Your browser is old and dusty. Try Google Chrome!

Details for sll5003

ORF sll5003
Accession NP_942159.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440061.1_9 Forward -18 -4 5.1122 0.294
NP_441054.1_2 Forward -196 -177 10.4225 0.284
NP_442062.1_8 Forward -132 -122 5.48657 0.168
NP_440044.1_8 Forward -63 -44 2.16274 0.155
NP_441581.1_6 Reverse -62 -81 11.3286 0.283
NP_441200.1_4 Reverse -134 -153 6.98095 0.272
NP_442742.1_9 Reverse -169 -188 -12.6852 0.269
NP_440132.1_1 Reverse -121 -139 8.37728 0.272
NP_440132.1_1 Forward -139 -121 7.78729 0.288
NP_442726.1_7 Forward -269 -251 8.18062 0.191
NP_441434.1_7 Forward -130 -116 12.291 0.114
NP_442570.1_3 Reverse -250 -269 -0.983855 0.212
NP_441792.1_5 Reverse -177 -193 10.9733 0.205
NP_441163.1_9 Forward -207 -188 13.6675 0.236
NP_441533.1_1 Forward -69 -50 11.7008 0.277
NP_440403.1_10 Reverse -259 -278 1.37609 0.291
NP_443018.1_3 Forward -46 -39 8.20058 0.153
NP_443018.1_3 Forward -131 -124 6.62729 0.168
NP_441634.1_8 Forward -160 -146 -4.81863 0.298
NP_440376.1_1 Forward -91 -82 -1.18024 0.294
NP_442687.1_7 Reverse -122 -132 3.81494 0.286
NP_442485.1_3 Forward -264 -245 -0.4922 0.253
NP_441013.1_2 Reverse -188 -206 -2.83245 0.287
NP_442161.1_7 Forward -32 -13 3.44104 0.26
NP_442161.1_7 Reverse -172 -191 3.44104 0.26
NP_442782.1_2 Reverse -13 -27 6.48943 0.223
NP_442782.1_2 Forward -190 -176 4.03116 0.257
NP_441487.1_6 Forward -99 -80 6.68596 0.216
NP_441097.1_2 Forward -200 -183 7.61033 0.242
NP_439990.1_5 Forward -21 -8 5.42749 0.295
NP_442690.1_1 Reverse -281 -300 -8.752 0.189
NP_441129.1_8 Reverse -255 -274 9.53756 0.296
NP_442002.1_9 Reverse -25 -32 12.2322 0.185
NP_441398.1_5 Forward -202 -183 20.2556 0.11
NP_442231.1_10 Forward -54 -35 12.2908 0.136
NP_441916.1_7 Reverse -38 -48 1.84832 0.272
NP_441041.1_4 Forward -197 -178 -6.09707 0.163
NP_441041.1_4 Reverse -7 -26 -8.45701 0.203
NP_441041.1_7 Forward -280 -268 4.79381 0.295
NP_441369.1_3 Reverse -279 -293 5.99778 0.191
NP_441725.1_4 Forward -27 -13 2.45727 0.287
NP_440202.1_8 Reverse -115 -134 9.41727 0.297
NP_440260.1_8 Reverse -78 -96 5.42735 0.154
NP_442281.1_1 Forward -20 -6 4.12889 0.206
NP_442901.1_4 Reverse -207 -226 2.75272 0.278
NP_442215.1_2 Reverse -4 -20 0.156866 0.156
NP_442215.1_2 Forward -93 -77 -0.236458 0.164
NP_442933.1_2 Reverse -313 -331 7.06839 0.268
NP_441751.2_8 Reverse -83 -97 -3.44199 0.145
NP_441448.1_1 Forward -279 -260 5.11266 0.266
NP_440379.1_5 Forward -277 -258 -9.93197 0.27
NP_441673.1_1 Forward -91 -82 -8.06341 0.254
NP_441330.1_1 Forward -27 -8 -8.85033 0.183
NP_442490.1_9 Reverse -253 -272 -8.16202 0.284
NP_440558.1_2 Forward -25 -6 -3.3438 0.234
NP_440558.1_2 Forward -356 -337 -4.03212 0.241
NP_441518.1_3 Reverse -258 -277 -14.1602 0.269
NP_441878.1_6 Reverse -81 -91 -7.78811 0.266
NP_441557.1_4 Reverse -21 -35 10.9143 0.291
NP_440356.1_10 Reverse -255 -273 11.0322 0.253
NP_442135.1_1 Forward -176 -157 17.1404 0.288
NP_442347.1_2 Forward -52 -43 3.83464 0.284
NP_442347.1_2 Forward -342 -333 3.44131 0.284
NP_442590.1_9 Forward -278 -259 9.24257 0.23
NP_442998.1_5 Forward -179 -169 11.7798 0.176
NP_442998.1_10 Forward -20 -13 10.4622 0.0819
NP_442998.1_10 Forward -137 -130 9.28223 0.117
NP_440299.1_1 Forward -351 -338 2.96866 0.265
NP_440299.1_1 Reverse -185 -198 2.57534 0.284
NP_440256.1_1 Forward -135 -116 -3.83545 0.14
NP_441296.1_9 Reverse -178 -191 12.5067 0.22
NP_442150.1_8 Reverse -210 -229 15.8524 0.265
NP_440570.1_5 Forward -26 -7 -3.93378 0.298
NP_442474.1_6 Forward -270 -251 12.2908 0.115
NP_440586.1_1 Forward -195 -176 -2.16383 0.25
NP_440586.1_8 Forward -46 -39 9.08521 0.178
NP_439937.1_9 Reverse -144 -161 -10.8765 0.236
NP_439937.1_9 Reverse -165 -182 -12.0565 0.269
NP_440836.1_6 Reverse -165 -179 10.521 0.243
NP_443039.1_7 Reverse -177 -191 6.88214 0.19
NP_439943.1_4 Forward -198 -179 5.70265 0.284
NP_439943.1_7 Reverse -8 -27 4.71934 0.278
NP_442384.1_10 Forward -377 -364 3.26421 0.197
NP_442262.1_10 Forward -131 -124 10.1672 0.162
NP_442262.1_10 Forward -46 -39 9.38056 0.202
NP_440562.1_10 Forward -141 -123 12.2122 0.206
NP_440298.1_6 Forward -266 -252 17.8952 0.251
NP_441896.1_3 Reverse -114 -133 10.8159 0.0833
NP_442378.1_1 Forward -350 -333 15.4768 0.282
NP_440179.1_6 Reverse -182 -201 8.65258 0.2
NP_441306.1_10 Forward -200 -186 11.897 0.263
NP_441462.1_2 Reverse -123 -133 -1.10161 0.281
NP_441621.1_7 Reverse -257 -271 -4.91696 0.248
NP_441929.1_6 Reverse -57 -76 4.916 0.294
NP_440668.1_9 Forward -199 -180 15.4374 0.171
NP_440519.1_8 Forward -128 -112 6.54838 0.21
NP_440516.1_8 Reverse -130 -139 -0.68859 0.297
NP_442120.1_10 Reverse -7 -26 -15.8318 0.296
NP_441733.1_5 Forward -265 -246 12.8808 0.294
NP_441004.1_1 Reverse -7 -26 -14.9469 0.271
NP_441157.1_1 Reverse -377 -391 7.47213 0.187
NP_441668.1_10 Forward -21 -4 16.656 0.0982
NP_442689.1_8 Reverse -285 -302 -6.746 0.288
NP_442689.1_8 Forward -399 -382 -8.31929 0.294
NP_439960.1_10 Reverse -227 -245 -3.42244 0.273
NP_441124.1_5 Reverse -324 -334 13.9631 0.215
NP_440588.1_2 Forward -386 -367 -5.70374 0.259
NP_441078.1_4 Reverse -82 -91 -1.08191 0.222
NP_441078.1_4 Forward -91 -82 -2.06522 0.295
NP_441432.1_8 Reverse -6 -15 12.2911 0.0444
NP_440760.1_1 Forward -132 -113 -22.6167 0.263
NP_441805.1_1 Forward -220 -201 2.94938 0.124
NP_442353.1_3 Reverse -174 -193 11.6017 0.126
NP_442489.1_7 Forward -132 -123 -1.77023 0.247
NP_442489.1_7 Reverse -123 -132 -2.16355 0.295
NP_441706.1_10 Reverse -331 -350 8.65258 0.254
NP_441092.1_6 Reverse -251 -270 7.37428 0.242
NP_441040.1_2 Reverse -211 -230 -11.6036 0.255
NP_441185.1_7 Forward -320 -301 13.1758 0.279
NP_440545.1_3 Forward -95 -78 -5.86102 0.262
NP_441629.1_3 Forward -269 -250 -3.44288 0.277
NP_440459.1_2 Forward -200 -183 7.61033 0.285
NP_441502.1_6 Forward -66 -47 12.4875 0.284
NP_442796.1_10 Forward -268 -249 14.3558 0.145
NP_440590.1_4 Forward -197 -184 -2.93064 0.251
NP_440590.1_4 Reverse -69 -82 -5.29059 0.277
NP_441541.1_1 Reverse -279 -297 -0.475474 0.237
NP_440412.1_2 Reverse -80 -99 6.19431 0.281
NP_440546.1_4 Reverse -38 -48 6.74945 0.282
NP_442499.1_3 Reverse -167 -185 3.85406 0.289
NP_441848.1_4 Reverse -311 -327 7.74165 0.288
NP_442039.1_7 Reverse -9 -19 7.05986 0.283
NP_441811.1_8 Forward -70 -56 5.89945 0.289
NP_442409.1_10 Reverse -84 -98 18.8785 0.191
NP_441701.1_3 Forward -195 -178 6.92201 0.273
NP_441959.1_8 Reverse -386 -399 9.19132 0.286
NP_441252.1_6 Reverse -23 -30 11.9372 0.25
NP_441252.1_6 Forward -180 -173 11.6422 0.288
NP_442532.1_4 Reverse -17 -35 7.28623 0.3
NP_442541.1_10 Forward -16 -2 11.897 0.182
NP_439944.1_9 Reverse -83 -93 8.73149 0.102
NP_441106.1_3 Forward -353 -334 13.7658 0.164
NP_439903.1_6 Forward -25 -6 -0.39464 0.282
NP_440670.1_8 Forward -132 -123 3.7363 0.23
NP_440886.1_7 Reverse -129 -139 4.40448 0.237
NP_442072.1_9 Reverse -81 -99 -21.9087 0.215
NP_442794.1_1 Forward -143 -131 7.31547 0.142
NP_440387.1_1 Reverse -82 -98 -3.57971 0.162
NP_441836.1_2 Forward -204 -185 3.04771 0.16
NP_440143.1_1 Reverse -335 -354 12.1925 0.288
NP_440114.1_10 Reverse -123 -137 5.60446 0.3
NP_439988.1_3 Reverse -248 -262 5.89945 0.278
NP_440422.1_2 Reverse -57 -76 15.8307 0.279
NP_442743.1_4 Forward -166 -147 -7.67036 0.28
NP_442930.1_1 Reverse -293 -303 13.4509 0.239
NP_442930.1_1 Reverse -276 -286 13.3526 0.239
NP_441984.1_3 Forward -202 -184 10.6389 0.186
NP_442439.1_8 Forward -269 -250 9.3409 0.253
NP_442439.1_8 Forward -23 -4 7.37428 0.288
NP_441885.1_5 Reverse -130 -140 -1.29827 0.259
NP_440022.1_4 Forward -70 -51 14.5524 0.274
NP_441842.1_10 Reverse -261 -275 6.78443 0.272
NP_441359.1_5 Forward -371 -352 6.68596 0.188
NP_442451.1_2 Reverse -115 -134 -8.35868 0.246
NP_441105.1_3 Reverse -2 -21 -5.60541 0.222
NP_441105.1_3 Forward -33 -14 -8.45701 0.272
NP_441105.1_3 Reverse -69 -88 -9.34199 0.288
NP_442373.1_2 Forward -160 -141 -4.52377 0.205
NP_440216.1_1 Forward -91 -77 -11.5051 0.192
NP_442371.1_1 Forward -305 -295 12.5659 0.246
NP_442788.1_7 Reverse -326 -345 8.25926 0.278
NP_442379.1_10 Forward -98 -81 0.235503 0.223
NP_440416.1_9 Forward -209 -190 -21.0434 0.29
NP_440416.1_9 Reverse -181 -200 -21.83 0.297
NP_441974.1_3 Forward -223 -206 17.7776 0.228
NP_442154.1_1 Forward -320 -302 -17.7788 0.267
NP_440261.1_7 Reverse -251 -270 -6.98204 0.296
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GAACTTAGCTTAAATTTGGGGTAAGTAAACACCCGCATTAACTCTGTAACCGTTACCTTCGATACCAAATTTTGCTATTTGCTATACTGAGGCTGCTGGAAATATTTAATAGAAGTGAATATGTTAGGTCGCCACTCTGGCCGAAACCGAGATAAGTCTCCGTCGAATGTGGAGCTTAGTCCACAGGAAAATGCTCAATTCCAACGGTGGGCAGAGGGTTTGGTGCAAAATCCAGCTATTATGGGCGGCGAAACTGTCTTTCCAGATAGCCGATTGACGGTACTGCGGGTTGCATCATTAGTAGAGCGAGGAGAAAGCCCTTCGGTCATCCTTGAGGATTATCCCTATTTGAAACCCATCGATCTTAAGTTTGCCCCAATCTATTGCCAATGCCAGACTT

CDS

GTGATCGAGCTTACCAACCCCTTTAAATTACTGATTGATGAAGACCTTTCCCCCTCCATTGCCCAAGTAATTAGTCAAAAATTGGGTATTGAGGCGGTTGCTGTTAGAGATAGGGGCTTAATTAACGCTGAAGATCAAGCAGTTTTTGAGTACGCTTACAAAAATGACTATATTGTTGTCACTGCCAATATCAGAGATTTTGAACAAATTGCTAGGGCAACAGAAATTCACCCAGGTATTATCTTCATTTGTGATGGGGAGTTGATCCGCGCTGAACAAATCGAGGTTGTCACCTTAGCGGCGATCGCCTTGGCAGAAGAAATGGCTACAGGAAGAGACATGATCAACCGTGTGCTTTATGTGGAAATTGATAGGTCACTCCGCTTTGAGACTATGCCAAACTGA

Protein

No sequence available