Your browser is old and dusty. Try Google Chrome!

Details for sll5033

ORF sll5033
Accession NP_942189.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442291.1_5 Reverse -140 -156 2.61514 0.121
NP_442291.1_5 Forward -151 -135 -4.66135 0.281
NP_441453.1_4 Reverse -141 -149 4.73931 0.252
NP_441453.1_4 Reverse -183 -191 4.34598 0.257
NP_441098.1_3 Reverse -16 -35 -3.24792 0.28
NP_442655.1_2 Forward -285 -266 12.3892 0.0907
NP_442752.1_4 Reverse -141 -148 5.54565 0.194
NP_442752.1_4 Forward -270 -263 5.25066 0.256
NP_443027.1_4 Reverse -145 -155 7.94484 0.223
NP_443027.1_4 Forward -54 -44 7.74818 0.235
NP_443027.1_4 Reverse -46 -56 6.8632 0.262
NP_441812.1_3 Forward -134 -120 6.78443 0.291
NP_442975.1_10 Forward -154 -140 9.6354 0.0661
NP_440061.1_9 Forward -152 -138 6.19383 0.255
NP_442405.1_3 Forward -304 -292 17.5413 0.288
NP_441476.1_5 Reverse -74 -93 -2.0655 0.216
NP_442062.1_8 Reverse -141 -151 4.79825 0.198
NP_442062.1_8 Reverse -183 -193 3.71661 0.256
NP_440044.1_8 Reverse -44 -63 -2.26216 0.261
NP_440300.1_5 Reverse -14 -32 12.7979 0.271
NP_441083.1_5 Forward -150 -140 8.23984 0.0429
NP_441083.1_5 Reverse -141 -151 1.06167 0.218
NP_441738.1_2 Reverse -107 -114 8.29857 0.176
NP_441738.1_2 Reverse -263 -270 8.00357 0.235
NP_441738.1_2 Reverse -97 -104 6.72528 0.236
NP_440209.1_1 Reverse -261 -269 2.08437 0.286
NP_442889.1_10 Forward -22 -3 10.9111 0.272
NP_440056.1_9 Reverse -125 -144 18.6546 0.141
NP_441716.1_1 Reverse -141 -155 8.75105 0.133
NP_440906.1_5 Reverse -142 -149 8.79057 0.149
NP_441209.1_8 Forward -309 -291 6.92989 0.296
NP_440747.1_10 Reverse -138 -150 7.11881 0.00789
NP_440747.1_10 Forward -153 -141 -12.1541 0.227
NP_441486.1_1 Reverse -144 -158 0.88457 0.124
NP_441486.1_1 Forward -153 -139 -5.31028 0.231
NP_442608.1_2 Reverse -273 -291 19.0049 0.219
NP_442848.1_1 Forward -156 -142 -2.06536 0.263
NP_443018.1_3 Forward -191 -184 12.5271 0.0523
NP_443018.1_3 Reverse -184 -191 12.5271 0.0523
NP_441634.1_8 Forward -203 -189 3.14618 0.155
NP_440376.1_1 Reverse -141 -150 15.0444 0.00888
NP_440376.1_1 Forward -150 -141 -0.196935 0.285
NP_441857.1_6 Forward -140 -130 15.9097 0.199
NP_442485.1_3 Forward -203 -184 1.76941 0.217
NP_440642.1_10 Forward -203 -189 1.96562 0.284
NP_442658.1_1 Forward -194 -184 4.99446 0.288
NP_441414.1_9 Forward -150 -131 -4.32711 0.152
NP_442836.1_10 Forward -140 -130 9.32148 0.277
NP_440203.1_5 Reverse -108 -118 10.4026 0.225
NP_439905.1_1 Reverse -184 -197 15.6539 0.0837
NP_441099.1_5 Reverse -131 -150 -11.1119 0.271
NP_440106.1_2 Reverse -193 -211 11.4255 0.288
NP_440377.1_1 Reverse -230 -247 11.0804 0.291
NP_440569.1_10 Reverse -49 -68 4.05798 0.276
NP_440202.1_8 Forward -200 -181 9.80632 0.297
NP_442941.1_3 Reverse -142 -152 7.94484 0.0486
NP_442941.1_3 Forward -149 -139 -0.118297 0.249
NP_441678.1_9 Reverse -130 -149 -0.39387 0.23
NP_441079.1_7 Forward -363 -344 8.65176 0.107
NP_441556.1_7 Reverse -182 -201 2.35861 0.269
NP_442177.1_5 Forward -279 -265 11.996 0.22
NP_442933.1_1 Reverse -1 -20 5.77684 0.295
NP_441751.2_8 Forward -149 -135 -5.9986 0.249
NP_442554.1_8 Reverse -184 -194 8.63316 0.0712
NP_442554.1_8 Forward -191 -181 4.60159 0.18
NP_442292.1_1 Reverse -142 -151 -0.590259 0.258
NP_442476.1_6 Forward -149 -135 3.8345 0.154
NP_441523.1_6 Forward -118 -99 2.16274 0.299
NP_440183.1_9 Reverse -185 -204 -10.1286 0.226
NP_441468.1_1 Reverse -184 -191 3.97235 0.277
NP_441468.1_1 Forward -191 -184 3.97235 0.277
NP_441673.1_1 Reverse -141 -150 1.37636 0.114
NP_441673.1_1 Forward -150 -141 1.1797 0.163
NP_442868.1_6 Reverse -139 -149 -0.216628 0.273
NP_442719.1_2 Forward -313 -295 -1.25988 0.175
NP_441612.1_2 Reverse -141 -151 13.2931 0.21
NP_442808.1_1 Reverse -140 -150 4.50281 0.197
NP_442050.1_5 Forward -152 -142 9.51767 0.193
NP_440558.1_2 Forward -205 -186 -7.4737 0.294
NP_441878.1_6 Reverse -140 -150 -7.49312 0.231
NP_441557.1_5 Reverse -141 -150 0.491382 0.144
NP_441557.1_5 Forward -150 -141 0.29472 0.174
NP_441557.1_8 Forward -149 -139 12.7626 0.235
NP_441445.1_1 Forward -159 -140 1.0811 0.262
NP_442962.1_5 Reverse -43 -62 3.73603 0.291
NP_441564.1_10 Forward -188 -169 8.25926 0.166
NP_441574.1_1 Reverse -171 -190 -6.68705 0.277
NP_441549.1_9 Reverse -137 -155 -9.71562 0.258
NP_442347.1_2 Reverse -262 -271 13.1761 0.056
NP_442347.1_2 Forward -149 -140 5.89959 0.21
NP_442347.1_2 Forward -87 -78 4.22796 0.284
NP_442645.1_2 Reverse -253 -272 -16.3235 0.23
NP_442594.1_8 Forward -278 -259 4.22769 0.269
NP_440563.1_6 Reverse -372 -385 18.2105 0.161
NP_441633.1_8 Reverse -63 -82 18.1907 0.235
NP_440136.1_2 Reverse -142 -149 4.26735 0.218
NP_440136.1_2 Forward -269 -262 3.97235 0.288
NP_442998.1_5 Reverse -129 -139 10.8948 0.201
NP_442998.1_5 Forward -308 -298 10.4031 0.214
NP_440299.1_1 Reverse -143 -156 4.93527 0.193
NP_440299.1_1 Reverse -347 -360 2.47701 0.288
NP_441799.1_1 Reverse -179 -193 7.07881 0.153
NP_440256.1_1 Reverse -138 -157 -3.73712 0.138
NP_441559.1_8 Reverse -100 -114 6.09611 0.0814
NP_441559.1_8 Forward -145 -131 2.45787 0.143
NP_441559.1_8 Forward -144 -130 -6.68692 0.279
NP_441559.1_8 Reverse -99 -113 -6.88358 0.281
NP_440695.1_6 Forward -306 -292 13.2231 0.24
NP_442386.1_9 Forward -193 -184 10.914 0.111
NP_442386.1_9 Reverse -191 -200 9.5374 0.159
NP_442386.1_9 Reverse -303 -312 6.9808 0.219
NP_440570.1_5 Reverse -131 -150 -2.36049 0.278
NP_441340.1_5 Reverse -184 -191 4.07068 0.239
NP_441340.1_5 Forward -191 -184 4.07068 0.239
NP_440211.1_4 Forward -116 -106 13.5497 0.296
NP_440586.1_8 Forward -51 -44 10.7568 0.128
NP_440586.1_8 Forward -191 -184 7.61025 0.227
NP_440586.1_8 Reverse -184 -191 7.61025 0.227
NP_441262.1_3 Forward -270 -263 5.15232 0.265
NP_439937.1_9 Forward -115 -98 -14.2198 0.287
NP_440626.1_8 Reverse -188 -207 9.24257 0.264
NP_441789.1_7 Reverse -96 -115 -3.34455 0.272
NP_442384.1_10 Forward -150 -137 7.19745 0.0866
NP_441877.1_5 Reverse -295 -314 -0.4922 0.276
NP_441018.1_7 Forward -98 -79 7.47261 0.269
NP_441018.1_7 Reverse -251 -270 7.37428 0.272
NP_442262.1_10 Forward -191 -184 10.4622 0.145
NP_442262.1_10 Reverse -184 -191 10.4622 0.145
NP_440531.1_6 Forward -200 -181 -3.14714 0.262
NP_441965.1_10 Forward -153 -137 10.3833 0.107
NP_440297.1_9 Reverse -184 -194 0.176696 0.282
NP_441896.1_3 Forward -201 -182 -1.08219 0.252
NP_442553.1_4 Reverse -129 -148 14.5524 0.115
NP_441543.1_2 Forward -149 -140 5.70292 0.181
NP_441543.1_2 Forward -233 -224 4.22796 0.267
NP_441543.1_2 Reverse -142 -151 4.12963 0.279
NP_442845.1_2 Reverse -177 -191 11.406 0.131
NP_442845.1_2 Reverse -255 -269 4.91614 0.249
NP_440771.1_10 Forward -265 -246 18.9732 0.282
NP_441469.1_8 Forward -193 -184 14.0611 0.0612
NP_440220.1_4 Reverse -99 -118 3.83357 0.22
NP_443062.1_1 Reverse -261 -279 5.81572 0.218
NP_443062.1_1 Forward -150 -132 3.37804 0.3
NP_442204.1_1 Forward -143 -132 -0.137991 0.286
NP_442428.1_5 Forward -191 -184 4.36568 0.271
NP_442428.1_5 Reverse -184 -191 4.36568 0.271
NP_440783.1_2 Reverse -44 -63 -6.39206 0.285
NP_440673.1_2 Forward -202 -183 7.95079 0.286
NP_441052.1_2 Forward -150 -140 14.828 0.0172
NP_441052.1_2 Reverse -141 -151 0.963343 0.255
NP_442219.1_9 Forward -149 -140 5.01461 0.193
NP_440436.1_4 Forward -149 -140 4.62087 0.248
NP_441719.1_4 Forward -269 -262 3.77569 0.285
NP_441115.1_4 Forward -193 -175 9.26148 0.221
NP_442206.1_10 Forward -150 -135 1.94652 0.212
NP_441851.1_10 Reverse -140 -150 5.5849 0.207
NP_441851.1_10 Forward -193 -183 4.3066 0.277
NP_441851.1_10 Forward -151 -141 4.10993 0.287
NP_441668.1_4 Reverse -294 -313 -0.295539 0.251
NP_442515.1_1 Reverse -140 -154 6.09611 0.101
NP_441349.1_10 Forward -160 -141 -2.95047 0.13
NP_441349.1_10 Reverse -131 -150 -8.65367 0.278
NP_442314.1_1 Reverse -181 -199 -5.19239 0.272
NP_440389.1_2 Reverse -124 -143 15.5357 0.241
NP_440474.1_8 Reverse -44 -58 7.66879 0.202
NP_441124.1_5 Forward -308 -298 15.8729 0.188
NP_441124.1_5 Reverse -293 -303 11.0028 0.268
NP_442450.1_5 Reverse -231 -241 6.07655 0.204
NP_439950.1_1 Forward -115 -106 16.0277 0.145
NP_441570.1_1 Forward -150 -132 -16.7954 0.254
NP_441570.1_1 Reverse -141 -159 -17.3854 0.273
NP_441078.1_4 Forward -150 -141 15.536 0.0064
NP_441078.1_4 Reverse -141 -150 7.37455 0.0688
NP_441539.1_1 Reverse -294 -308 11.012 0.287
NP_441432.1_8 Forward -151 -142 5.89959 0.13
NP_442344.1_7 Reverse -262 -281 -7.27704 0.18
NP_441732.1_2 Reverse -137 -153 -15.7728 0.16
NP_441030.1_6 Reverse -128 -147 12.4664 0.24
NP_440760.1_1 Forward -150 -131 -23.2067 0.288
NP_440199.1_10 Forward -153 -143 7.74818 0.231
NP_442178.1_8 Forward -169 -151 16.5388 0.228
NP_440913.1_1 Reverse -163 -181 8.86894 0.181
NP_442230.1_3 Forward -64 -45 23.3039 0.0603
NP_442400.1_10 Forward -303 -290 8.27408 0.279
NP_442489.1_7 Reverse -141 -150 1.1797 0.101
NP_442489.1_7 Forward -150 -141 0.491382 0.178
NP_442079.1_7 Forward -191 -172 0.786102 0.27
NP_441022.1_1 Reverse -58 -67 11.2584 0.284
NP_442346.1_5 Reverse -182 -192 10.8948 0.0813
NP_442346.1_10 Forward -203 -184 -0.000545616 0.258
NP_440545.1_3 Reverse -126 -143 -1.33779 0.167
NP_440025.1_3 Reverse -100 -114 12.063 0.269
NP_441888.1_9 Forward -313 -294 13.775 0.289
NP_442699.1_8 Forward -315 -296 -12.6852 0.255
NP_442140.1_3 Reverse -184 -194 10.4031 0.0902
NP_441609.1_1 Forward -303 -284 0.884433 0.205
NP_440875.1_9 Reverse -45 -55 11.0001 0.187
NP_440875.1_9 Reverse -185 -195 8.85871 0.233
NP_440594.1_6 Reverse -255 -274 6.58682 0.258
NP_440927.1_4 Reverse -361 -380 18.289 0.213
NP_441239.1_9 Forward -194 -182 10.1671 0.0861
NP_441239.1_9 Reverse -181 -193 8.10212 0.142
NP_440796.1_3 Forward -157 -139 13.883 0.204
NP_441508.1_4 Forward -71 -57 14.1444 0.287
NP_441874.1_1 Forward -124 -110 11.8976 0.24
NP_442216.1_4 Reverse -106 -114 8.1805 0.255
NP_441617.1_6 Reverse -298 -317 -1.18052 0.256
NP_441230.1_5 Forward -239 -220 5.11266 0.185
NP_442402.1_4 Forward -158 -139 1.47364 0.173
NP_442402.1_6 Reverse -138 -147 13.4711 0.284
NP_441848.1_4 Forward -314 -298 13.9486 0.183
NP_441084.1_6 Forward -261 -247 10.8954 0.226
NP_442039.1_7 Forward -311 -301 15.3197 0.211
NP_441811.1_8 Reverse -255 -269 10.1277 0.22
NP_442679.1_1 Forward -254 -235 -4.91709 0.286
NP_441926.1_3 Reverse -225 -241 11.0716 0.138
NP_442837.1_3 Reverse -262 -269 8.79057 0.165
NP_442053.1_1 Reverse -141 -150 5.3096 0.197
NP_440505.1_3 Reverse -139 -149 16.1063 0.00763
NP_440505.1_7 Forward -143 -124 -1.18052 0.271
NP_441959.1_8 Reverse -357 -370 8.61288 0.286
NP_440207.2_7 Reverse -131 -150 19.174 0.143
NP_440013.1_1 Forward -138 -119 12.4867 0.189
NP_442532.1_3 Reverse -350 -369 16.2394 0.277
NP_440914.1_1 Forward -150 -140 7.5416 0.232
NP_442533.1_6 Forward -150 -141 7.86621 0.0862
NP_442533.1_6 Forward -192 -183 4.62128 0.179
NP_440263.1_5 Reverse -98 -112 8.75105 0.294
NP_442203.1_3 Reverse -11 -30 9.6711 0.257
NP_442203.1_3 Reverse -15 -34 6.22578 0.267
NP_439965.1_7 Forward -205 -186 12.3637 0.294
NP_442673.1_7 Reverse -337 -356 16.281 0.149
NP_441170.1_2 Forward -146 -127 2.16274 0.251
NP_441106.1_1 Reverse -182 -191 4.62128 0.213
NP_442588.1_1 Forward -204 -185 6.98095 0.259
NP_441286.1_1 Reverse -140 -152 1.90727 0.0767
NP_441286.1_1 Forward -151 -139 -6.74586 0.278
NP_442674.1_10 Forward -153 -134 15.4374 0.2
NP_442674.1_10 Forward -78 -59 14.5524 0.2
NP_440886.1_7 Forward -151 -141 4.69947 0.22
NP_442382.1_9 Reverse -101 -120 10.52 0.281
NP_442382.1_9 Forward -143 -124 8.65176 0.281
NP_442365.1_7 Reverse -137 -156 2.16274 0.168
NP_442615.1_1 Forward -279 -261 -5.48739 0.215
NP_441431.1_2 Forward -195 -181 9.14375 0.192
NP_442020.1_1 Reverse -85 -104 -1.08295 0.291
NP_441836.1_2 Forward -198 -179 -1.27885 0.217
NP_441174.1_1 Forward -112 -97 22.9893 0.0182
NP_440358.1_8 Reverse -292 -311 10.3242 0.116
NP_442357.1_8 Reverse -266 -285 15.0441 0.241
NP_441237.1_9 Forward -269 -259 11.6814 0.164
NP_441246.1_7 Forward -139 -120 8.45592 0.197
NP_442930.1_1 Forward -334 -324 10.796 0.275
NP_439910.1_2 Reverse -156 -173 -13.6292 0.162
NP_441489.1_3 Forward -189 -175 7.3645 0.272
NP_441489.1_3 Forward -370 -356 7.17351 0.279
NP_440554.1_4 Reverse -184 -194 5.09324 0.162
NP_441885.1_5 Forward -150 -140 17.3846 0.00578
NP_441885.1_5 Reverse -141 -151 1.455 0.11
NP_442341.1_3 Reverse -131 -150 13.0775 0.114
NP_442341.1_7 Reverse -140 -154 2.65453 0.249
NP_442341.1_9 Reverse -162 -176 5.1122 0.279
NP_441173.1_9 Reverse -301 -309 13.2937 0.17
NP_441173.1_9 Forward -300 -292 12.9004 0.206
NP_440191.1_6 Reverse -10 -24 16.0543 0.294
NP_443000.1_7 Reverse -139 -149 0.668351 0.293
NP_442354.1_7 Forward -153 -134 5.40766 0.26
NP_441902.1_1 Reverse -97 -116 10.7167 0.282
NP_441635.1_2 Forward -24 -5 12.0793 0.241
NP_441635.1_4 Forward -332 -313 14.3711 0.217
NP_440216.1_9 Reverse -194 -203 12.0944 0.252
NP_440216.1_9 Forward -311 -302 7.57121 0.286
NP_440216.1_9 Reverse -185 -194 5.99792 0.289
NP_440167.1_1 Reverse -153 -171 16.9313 0.299
NP_442015.1_10 Reverse -137 -150 -0.472371 0.268
NP_441226.1_7 Reverse -165 -172 7.1186 0.218
NP_441226.1_7 Forward -173 -166 6.82361 0.246
NP_440261.1_5 Reverse -184 -197 -8.33885 0.201
NP_440988.1_10 Forward -152 -138 5.28608 0.243
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TAGCAAAGAAAATGGTTGGCAGGTTCAACAAATTGCTAATAAATATCGTAATCCTGACCATAAACCAAATAATTTACACGACCAAATAGCCTTGGCAAAATTTAACCAAGAGCCGGAACTTGTTGGATTTTGGGATCGAGAAACCCTGAATAAACAAACGGGAACACGCTATTACCGTCGCATTGAAGTGGAATCTACTTGCCTTGCCTGCCATGGCTTAAAAAATAGCCGTCCGCAGTTTATTAAAGATGGCTATCCCCAGGATTTGGCCTACGACTTTAACGTGGGGGATTTACGGGGAATGTATGCAGTTTTCATCCCAGATGATATTCAAAAAGCTATGCAAGATGCCATCAAGTAAGACTAAATCAAGCAATTTAATATTTAGAGAATAGTCAAA

CDS

ATGAAAAGCATCTTAAGTTTTATCAAATCAGTCTTTATTCTTGGAATTTTAGTTGGGGTGTTGATAATTAATCTCGCAGTTTCTCCGGCTCAGGCTGTTATTCGCCAATTGGAAGAAGCACCAGGCCCAACAGTTTATCAGTCGGAGATTTCCAAGTCCCGTCAAATACTCAAGGATCAACAAGGGGGAAGTTGGCAGGCGATCGCCTTTGAAAGGACTATTCCTGACCATGAGGATAGTATCTATCTACGCCTAGTGGACTTTCCCGGCACCGCTAACATTGATCACTCCAAACCCCTCATTATTACTAATATGATGAGCGAAACTTTAAGTGCTGTAAATGTATCCGAAGATATGTTTATGGACAAGACCAAAATGTCCCCTGATGCCGGGGAATATGATTTACAGCCCATCTTAATGCAATTGGAATCGGCAATTCCTTTACGGCTAATTTTGCCCACCCTCGATCAACAAAAAATAGTGCTTAATGTTTCTCCAGCGGTGGTTGAAGAATGGCAATCACTCACCACTCAAAAGTAA

Protein

No sequence available