Your browser is old and dusty. Try Google Chrome!

Details for sll5026

ORF sll5026
Accession NP_942182.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -276 -262 5.01447 0.142
NP_440795.1_7 Reverse -141 -148 7.31561 0.259
NP_441418.1_6 Reverse -154 -173 -29.4015 0.224
NP_442291.1_5 Forward -278 -262 4.87675 0.0841
NP_442272.1_2 Reverse -40 -59 9.7875 0.281
NP_440897.1_6 Forward -374 -355 2.85027 0.157
NP_441453.1_4 Reverse -268 -276 14.8674 0.00947
NP_441453.1_4 Forward -277 -269 6.80426 0.121
NP_442151.1_1 Forward -296 -277 9.0459 0.27
NP_442151.1_6 Forward -277 -263 5.80112 0.262
NP_441818.1_9 Forward -339 -320 -7.86702 0.274
NP_442173.1_1 Forward -276 -268 13.8841 0.0225
NP_442173.1_1 Reverse -269 -277 12.0158 0.0316
NP_442752.1_4 Forward -277 -270 13.8055 0.0199
NP_442752.1_4 Forward -301 -294 9.47889 0.109
NP_443027.1_4 Reverse -195 -205 9.12481 0.177
NP_440784.1_7 Forward -276 -269 6.23397 0.241
NP_440784.1_7 Reverse -269 -276 6.13563 0.241
NP_442909.1_7 Reverse -263 -277 7.27547 0.221
NP_442861.1_4 Forward -63 -44 7.37347 0.23
NP_440061.1_9 Reverse -290 -304 10.2254 0.126
NP_440878.1_9 Forward -385 -366 -2.95047 0.281
NP_442062.1_8 Forward -277 -267 7.64985 0.0911
NP_442062.1_8 Reverse -268 -278 7.15819 0.107
NP_442062.1_8 Reverse -309 -319 6.17489 0.136
NP_442974.1_7 Forward -52 -34 14.473 0.283
NP_442972.1_1 Forward -63 -45 12.864 0.229
NP_442602.1_3 Reverse -300 -319 -3.24547 0.277
NP_439918.1_2 Forward -270 -251 0.884433 0.217
NP_441594.1_6 Forward -297 -278 -0.000545616 0.294
NP_440370.1_10 Reverse -259 -278 11.7008 0.176
NP_442110.1_7 Forward -277 -263 7.47274 0.116
NP_441083.1_5 Forward -277 -267 7.94484 0.048
NP_441083.1_5 Reverse -268 -278 0.865012 0.218
NP_442827.1_8 Forward -279 -260 7.66846 0.0938
NP_442115.2_4 Reverse -284 -303 8.84842 0.238
NP_441434.1_7 Reverse -270 -284 3.04785 0.264
NP_441738.1_2 Reverse -270 -277 15.28 0.0102
NP_441738.1_2 Reverse -148 -155 6.72528 0.236
NP_441558.1_5 Reverse -266 -285 3.83436 0.296
NP_441955.1_10 Reverse -352 -366 16.1259 0.294
NP_440209.1_1 Forward -277 -269 8.57422 0.0425
NP_442889.1_8 Forward -280 -266 10.422 0.0848
NP_441713.1_8 Reverse -300 -318 9.0656 0.268
NP_441716.1_1 Forward -241 -227 5.1128 0.24
NP_441327.1_1 Reverse -46 -65 9.49938 0.203
NP_440343.1_9 Forward -306 -287 8.94757 0.251
NP_440906.1_5 Forward -276 -269 6.23397 0.234
NP_440906.1_5 Reverse -269 -276 6.13563 0.241
NP_440747.1_10 Reverse -265 -277 -12.0557 0.199
NP_440747.1_10 Forward -280 -268 -12.2524 0.254
NP_441130.1_10 Reverse -266 -280 6.48943 0.187
NP_441486.1_1 Forward -280 -266 2.85119 0.074
NP_441486.1_1 Reverse -265 -279 1.76955 0.0999
NP_440470.1_5 Forward -111 -92 8.6416 0.248
NP_441695.1_4 Reverse -288 -306 20.5703 0.0532
NP_441695.1_4 Reverse -289 -307 11.8189 0.227
NP_441014.1_8 Reverse -238 -257 -9.83364 0.299
NP_442848.1_1 Reverse -262 -276 -3.04867 0.263
NP_442848.1_9 Reverse -303 -322 -1.57384 0.293
NP_443018.1_3 Reverse -269 -276 11.7405 0.0655
NP_443018.1_3 Forward -276 -269 5.44732 0.193
NP_440376.1_1 Forward -277 -268 5.89959 0.116
NP_440376.1_1 Reverse -268 -277 -0.0986038 0.285
NP_441588.1_4 Reverse -270 -280 7.05986 0.178
NP_442687.1_7 Forward -278 -268 12.5664 0.0712
NP_441077.1_6 Reverse -72 -88 3.57312 0.268
NP_441846.1_10 Forward -306 -287 -19.5684 0.256
NP_441846.1_10 Forward -305 -286 -21.535 0.256
NP_441846.1_10 Forward -339 -320 -22.42 0.259
NP_441846.1_10 Forward -312 -293 -22.715 0.264
NP_441846.1_10 Forward -302 -283 -23.01 0.275
NP_442658.1_1 Forward -320 -310 9.12434 0.167
NP_442658.1_1 Forward -279 -269 7.35439 0.214
NP_441256.1_1 Reverse -293 -312 -8.94866 0.269
NP_441958.1_5 Forward -278 -268 8.73149 0.0255
NP_441127.1_1 Reverse -163 -177 8.75105 0.288
NP_442836.1_5 Reverse -262 -281 14.6508 0.0588
NP_440984.1_7 Reverse -257 -271 6.09611 0.227
NP_440984.1_7 Forward -282 -268 4.91614 0.281
NP_442690.1_1 Forward -101 -82 -8.94866 0.19
NP_440153.1_5 Forward -276 -262 8.16106 0.149
NP_440993.1_2 Reverse -263 -279 2.32015 0.268
NP_441099.1_5 Reverse -258 -277 -5.99873 0.155
NP_442002.1_1 Forward -304 -286 6.70565 0.105
NP_442002.1_9 Forward -278 -271 10.7572 0.185
NP_442438.1_10 Reverse -263 -277 5.60446 0.131
NP_442431.1_7 Reverse -338 -357 6.4893 0.27
NP_441000.1_6 Reverse -267 -281 5.40779 0.0933
NP_440147.1_4 Forward -279 -266 6.1158 0.103
NP_441550.1_8 Forward -279 -269 7.55106 0.154
NP_441550.1_8 Reverse -266 -276 6.56775 0.201
NP_441331.1_1 Forward -323 -304 -7.76869 0.262
NP_441916.1_7 Reverse -268 -278 9.51814 0.0338
NP_441041.1_7 Forward -280 -268 11.0132 0.0864
NP_442996.1_1 Reverse -69 -88 5.96782 0.246
NP_441725.1_5 Reverse -310 -320 3.61828 0.115
NP_439966.1_7 Forward -279 -269 8.23937 0.14
NP_439966.1_7 Reverse -266 -276 6.56775 0.177
NP_439966.1_9 Forward -279 -270 0.884706 0.253
NP_442941.1_3 Forward -276 -266 7.64985 0.0628
NP_442941.1_3 Reverse -269 -279 0.963343 0.16
NP_440289.1_2 Forward -280 -267 1.59258 0.122
NP_441514.1_6 Forward -297 -290 14.2971 0.248
NP_442281.1_1 Reverse -263 -277 7.17714 0.106
NP_442281.1_1 Forward -282 -268 6.19383 0.133
NP_441079.1_7 Reverse -14 -33 -5.90115 0.269
NP_442575.1_8 Forward -307 -288 -2.75381 0.242
NP_441087.1_6 Reverse -137 -155 -2.53818 0.296
NP_441644.1_6 Reverse -268 -278 7.45273 0.124
NP_442501.1_2 Reverse -143 -162 3.6377 0.157
NP_440929.1_8 Reverse -268 -277 7.17789 0.0713
NP_442933.1_1 Reverse -219 -238 8.25963 0.253
NP_442933.1_2 Reverse -53 -71 7.45036 0.259
NP_442933.1_10 Reverse -268 -277 8.06287 0.0885
NP_442933.1_10 Forward -277 -268 7.96454 0.0937
NP_442926.1_1 Forward -269 -250 -4.52377 0.278
NP_440096.1_1 Reverse -74 -93 20.7464 0.103
NP_442554.1_8 Reverse -269 -279 4.3066 0.189
NP_442554.1_8 Forward -276 -266 3.91327 0.203
NP_442554.1_9 Forward -80 -61 12.8831 0.279
NP_441762.1_7 Reverse -267 -279 -5.07423 0.187
NP_442142.1_4 Forward -280 -267 2.67367 0.281
NP_442292.1_1 Forward -276 -267 -0.196935 0.239
NP_442292.1_1 Reverse -269 -278 -0.196935 0.239
NP_443009.1_5 Reverse -308 -319 5.07306 0.218
NP_443009.1_5 Reverse -267 -278 4.67974 0.234
NP_441715.1_4 Reverse -269 -279 9.02648 0.105
NP_440357.1_3 Reverse -307 -326 1.17943 0.275
NP_440357.1_6 Forward -175 -156 5.99764 0.279
NP_441198.1_8 Forward -320 -310 11.6111 0.193
NP_441468.1_1 Forward -276 -269 6.13563 0.209
NP_441468.1_1 Reverse -269 -276 6.0373 0.223
NP_441673.1_1 Forward -277 -268 1.27803 0.155
NP_441673.1_1 Reverse -268 -277 1.27803 0.155
NP_441826.1_2 Reverse -262 -276 4.22782 0.104
NP_441393.1_2 Reverse -362 -381 11.7032 0.272
NP_442868.1_6 Forward -279 -269 0.57002 0.217
NP_441056.1_1 Forward -277 -258 -4.42544 0.249
NP_440806.1_1 Reverse -113 -131 7.4923 0.273
NP_442227.1_2 Reverse -288 -307 4.916 0.202
NP_442227.1_2 Reverse -147 -166 0.392778 0.252
NP_442227.1_2 Reverse -287 -306 -1.67217 0.264
NP_442227.1_2 Reverse -284 -303 -3.14714 0.289
NP_442227.1_4 Forward -146 -127 11.7983 0.285
NP_442542.1_2 Forward -279 -266 14.5723 0.114
NP_442542.1_9 Reverse -156 -170 18.1901 0.0372
NP_442542.1_9 Forward -284 -270 4.52221 0.294
NP_442050.1_5 Reverse -266 -276 13.4509 0.0343
NP_440558.1_2 Reverse -306 -325 0.196116 0.194
NP_441036.1_8 Forward -278 -268 12.5664 0.0744
NP_442650.1_2 Forward -277 -263 2.5562 0.261
NP_441557.1_5 Forward -277 -268 8.94785 0.0289
NP_441557.1_5 Reverse -268 -277 0.688044 0.128
NP_441557.1_8 Reverse -293 -303 15.2208 0.183
NP_440084.1_8 Forward -131 -117 11.6616 0.241
NP_440101.1_3 Forward -339 -320 5.70265 0.19
NP_442347.1_2 Reverse -269 -278 8.94785 0.0718
NP_442347.1_2 Reverse -314 -323 4.0313 0.284
NP_442645.1_2 Reverse -260 -279 -16.0285 0.22
NP_440136.1_2 Forward -276 -269 6.23397 0.171
NP_440136.1_2 Reverse -269 -276 6.13563 0.193
NP_442998.1_10 Reverse -270 -277 15.5754 0.0102
NP_440299.1_1 Reverse -264 -277 6.90188 0.127
NP_441799.1_1 Reverse -264 -278 5.01387 0.227
NP_442201.1_10 Forward -288 -269 -6.39206 0.184
NP_442333.2_5 Reverse -257 -276 -14.3569 0.272
NP_440256.1_1 Reverse -265 -284 -5.9004 0.196
NP_440256.1_1 Forward -280 -261 -9.14533 0.275
NP_440915.1_6 Forward -300 -286 -2.55701 0.276
NP_441296.1_9 Reverse -287 -300 20.9631 0.0414
NP_440717.1_3 Reverse -282 -296 10.2254 0.231
NP_442866.1_1 Forward -339 -320 -6.98204 0.263
NP_441417.1_2 Reverse -301 -320 4.22769 0.162
NP_442386.1_9 Reverse -267 -276 11.0124 0.107
NP_442386.1_9 Forward -278 -269 5.9975 0.23
NP_441340.1_5 Forward -276 -269 13.5105 0.0314
NP_441340.1_5 Reverse -269 -276 5.84064 0.208
NP_440586.1_8 Reverse -198 -205 10.7568 0.128
NP_440586.1_8 Reverse -269 -276 9.47853 0.146
NP_440586.1_8 Forward -276 -269 5.74197 0.283
NP_441262.1_3 Forward -277 -270 14.7888 0.0223
NP_440027.1_8 Forward -280 -261 10.0284 0.243
NP_443051.1_1 Forward -278 -269 7.47288 0.0571
NP_439984.1_2 Reverse -269 -282 12.704 0.252
NP_439937.1_9 Reverse -308 -325 -0.650168 0.122
NP_440408.1_7 Forward -307 -288 9.0459 0.265
NP_440439.1_1 Forward -280 -267 1.49425 0.153
NP_440372.1_2 Forward -276 -269 13.8055 0.0214
NP_440372.1_2 Reverse -269 -276 6.52896 0.188
NP_440574.1_3 Forward -282 -263 1.47442 0.184
NP_440139.1_1 Forward -283 -264 10.815 0.0892
NP_442114.1_4 Reverse -268 -279 7.43349 0.277
NP_442262.1_10 Reverse -269 -276 13.2155 0.0213
NP_441689.1_4 Reverse -35 -54 10.8379 0.293
NP_441689.1_4 Forward -63 -44 10.6469 0.293
NP_441689.1_5 Reverse -266 -276 15.3192 0.0403
NP_441689.1_5 Forward -356 -346 12.1726 0.132
NP_440562.1_1 Reverse -272 -291 11.5033 0.276
NP_442556.1_10 Forward -206 -187 14.6558 0.177
NP_440350.1_5 Forward -78 -59 5.60432 0.157
NP_440350.1_5 Forward -84 -65 -3.44213 0.26
NP_442280.1_10 Reverse -293 -311 7.49983 0.268
NP_440888.1_2 Reverse -268 -282 12.6836 0.0405
NP_440888.1_2 Reverse -287 -301 9.83206 0.113
NP_440888.1_2 Forward -277 -263 6.29216 0.241
NP_440822.1_8 Reverse -299 -318 8.84924 0.258
NP_442277.1_7 Reverse -70 -86 5.9273 0.205
NP_442277.1_7 Reverse -64 -80 5.9273 0.205
NP_440575.1_1 Forward -51 -32 -2.95123 0.294
NP_441543.1_2 Reverse -269 -278 8.65285 0.0968
NP_441543.1_2 Forward -276 -267 4.52295 0.234
NP_442845.1_2 Forward -277 -263 8.35772 0.195
NP_442845.1_2 Reverse -262 -276 7.86607 0.195
NP_442845.1_2 Forward -302 -288 7.76774 0.195
NP_440208.1_1 Reverse -362 -381 -10.227 0.257
NP_441319.1_8 Forward -178 -160 6.214 0.27
NP_440982.1_1 Reverse -292 -311 3.83357 0.294
NP_440982.1_1 Reverse -287 -306 3.73524 0.294
NP_441469.1_8 Forward -319 -310 9.83282 0.227
NP_441469.1_8 Forward -278 -269 6.39124 0.227
NP_443064.1_8 Forward -375 -365 15.4175 0.286
NP_442337.1_8 Forward -389 -370 6.09597 0.21
NP_442578.1_7 Forward -276 -269 6.0373 0.18
NP_440071.1_1 Forward -170 -153 15.771 0.216
NP_441462.1_2 Forward -277 -267 8.82982 0.03
NP_443062.1_1 Forward -206 -188 10.3986 0.117
NP_443062.1_1 Reverse -268 -286 5.32818 0.231
NP_441601.1_4 Reverse -250 -269 -3.93378 0.293
NP_441601.1_4 Forward -173 -154 -4.22878 0.293
NP_441601.1_4 Forward -170 -151 -4.52377 0.293
NP_441601.1_4 Reverse -152 -171 -5.70374 0.294
NP_440936.1_2 Reverse -212 -231 16.1257 0.16
NP_442204.1_1 Reverse -13 -24 1.14031 0.28
NP_440516.1_8 Forward -277 -268 9.4395 0.0183
NP_440516.1_8 Reverse -268 -277 5.11294 0.118
NP_442080.1_7 Reverse -152 -171 0.491109 0.229
NP_442428.1_5 Forward -276 -269 6.13563 0.209
NP_442428.1_5 Reverse -269 -276 6.0373 0.212
NP_440673.1_3 Reverse -270 -277 12.4288 0.0426
NP_440673.1_7 Reverse -257 -276 1.76941 0.24
NP_440865.1_9 Forward -294 -275 -6.49039 0.226
NP_441052.1_2 Forward -277 -267 0.57002 0.256
NP_442219.1_9 Forward -276 -267 8.75118 0.0681
NP_440436.1_4 Reverse -269 -278 8.55409 0.0997
NP_440436.1_4 Forward -276 -267 6.39082 0.162
NP_441884.1_9 Forward -280 -261 -22.125 0.275
NP_441893.1_8 Forward -273 -254 18.9773 0.117
NP_441719.1_4 Forward -276 -269 6.82395 0.0855
NP_441719.1_4 Reverse -269 -276 6.52896 0.188
NP_441004.1_1 Forward -339 -320 -12.4886 0.247
NP_441004.1_1 Forward -306 -287 -17.7985 0.294
NP_442813.1_4 Reverse -151 -170 10.0292 0.139
NP_442366.1_3 Forward -278 -260 0.904127 0.161
NP_442366.1_3 Forward -27 -9 -1.94747 0.219
NP_441729.1_3 Reverse -250 -269 14.6508 0.173
NP_442206.1_10 Reverse -154 -169 3.42148 0.185
NP_440288.1_4 Reverse -68 -87 10.0284 0.26
NP_443054.1_2 Reverse -266 -280 1.86788 0.245
NP_441851.1_10 Forward -278 -268 7.55152 0.137
NP_441851.1_10 Forward -319 -309 4.0116 0.291
NP_441157.1_1 Reverse -113 -127 5.60385 0.235
NP_442856.1_7 Forward -193 -174 -4.42544 0.26
NP_440874.1_2 Forward -57 -38 11.7099 0.222
NP_441409.1_6 Reverse -11 -30 -8.45701 0.168
NP_440432.1_9 Reverse -269 -284 3.12649 0.0983
NP_441062.1_9 Forward -236 -218 17.5733 0.237
NP_442843.1_1 Forward -317 -298 1.57275 0.165
NP_441477.1_10 Reverse -261 -279 17.7187 0.0842
NP_442006.1_2 Forward -168 -151 -13.7275 0.197
NP_441570.1_1 Reverse -262 -280 -16.7954 0.254
NP_441078.1_4 Reverse -268 -277 0.0980582 0.205
NP_441078.1_4 Forward -277 -268 0.0980582 0.205
NP_441432.1_8 Forward -278 -269 5.50626 0.151
NP_442320.1_8 Forward -283 -269 5.01447 0.0442
NP_442320.1_8 Reverse -262 -276 -6.29359 0.277
NP_441732.1_2 Forward -294 -278 -16.8544 0.207
NP_440131.1_2 Forward -283 -264 7.96426 0.279
NP_441805.1_1 Reverse -67 -86 -5.80207 0.297
NP_440913.1_1 Forward -335 -317 6.50899 0.224
NP_442400.1_10 Reverse -83 -96 9.32449 0.271
NP_440713.1_4 Forward -306 -287 9.24257 0.152
NP_442489.1_7 Reverse -268 -277 0.786375 0.152
NP_442489.1_7 Forward -277 -268 0.589713 0.17
NP_441452.1_1 Reverse -285 -304 12.2908 0.292
NP_440559.1_1 Forward -276 -267 14.7494 0.0118
NP_441659.2_8 Reverse -268 -278 6.56821 0.0714
NP_442913.1_10 Reverse -364 -383 -5.70374 0.276
NP_441040.1_2 Forward -383 -364 -13.9635 0.284
NP_440708.1_6 Forward -392 -373 -2.26216 0.202
NP_440779.1_5 Reverse -268 -285 -15.0058 0.3
NP_442346.1_5 Reverse -267 -277 4.69992 0.276
NP_440352.1_5 Reverse -177 -196 10.6116 0.27
NP_441856.1_7 Reverse -154 -173 10.0292 0.288
NP_440459.1_2 Forward -279 -262 8.00365 0.272
NP_440010.1_5 Reverse -365 -384 14.5524 0.285
NP_442603.1_7 Forward -277 -263 19.8618 0.00895
NP_441833.1_4 Reverse -269 -276 6.52896 0.0924
NP_441833.1_4 Forward -276 -269 6.23397 0.163
NP_441329.1_6 Reverse -79 -98 18.3818 0.106
NP_441329.1_6 Reverse -67 -86 -2.81744 0.294
NP_442498.1_4 Forward -322 -304 10.6389 0.229
NP_440912.1_3 Forward -89 -70 11.7983 0.254
NP_442162.1_9 Forward -276 -269 12.9205 0.0282
NP_442162.1_9 Reverse -269 -276 12.9205 0.0282
NP_440671.1_4 Reverse -262 -276 7.37441 0.219
NP_440671.1_4 Forward -283 -269 4.91614 0.3
NP_442045.1_5 Reverse -150 -169 9.63589 0.182
NP_442045.1_5 Forward -286 -267 -1.67217 0.29
NP_442140.1_3 Reverse -269 -279 12.1731 0.0637
NP_440875.1_9 Reverse -270 -280 16.6457 0.0145
NP_441813.1_5 Reverse -266 -276 11.9764 0.0208
NP_441813.1_5 Forward -279 -269 9.7148 0.0241
NP_442028.1_1 Forward -51 -38 14.7675 0.251
NP_440590.1_4 Forward -276 -263 2.47756 0.0879
NP_440590.1_4 Reverse -269 -282 2.2809 0.0939
NP_440590.1_4 Forward -270 -257 -0.37404 0.186
NP_440567.1_1 Forward -276 -262 3.93283 0.134
NP_442497.1_10 Reverse -269 -278 0.589713 0.153
NP_442497.1_10 Forward -276 -267 -1.18024 0.256
NP_440821.1_4 Forward -279 -269 0.471689 0.174
NP_440821.1_4 Reverse -266 -276 -0.314959 0.251
NP_441239.1_9 Reverse -266 -278 4.07055 0.264
NP_442568.1_5 Forward -368 -349 9.0459 0.295
NP_441892.1_1 Reverse -300 -317 -2.02611 0.217
NP_441508.1_1 Forward -127 -108 12.0953 0.233
NP_441508.1_4 Forward -361 -347 13.285 0.297
NP_442643.1_3 Forward -171 -152 -0.4922 0.234
NP_441017.1_6 Reverse -264 -278 13.2736 0.2
NP_441541.1_1 Forward -51 -33 -4.10417 0.271
NP_440546.1_4 Forward -277 -267 12.6639 0.0641
NP_440546.1_4 Reverse -268 -278 10.046 0.109
NP_441230.1_5 Forward -282 -263 6.98095 0.166
NP_441230.1_5 Reverse -257 -276 -0.885524 0.292
NP_440462.1_6 Forward -279 -269 7.74818 0.0699
NP_440462.1_6 Reverse -266 -276 4.10993 0.216
NP_440868.1_4 Forward -281 -269 7.80712 0.0637
NP_441848.1_4 Reverse -108 -124 12.2298 0.208
NP_441848.1_5 Reverse -35 -54 13.9651 0.223
NP_442039.1_4 Forward -276 -269 11.6422 0.0747
NP_441811.1_8 Forward -324 -310 5.50613 0.299
NP_442837.1_3 Forward -276 -269 6.0373 0.25
NP_442837.1_3 Reverse -269 -276 6.0373 0.25
NP_440160.1_2 Forward -319 -300 0.0977854 0.228
NP_442053.1_1 Reverse -268 -277 7.17789 0.104
NP_440505.1_3 Forward -279 -269 14.3364 0.0224
NP_441701.1_3 Forward -305 -288 8.59364 0.247
NP_441777.1_8 Forward -90 -71 16.227 0.253
NP_442532.1_1 Reverse -37 -51 12.2515 0.215
NP_442532.1_1 Reverse -72 -86 11.5713 0.215
NP_440914.1_7 Forward -47 -28 5.20389 0.29
NP_441011.1_8 Forward -333 -324 8.35786 0.144
NP_441011.1_8 Reverse -269 -278 7.07956 0.179
NP_441011.1_8 Forward -276 -267 5.99792 0.208
NP_442533.1_1 Forward -337 -318 -14.3569 0.242
NP_442533.1_6 Forward -277 -268 5.40793 0.14
NP_442533.1_6 Reverse -268 -277 4.52295 0.179
NP_440263.1_3 Forward -283 -264 0.58944 0.298
NP_442322.1_4 Reverse -284 -301 -1.33848 0.226
NP_439944.1_9 Forward -276 -266 8.04317 0.121
NP_440116.1_8 Forward -276 -257 -6.29373 0.205
NP_441527.1_4 Reverse -67 -86 -8.45146 0.244
NP_441527.1_4 Reverse -90 -109 -10.2658 0.268
NP_441527.1_4 Reverse -65 -84 -11.4117 0.282
NP_441527.1_4 Reverse -59 -78 -12.9396 0.296
NP_440608.1_1 Reverse -65 -84 6.30397 0.265
NP_441602.1_3 Forward -276 -257 4.03102 0.162
NP_441972.1_5 Forward -383 -364 -1.57384 0.177
NP_441106.1_1 Forward -278 -269 8.45619 0.0548
NP_441286.1_1 Forward -278 -266 -6.84419 0.283
NP_440670.1_8 Forward -277 -268 8.65285 0.0627
NP_440670.1_8 Reverse -268 -277 6.29291 0.124
NP_440886.1_7 Reverse -250 -260 9.616 0.0805
NP_442614.1_2 Forward -277 -263 6.29277 0.291
NP_442072.1_9 Forward -278 -260 -23.3836 0.292
NP_440907.2_8 Reverse -269 -279 6.17443 0.178
NP_442842.1_10 Forward -78 -59 1.53328 0.254
NP_441626.1_2 Forward -276 -269 12.2322 0.0511
NP_441626.1_2 Reverse -269 -276 5.93897 0.231
NP_440387.1_1 Forward -277 -261 -4.46469 0.187
NP_441431.1_3 Forward -308 -289 4.52268 0.263
NP_442805.1_5 Reverse -146 -165 -3.44288 0.262
NP_440467.1_3 Reverse -310 -329 11.0609 0.284
NP_440114.1_10 Reverse -268 -282 11.8976 0.0996
NP_440114.1_10 Reverse -345 -359 8.84938 0.192
NP_441425.1_2 Forward -54 -35 12.9369 0.252
NP_440492.1_9 Reverse -191 -205 11.5223 0.294
NP_440293.1_3 Reverse -301 -320 1.17943 0.209
NP_440293.1_3 Forward -161 -142 -6.78538 0.293
NP_440766.1_4 Reverse -264 -278 0.88457 0.263
NP_439988.1_3 Reverse -298 -312 10.6193 0.219
NP_441237.1_9 Reverse -310 -320 12.9597 0.0987
NP_442743.1_4 Reverse -269 -288 -6.98204 0.279
NP_439910.1_2 Forward -285 -268 -22.5773 0.267
NP_442867.1_8 Reverse -295 -314 10.6192 0.206
NP_442867.1_8 Reverse -151 -170 5.50599 0.276
NP_442867.1_8 Reverse -294 -313 4.71934 0.277
NP_440457.1_1 Forward -305 -293 7.70879 0.101
NP_440457.1_1 Forward -281 -269 1.61227 0.232
NP_440457.1_1 Forward -299 -287 -0.74767 0.273
NP_440798.1_6 Reverse -269 -282 4.14919 0.147
NP_442680.1_5 Reverse -186 -205 -0.709294 0.292
NP_440554.1_4 Reverse -269 -279 13.5497 0.0245
NP_442737.1_9 Forward -399 -380 16.4369 0.211
NP_441885.1_5 Forward -277 -267 17.3846 0.00578
NP_440649.2_8 Reverse -182 -196 11.5043 0.265
NP_442341.1_7 Forward -278 -264 4.42448 0.191
NP_442341.1_9 Forward -279 -265 7.76712 0.187
NP_442341.1_9 Forward -268 -254 7.17714 0.204
NP_442395.2_4 Forward -167 -148 3.24359 0.207
NP_442395.2_10 Forward -282 -263 12.2908 0.271
NP_443000.1_7 Reverse -266 -276 6.56821 0.123
NP_443000.1_7 Forward -279 -269 1.84832 0.228
NP_440076.1_9 Reverse -309 -322 18.0132 0.166
NP_440275.1_3 Forward -279 -269 12.8614 0.0299
NP_440091.1_1 Forward -281 -269 1.02229 0.218
NP_440091.1_1 Reverse -264 -276 -0.74767 0.286
NP_439962.1_4 Reverse -292 -311 7.07928 0.155
NP_439962.1_4 Reverse -260 -279 -3.63879 0.256
NP_439962.1_4 Forward -171 -152 -8.85033 0.298
NP_439962.1_4 Reverse -151 -170 -8.94866 0.298
NP_440149.1_8 Forward -277 -258 -5.70374 0.231
NP_441105.1_3 Reverse -298 -317 -6.49039 0.236
NP_440216.1_1 Reverse -268 -282 13.9626 0.00532
NP_440216.1_1 Forward -288 -274 -12.5868 0.288
NP_440172.1_1 Forward -277 -267 7.55152 0.0761
NP_442015.1_10 Reverse -264 -277 9.75405 0.0449
NP_441226.1_7 Forward -276 -269 12.7234 0.0312
NP_441226.1_7 Reverse -269 -276 11.5435 0.0757
NP_441111.1_7 Reverse -269 -277 8.86921 0.0589
NP_442379.1_10 Reverse -261 -278 -1.43612 0.223
NP_439971.2_8 Forward -301 -287 16.5192 0.182
NP_441766.1_2 Forward -277 -268 8.1612 0.0645
NP_441766.1_2 Reverse -268 -277 5.89959 0.103
NP_440416.1_9 Reverse -285 -304 -10.9153 0.147
NP_440416.1_9 Reverse -152 -171 -18.0934 0.251
NP_440416.1_9 Reverse -286 -305 -20.1584 0.282
NP_443052.1_8 Forward -287 -268 -12.8819 0.267
NP_443052.1_9 Reverse -152 -171 2.45773 0.172
NP_443052.1_9 Reverse -286 -305 -2.55715 0.239
NP_443052.1_9 Reverse -149 -168 -3.44213 0.25
NP_443052.1_9 Forward -179 -160 -4.13045 0.254
NP_443052.1_9 Forward -170 -151 -4.72043 0.26
NP_443052.1_9 Forward -173 -154 -6.49039 0.283
NP_443052.1_9 Reverse -289 -308 -7.27704 0.295
NP_442154.1_1 Reverse -155 -173 -16.0088 0.229
NP_441430.1_6 Forward -329 -310 17.5024 0.121
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AATAATCGTTATTCTCCTGACTGGCCCCAGTTGGCCCTACAGAAAAAGCAATCCGTTAACTGGGTCTGTGAACGGTGTGGGGTGCAATGCCTCAAGCCGGGGGAGGGGAAGGGGTTATCAACCGGCGATCGGTATCGGCTCAGGATGGCGGTACATCATTGTGATTATGATCCAAGTAATAACTATCCTAGTAATTTGATGGCTTTATGCTCCCCCTGTCATCTTTACTACCACCGCAGGCAGCGGGGGAATGTGACACCAGGACAGTTAACATTAAAGTTTTGTTAGAGTCACTTTTCATGGATTCTTGTCAATATTTATCTTTATCTTTGTGTTATTGTTTACATTAAAATTTACTTTTATAACTAAAAAACTACCATCGTTTTGGAATAAAAAATAA

CDS

ATGGCGGATACTCATAATTTTATTGATATTAAAGATGCACTAAATGCTTTAATTTTGGGTAAACGTTTACCTGATGCGCTCTATATTCATTACTCGATTATTTCTCATTTATCACCTATTTTACGGCGATATGAAAGTCTTGCTCGACAAATTTTTGATGAAAATTATCAGTCTAAACTAAATCAAAATTTACAATTTACGCTGATTAAGTTTAATCTTAATGAACCAAAAATTTCCTACCTCGATTATCCTAATTTTGATTTAGATGCCCATCCTGCTCTGCGACAAAGCACACAGGTCAATTTAGAATTGAACAATTGTCAGGTTCGCCATTACGGGGATAATCCTCCTATTCTGCACCGTAAGGAAACCTTTGTCTGTGCTGATTATCCCTTGTACCAAACCTTTGCAGAGTTAACTCAGGCTGAGGAAAAATTGGGCTTACTAGCTGATCCTCGTCAAATTGGCTATCGTCAGCAGTGGGAAAAACGTCTGCAACAGTTTCGGGTCAGGATTGAAAACCACAAGTTGATTGAAATTCAAGAATTTGCTCATCAATCTCCCAAAATTGACCGTCACAAAGCAGCGATTATTCGGCGGCAAATGTCTCGTCCAGTGAGATCCCTCCTGGACGCAAATCTTTTGACTGAAGGTATGACCTTTTTTGACTATGGTTGTGGCCATGGGGAGGATCTAAAATTTGTTGCGGAAAAAGGGTTCGAGGTTCATGGCTGGGATCCGTTTTATGAACCAGAAGGCGATCGCCACCCTGCGGATATAGTCAATCTTGGCTATGTGATTAATGTCATTGAAAATCCAGCAGAAAGACGGGAAGCGTTATTTCAAGCTTGGGAACTGGCCCAAAAAATATTAGTGGTGTCAGCCCAGGTATTAATTGCCGATGGGGGAGCTGGTCATATTGCCTATGGAGATGGCGTAATTACTAGCCGCAACACCTTCCAAAAATATTATGGCCAAGAAGAACTGAAGCTTTACATTGATCAGGTTTTGGGGATTGATGCGATTCCGGTGGCCTTGGGAATTTACTTTGTCTTTCGGGATGAGGCCCAGGCTCAAGCTTTTCGGGCTTCCCGGTTTCGGTCACGGGCAACCACACCCCGAATTCGTCTTTCGGTTAAACGCTTTGAGGACTATCAAGACCTACTGCAACCGTTGATGAACTTCTTAACGGAACGGGGACGTTTACCGAAAAAGGGAGAGTTGGCAACCGAAGCAGATATTTGTGCTGAATTTAAGACCTTGACTCGAGCTTTTCAGGTGATTGAGCAGGCGACGAATGGAGAAGATTGGAAAAAAATTACAGAACAACGTAAACAGGATATTCAGATTTATTTAGCATTATCGCACTTTGCAAAACGTCCTCGCTTTAGTCAGTTAGATGACATCCTACAAACGGATATTAAAGTGTTGTTTGGAACCTATAAAGAAGCGTGTTTGCTGTCAGATAGAATGTTATTTAGTTTGGGAAATTTGGCAAATCTAGCCAATATCGCCCAACAAAGTCCAATCGGAATTTGCTCAAAGAAAGCGTTGCTGGTCCATATTAGTGCATTGGAAGCCCTTGATCCGTTGTTACGCTTATATGAGGGTTGTGCCAGTCGGACAGTGGGGCGATTGGAGAATGTAACATTGGTACGATTTTATCTCCATGAGCCAAAAATTGCTTATATTTTTTGTTCAGATTTTGACACAAATCCCCATCCGCGTTGGCAGACGATGATGCAGATTAGTTTGCAGGATTTACGGGTACGATACAAAGAATATGACCCTGATTATGCACCTGTAGTGCATTGTAAGGAGCGATTAGTGATGACGGATTATCCTCTGTGCAAAAAATTCGCTAAGTTGTCTCAACAGGAGGAGGATTGGGGATTATTGGAGAATTGGTCGGAAATTCAACTGTGGCCGGGATGGCAAAGAACCTTGCGGGAGATGGGAGTGGAATTTAGGGGTCATCGGTTAGTATGGCGCTCTGATGCTGATCCCTATGCACAAAAACTTCTCAAAGCTCGCATTCGTACCCAGCAACGGCAACGCCAAAATCTTTCCTAA

Protein

No sequence available