Your browser is old and dusty. Try Google Chrome!

Details for sll5004

ORF sll5004
Accession NP_942160.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441623.1_2 Forward -347 -328 18.4848 0.111
NP_441098.1_3 Reverse -98 -117 -5.64052 0.28
NP_440996.1_2 Forward -384 -375 13.9627 0.293
NP_442975.1_10 Forward -214 -200 1.37564 0.299
NP_442062.1_3 Forward -385 -366 -2.36049 0.271
NP_442972.1_1 Reverse -172 -190 7.8663 0.289
NP_440273.1_1 Reverse -273 -292 14.7531 0.243
NP_440769.1_3 Forward -227 -208 10.9134 0.28
NP_441434.1_1 Reverse -366 -380 19.9694 0.0521
NP_441434.1_1 Forward -381 -367 11.1842 0.233
NP_441327.1_1 Reverse -159 -178 2.67563 0.287
NP_442111.1_3 Forward -386 -373 17.2503 0.144
NP_441209.1_3 Forward -291 -272 17.0449 0.245
NP_440470.1_5 Forward -159 -140 12.1748 0.169
NP_441080.1_7 Reverse -366 -384 7.29487 0.238
NP_442690.1_1 Forward -225 -206 -13.6686 0.264
NP_442690.1_1 Forward -117 -98 -14.9469 0.276
NP_442690.1_1 Forward -192 -173 -15.7335 0.28
NP_442690.1_1 Reverse -363 -382 -16.8151 0.291
NP_441913.1_3 Reverse -208 -221 14.863 0.226
NP_441099.1_5 Forward -249 -230 -3.3438 0.133
NP_442598.1_2 Forward -361 -352 13.8644 0.292
NP_442396.1_5 Forward -356 -343 6.4108 0.238
NP_440569.1_7 Reverse -230 -249 11.2092 0.286
NP_442996.1_1 Reverse -273 -292 6.92274 0.219
NP_441406.1_3 Forward -378 -366 17.6402 0.235
NP_441514.1_4 Reverse -323 -342 15.1241 0.226
NP_441079.1_7 Forward -383 -364 -1.27961 0.201
NP_441079.1_7 Forward -293 -274 -5.40949 0.266
NP_442500.1_8 Reverse -354 -368 8.9251 0.285
NP_442933.1_2 Reverse -27 -45 7.06839 0.268
NP_442671.1_2 Forward -382 -363 -0.477563 0.297
NP_442476.1_1 Forward -385 -366 11.1244 0.276
NP_441298.1_3 Reverse -129 -139 16.9233 0.157
NP_441637.1_9 Forward -188 -170 -3.22577 0.296
NP_440785.1_1 Reverse -356 -375 2.75272 0.2
NP_440785.1_1 Forward -391 -372 -1.96717 0.265
NP_440385.1_8 Forward -146 -127 11.7928 0.206
NP_442977.1_2 Reverse -354 -372 20.6282 0.118
NP_440558.1_2 Forward -70 -51 -4.03212 0.241
NP_441739.1_2 Reverse -364 -380 2.81113 0.288
NP_441819.1_5 Reverse -202 -221 11.1244 0.261
NP_442347.1_2 Reverse -231 -240 5.89959 0.21
NP_442347.1_2 Forward -56 -47 3.44131 0.284
NP_440899.1_8 Forward -369 -350 -5.50708 0.231
NP_440299.1_1 Forward -65 -52 2.96866 0.265
NP_440787.1_5 Forward -382 -368 15.2409 0.215
NP_439985.1_1 Reverse -258 -277 11.2092 0.146
NP_441340.1_9 Forward -386 -376 8.06241 0.256
NP_441248.1_10 Forward -383 -373 14.9073 0.277
NP_439943.1_2 Forward -340 -321 10.5209 0.259
NP_442384.1_10 Forward -91 -78 3.26421 0.197
NP_442378.1_1 Forward -64 -47 15.4768 0.282
NP_442454.1_2 Forward -321 -302 10.074 0.29
NP_442277.1_7 Reverse -352 -368 -0.470657 0.224
NP_440255.1_3 Forward -290 -280 14.6315 0.298
NP_440296.1_6 Forward -289 -271 16.9041 0.282
NP_441157.1_1 Reverse -91 -105 7.47213 0.187
NP_441668.1_5 Reverse -361 -380 6.78429 0.279
NP_442689.1_8 Reverse -196 -213 -3.5994 0.251
NP_442689.1_8 Forward -221 -204 -3.79607 0.252
NP_442689.1_8 Forward -113 -96 -8.31929 0.294
NP_441124.1_5 Reverse -38 -48 13.9631 0.215
NP_441124.1_5 Forward -376 -366 11.9577 0.239
NP_440431.1_3 Reverse -261 -280 -9.14533 0.241
NP_440588.1_2 Forward -100 -81 -5.70374 0.259
NP_441432.1_9 Reverse -369 -382 12.9614 0.189
NP_441432.1_9 Reverse -188 -201 9.27706 0.28
NP_442400.1_10 Reverse -217 -230 14.863 0.173
NP_442400.1_10 Reverse -173 -186 7.41465 0.286
NP_441706.1_10 Reverse -45 -64 8.65258 0.254
NP_442749.1_5 Forward -382 -365 12.8512 0.159
NP_442749.1_5 Reverse -365 -382 10.2482 0.192
NP_441185.1_7 Forward -34 -15 13.1758 0.279
NP_442875.1_8 Forward -392 -373 12.5858 0.221
NP_441329.1_6 Reverse -340 -359 1.00224 0.245
NP_441329.1_6 Reverse -203 -222 -0.621121 0.278
NP_440227.1_2 Reverse -206 -222 10.6783 0.29
NP_440573.1_3 Forward -189 -176 17.8233 0.111
NP_440573.1_3 Forward -329 -316 17.2503 0.143
NP_441541.1_1 Forward -285 -267 3.3442 0.185
NP_441848.1_4 Reverse -25 -41 7.74165 0.288
NP_441848.1_4 Forward -391 -375 7.07321 0.297
NP_439948.1_2 Reverse -354 -372 14.8987 0.259
NP_441084.1_6 Reverse -353 -367 10.6046 0.234
NP_442696.1_4 Reverse -365 -379 19.3965 0.281
NP_441959.1_8 Reverse -100 -113 9.19132 0.286
NP_441959.1_8 Reverse -174 -187 8.61288 0.286
NP_442532.1_1 Forward -380 -366 9.23901 0.284
NP_442532.1_3 Reverse -370 -389 18.0371 0.16
NP_442532.1_4 Forward -382 -364 16.4972 0.124
NP_442532.1_4 Reverse -283 -301 7.28623 0.3
NP_440914.1_7 Forward -153 -134 12.8432 0.193
NP_441697.1_5 Reverse -272 -291 -8.64244 0.265
NP_441697.1_5 Reverse -364 -383 -10.9342 0.287
NP_441527.1_4 Reverse -217 -236 -9.31089 0.256
NP_441527.1_4 Reverse -353 -372 -10.5523 0.272
NP_441527.1_8 Reverse -342 -361 3.93269 0.279
NP_441106.1_3 Forward -67 -48 13.7658 0.164
NP_442058.1_6 Forward -189 -170 -2.36049 0.237
NP_440143.1_1 Reverse -49 -68 12.1925 0.288
NP_442743.1_8 Forward -324 -305 14.7864 0.132
NP_442930.1_1 Reverse -7 -17 13.4509 0.239
NP_442930.1_1 Reverse -322 -332 11.1893 0.26
NP_442930.1_1 Reverse -364 -374 9.12434 0.295
NP_441489.1_3 Reverse -208 -222 8.03294 0.244
NP_441885.1_3 Forward -366 -347 19.6867 0.0522
NP_442703.1_1 Reverse -212 -231 10.074 0.228
NP_442369.1_6 Reverse -176 -186 16.5414 0.127
NP_441359.1_5 Forward -85 -66 6.68596 0.188
NP_441207.1_7 Forward -383 -369 10.4172 0.263
NP_440804.1_7 Reverse -99 -116 8.88789 0.261
NP_441730.1_3 Reverse -366 -384 12.9098 0.234
NP_442371.1_1 Forward -19 -9 12.5659 0.246
NP_442788.1_7 Reverse -40 -59 8.25926 0.278
NP_440244.1_8 Forward -363 -344 1.37609 0.298
NP_442552.1_4 Forward -317 -298 10.7424 0.295
NP_442116.1_6 Forward -221 -204 8.16895 0.254
NP_442116.1_6 Forward -211 -194 5.78166 0.291
NP_442154.1_1 Forward -34 -16 -17.7788 0.267
NP_440988.1_5 Reverse -168 -187 13.1534 0.28
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGATTCAGCACATCAATGAAAAATTAGGTAAATTTTACTCTTTGTTTTGTCAATTCATAGAAGCCCAAGATAATTATTTGATCAAAGTATTTTTTACTCAGATAATGCCATAATATTATTAATTTGTTTAGAAGCATTTTGCGGTTCTAGTCCCAGAATGTTCGGATCACTTCTTATCTATTTTTCATAAAATTATTGCAATAAGAGAGATATGTTTTTGATTAATTTAGCAATTAAAACTCGAAGTTTTAGTTACTAGTTAATTAATAATTCCTCTCTTTCTACTGAACTTAGCTTAAATTTGGGGTAAGTAAACACCCGCATTAACTCTGTAACCGTTACCTTCGATACCAAATTTTGCTATTTGCTATACTGAGGCTGCTGGAAATATTTAATAGAA

CDS

GTGAATATGTTAGGTCGCCACTCTGGCCGAAACCGAGATAAGTCTCCGTCGAATGTGGAGCTTAGTCCACAGGAAAATGCTCAATTCCAACGGTGGGCAGAGGGTTTGGTGCAAAATCCAGCTATTATGGGCGGCGAAACTGTCTTTCCAGATAGCCGATTGACGGTACTGCGGGTTGCATCATTAGTAGAGCGAGGAGAAAGCCCTTCGGTCATCCTTGAGGATTATCCCTATTTGAAACCCATCGATCTTAAGTTTGCCCCAATCTATTGCCAATGCCAGACTTGTGATCGAGCTTACCAACCCCTTTAA

Protein

No sequence available