 -329 -9.40093 0.197
NP_440483.1_1 Forward -187 -168 0.392778 0.193
NP_440483.1_1 Forward -155 -136 -2.75381 0.208
NP_441570.1_1 Reverse -9 -27 -0.374176 0.046
NP_441078.1_4 Reverse -9 -18 10.1278 0.016
NP_441078.1_4 Forward -18 -9 9.83282 0.0226
NP_442729.1_8 Reverse -5 -18 7.88576 0.132
NP_442348.1_2 Reverse -194 -203 12.0944 0.218
NP_442443.1_1 Forward -189 -170 -5.31042 0.282
NP_440526.1_3 Reverse -10 -21 0.451529 0.281
NP_441432.1_8 Forward -19 -10 6.98123 0.112
NP_441432.1_8 Reverse -8 -17 5.21127 0.185
NP_441432.1_9 Forward -239 -226 10.1497 0.256
NP_443024.1_2 Forward -195 -182 14.7683 0.248
NP_442320.1_8 Reverse -3 -17 -4.7203 0.185
NP_441732.1_2 Reverse -5 -21 -7.51295 0.0859
NP_441732.1_2 Forward -22 -6 -15.2811 0.145
NP_440629.1_6 Forward -24 -5 15.3356 0.135
NP_442815.1_10 Forward -168 -150 13.9813 0.297
NP_440199.1_10 Reverse -6 -16 11.3864 0.159
NP_441072.1_2 Forward -29 -10 13.7658 0.159
NP_442489.1_7 Reverse -9 -18 10.4228 0.0151
NP_442489.1_7 Forward -18 -9 10.3245 0.0193
NP_441659.2_8 Reverse -9 -19 11.1898 0.0198
NP_441659.2_8 Forward -18 -8 2.14332 0.211
NP_442913.1_10 Reverse -185 -204 -4.81876 0.248
NP_442008.1_2 Forward -21 -2 4.62101 0.234
NP_442346.1_5 Forward -19 -9 11.8781 0.055
NP_442346.1_5 Reverse -8 -18 5.68323 0.234
NP_440545.1_3 Forward -22 -5 13.0185 0.0189
NP_440010.1_4 Forward -28 -9 0.490334 0.248
NP_440010.1_4 Forward -22 -3 -1.08295 0.267
NP_440010.1_10 Forward -30 -11 6.09597 0.226
NP_442603.1_7 Forward -18 -4 11.307 0.117
NP_440449.1_6 Reverse -1 -19 6.21331 0.255
NP_441948.1_4 Reverse -2 -20 -2.0458 0.158
NP_441047.1_2 Reverse -313 -332 -1.47551 0.267
NP_441833.1_4 Forward -17 -10 6.3323 0.134
NP_441833.1_4 Reverse -10 -17 6.23397 0.163
NP_442799.1_2 Reverse -1 -20 -1.18052 0.294
NP_442162.1_9 Reverse -10 -17 6.52896 0.178
NP_442162.1_9 Forward -17 -10 6.43063 0.208
NP_442199.1_5 Reverse -1 -20 -7.57203 0.299
NP_440875.1_9 Reverse -11 -21 7.88535 0.255
NP_441813.1_5 Reverse -7 -17 7.45319 0.0746
NP_440590.1_4 Forward -17 -4 4.05085 0.0642
NP_440590.1_7 Forward -152 -138 15.3392 0.253
NP_440567.1_1 Forward -17 -3 5.80112 0.0959
NP_440035.1_1 Forward -32 -13 17.0107 0.136
NP_442497.1_8 Forward -300 -281 14.1583 0.231
NP_442497.1_10 Reverse -10 -19 7.86621 0.0695
NP_442497.1_10 Forward -17 -8 0.589713 0.153
NP_440821.1_4 Reverse -7 -17 9.32148 0.03
NP_440821.1_4 Forward -20 -10 1.16001 0.141
NP_440227.1_6 Reverse -92 -106 13.5715 0.287
NP_441239.1_9 Forward -20 -8 7.80712 0.148
NP_441239.1_9 Forward -198 -186 7.31547 0.165
NP_441239.1_9 Reverse -7 -19 3.57889 0.283
NP_441892.1_1 Forward -27 -10 9.77361 0.0715
NP_442669.1_1 Reverse -101 -120 26.5488 0.0000912
NP_442669.1_1 Forward -216 -197 22.2223 0.000502
NP_440796.1_3 Reverse -2 -20 9.94979 0.208
NP_442643.1_3 Reverse -136 -155 -8.45701 0.295
NP_442216.1_4 Reverse -135 -143 8.1805 0.255
NP_440354.1_5 Forward -21 -2 5.50599 0.195
NP_442138.1_10 Reverse -9 -28 8.84924 0.0507
NP_441782.1_5 Forward -26 -7 14.5524 0.107
NP_439974.1_4 Reverse -62 -81 10.7175 0.24
NP_440462.1_6 Forward -20 -10 10.0098 0.0429
NP_440462.1_6 Reverse -7 -17 5.68323 0.145
NP_440868.1_4 Reverse -14 -26 5.34885 0.101
NP_440868.1_4 Forward -22 -10 4.36554 0.121
NP_440868.1_4 Reverse -5 -17 1.51394 0.181
NP_442402.1_10 Reverse -167 -177 12.6642 0.204
NP_442882.1_8 Forward -145 -126 22.0256 0.0151
NP_442039.1_7 Reverse -179 -189 7.64985 0.273
NP_442696.1_6 Forward -199 -180 -2.75381 0.147
NP_442696.1_6 Reverse -128 -147 -11.7019 0.235
NP_442837.1_3 Forward -17 -10 13.5105 0.0268
NP_442837.1_3 Reverse -10 -17 6.13563 0.25
NP_442053.1_1 Reverse -9 -18 8.75118 0.0728
NP_442053.1_1 Forward -18 -9 8.65285 0.0741
NP_440505.1_3 Forward -20 -10 6.27322 0.187
NP_440351.1_1 Forward -192 -173 15.9291 0.00835
NP_440351.1_5 Forward -130 -111 22.5172 0.00394
NP_440351.1_8 Forward -160 -142 11.4255 0.162
NP_440914.1_1 Reverse -9 -19 14.4706 0.0143
NP_441011.1_8 Forward -17 -8 14.1594 0.0269
NP_441011.1_8 Reverse -10 -19 6.98123 0.18
NP_442101.1_10 Forward -26 -7 -12.1936 0.267
NP_442533.1_1 Reverse -177 -196 -7.76869 0.197
NP_442533.1_1 Forward -21 -2 -17.2085 0.281
NP_442533.1_6 Reverse -9 -18 14.651 0.01
NP_442533.1_6 Forward -18 -9 7.37455 0.0898
NP_441482.1_7 Forward -33 -19 -4.62196 0.153
NP_439944.1_9 Reverse -10 -20 8.1415 0.116
NP_441028.1_6 Reverse -168 -178 8.3377 0.216
NP_441028.1_6 Forward -229 -219 5.38779 0.255
NP_440115.1_6 Forward -21 -11 7.15819 0.158
NP_441602.1_4 Forward -29 -10 8.25926 0.293
NP_441106.1_1 Forward -19 -10 8.65285 0.0522
NP_441106.1_1 Reverse -8 -17 8.45619 0.0548
NP_439903.1_6 Forward -21 -2 3.83357 0.206
NP_441286.1_1 Reverse -8 -20 -4.58258 0.165
NP_441286.1_1 Forward -19 -7 -4.77924 0.175
NP_442674.1_3 Forward -26 -7 2.9486 0.297
NP_441809.1_7 Forward -292 -273 8.75091 0.2
NP_440670.1_8 Reverse -9 -18 8.84951 0.0606
NP_440670.1_8 Forward -18 -9 8.55452 0.066
NP_440886.1_7 Reverse -8 -18 17.1874 0.00477
NP_440886.1_7 Reverse -311 -321 4.10949 0.253
NP_440513.1_4 Reverse -9 -28 14.8474 0.19
NP_440907.2_8 Reverse -10 -20 10.0093 0.103
NP_442459.1_2 Forward -174 -155 12.7825 0.178
NP_441463.1_3 Forward -28 -9 -5.50708 0.229
NP_441626.1_2 Reverse -10 -17 6.0373 0.212
NP_441626.1_2 Forward -17 -10 5.93897 0.231
NP_441460.1_5 Forward -237 -223 16.4202 0.204
NP_442467.1_4 Reverse -252 -271 11.9958 0.149
NP_440387.1_1 Reverse -9 -25 -1.21977 0.142
NP_440387.1_1 Forward -18 -2 -3.18639 0.156
NP_440855.1_1 Reverse -309 -328 -0.885524 0.266
NP_442090.1_10 Forward -140 -127 12.999 0.179
NP_440766.1_5 Forward -177 -165 6.60538 0.296
NP_442867.1_8 Reverse -170 -189 5.99764 0.273
NP_440457.1_1 Reverse -5 -17 -0.846001 0.278
NP_440987.1_4 Forward -274 -255 10.6192 0.15
NP_442680.1_5 Reverse -218 -237 3.49139 0.23
NP_440473.1_9 Forward -29 -10 -7.17871 0.236
NP_442509.1_9 Forward -18 -8 16.1058 0.00871
NP_440554.1_4 Reverse -10 -20 5.68323 0.135
NP_440554.1_4 Forward -17 -7 4.99491 0.167
NP_441885.1_5 Reverse -9 -19 1.94665 0.0935
NP_441885.1_5 Forward -18 -8 1.65166 0.106
NP_440649.2_8 Forward -136 -122 10.1277 0.265
NP_442341.1_7 Forward -19 -5 1.47456 0.288
NP_441173.1_9 Reverse -169 -177 10.1471 0.261
NP_441173.1_9 Forward -228 -220 9.75379 0.284
NP_440423.1_6 Forward -26 -7 -13.3736 0.217
NP_443000.1_7 Forward -20 -10 7.94484 0.0589
NP_443000.1_7 Reverse -7 -17 5.87989 0.126
NP_441842.1_10 Reverse -2 -16 11.0127 0.145
NP_440275.1_3 Forward -20 -10 8.82982 0.0602
NP_440560.1_5 Reverse -166 -185 15.1137 0.108
NP_440091.1_1 Reverse -5 -17 5.25052 0.124
NP_441397.1_8 Reverse -220 -233 15.245 0.156
NP_441902.1_3 Forward -178 -168 12.9817 0.23
NP_442451.1_2 Reverse -1 -20 -10.227 0.265
NP_441207.1_7 Forward -173 -159 12.063 0.241
NP_441875.1_7 Reverse -150 -160 15.418 0.227
NP_441730.1_2 Reverse -94 -112 5.72234 0.299
NP_440216.1_1 Forward -18 -4 -1.27871 0.0303
NP_440216.1_1 Reverse -9 -23 -4.4253 0.111
NP_440216.1_6 Reverse -2 -18 8.22001 0.166
NP_440216.1_9 Forward -399 -390 5.60459 0.292
NP_440172.1_1 Reverse -9 -19 14.7297 0.0108
NP_442015.1_10 Reverse -5 -18 16.7355 0.0133
NP_441226.1_7 Forward -11 -4 9.77352 0.131
NP_441111.1_7 Reverse -10 -18 8.96754 0.0463
NP_441111.1_7 Forward -17 -9 8.86921 0.0589
NP_441766.1_2 Reverse -9 -18 7.86621 0.0703
NP_441766.1_2 Forward -18 -9 7.66954 0.0723
NP_442417.1_5 Forward -27 -13 5.99778 0.241
NP_442417.1_5 Reverse -312 -326 5.60446 0.255
NP_440416.1_9 Reverse -2 -21 -6.29373 0.0884
NP_442154.1_1 Forward -329 -311 -19.2537 0.294
NP_440261.1_5 Reverse -10 -23 -10.9938 0.23
NP_440261.1_5 Forward -17 -4 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GCCCGGGCAAACTTTCGTTTACAGCGTTACGGGGCAGTCTTGTTTACTTTAAATTACATTACCAGTCGTTTACCACTTCGGGCGTGGCGGGACAGAATACAACTGAAAATCAACCAAATTGACTTGGAATATATCAAATAGATTTCGGTACTCTTACTGCAATTTCATTACTTTTTCCCCGCCCTAAGAGCGTGTTTGAAAAGCCCCCCTGGTCCCCCAAGTTTGGGGGGAAACTAAATCAAAGTCCCCCAGTATTGGGGGATTTAGGGGGCAGAATCCGACTTTACAAACAGATTCTAAGCAACTTATTAAAAGGTATTCCATGTCTTCCGCTTTCTTCAACTATTTTGATGGCACATACATTATTAACCTAGCCGAACGAGGTGATCGCCGTCGGGAA

CDS

ATGATCCAAGAGTTTCAGCGGTTTAAAATTCTTGGTTTGCCCAAAAATGCTGCATTTTTTACAGCGGTAAAGCCATCAGACCAAGGAAATTTTCCGAGCCTGGGGGCCAGGGGGTGTTTTCTAAGTCATTTGGGAGTTTTGAAAGTGGCCAAAGCCCAAAACTTGGAACAGGTTCTCCTATTGGAAGATGATGCCACATTTACAAAAGACTTAGTTCAAAATCAAACCCAATTACTGCAAGAGTTACAAACGACTTCCTGGGACTTTGTTTACTTCGGTCATAATGTTTCAGCTAACACAAACTCCCTTTTGCATCTCTATGATGAGCCAATTATTCAAGCCCATTTTCTCGCCATCCATAGCCGTATTTTTGACCAGTTGATCGACTTTTTAGAAACATTGCTAGAACGTCCCGGTGGTCATCCCGATGGCGGCCCCATGCATGTGGATGGAGCTTATTCCACCTTTCGCCAACAAAATCCCCAGATCAAAACCTTAGTCGCCTCAATTCCATTAGGATTTCAACGGGCTTCCTGTAGTAGTATTGCCCCTCGCCAATGGTTTGATCGCTGGCCCGCCGCCACCAATATTGTCAATCTGGCCCGCAAAGCTAAGAATATTTACCAAAAAGTAGCTGTCTAG

Protein

No sequence available