Your browser is old and dusty. Try Google Chrome!

Details for sll5002

ORF sll5002
Accession NP_942158.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -312 -326 5.80112 0.13
NP_441061.1_2 Forward -319 -305 4.71948 0.145
NP_441061.1_2 Reverse -306 -320 1.67122 0.183
NP_441061.1_2 Forward -93 -79 -0.197071 0.223
NP_440557.1_1 Reverse -174 -193 7.7676 0.148
NP_440795.1_7 Forward -319 -312 14.6904 0.0123
NP_440795.1_7 Reverse -312 -319 14.6904 0.0123
NP_440795.1_7 Forward -181 -174 14.6904 0.0123
NP_440795.1_7 Reverse -174 -181 14.6904 0.0123
NP_441418.1_6 Forward -320 -301 -9.63698 0.0288
NP_441418.1_6 Reverse -311 -330 -10.522 0.0362
NP_441418.1_6 Forward -182 -163 -21.24 0.143
NP_441453.1_1 Reverse -304 -322 12.2114 0.0985
NP_441453.1_1 Forward -327 -309 6.40989 0.235
NP_441453.1_4 Reverse -311 -319 16.539 0.00633
NP_441453.1_4 Reverse -173 -181 16.539 0.00633
NP_441453.1_4 Forward -320 -312 16.539 0.00633
NP_441453.1_4 Forward -182 -174 16.539 0.00633
NP_441453.1_4 Reverse -85 -93 4.93597 0.224
NP_441453.1_7 Forward -134 -127 11.6422 0.298
NP_441960.1_3 Forward -322 -303 18.1889 0.116
NP_442151.1_6 Forward -182 -168 15.3392 0.0238
NP_442151.1_6 Reverse -173 -187 15.3392 0.0238
NP_442151.1_6 Forward -320 -306 14.2576 0.0379
NP_442151.1_6 Forward -94 -80 11.6026 0.0956
NP_442151.1_6 Reverse -311 -325 8.35772 0.175
NP_440561.1_4 Forward -337 -318 15.7394 0.185
NP_440561.1_4 Forward -322 -303 12.7242 0.241
NP_441818.1_1 Forward -181 -170 9.79292 0.232
NP_440226.1_1 Forward -182 -163 13.9625 0.0337
NP_440226.1_1 Reverse -311 -330 5.80098 0.145
NP_440226.1_1 Reverse -85 -104 3.6377 0.218
NP_441465.1_5 Forward -129 -115 17.9942 0.286
NP_442655.1_10 Forward -323 -304 -19.5684 0.282
NP_443002.1_5 Reverse -294 -312 15.2596 0.192
NP_442173.1_1 Forward -319 -311 15.4574 0.00633
NP_442173.1_1 Forward -181 -173 15.4574 0.00633
NP_442173.1_1 Reverse -312 -320 15.4574 0.00633
NP_442173.1_1 Reverse -174 -182 15.4574 0.00633
NP_442752.1_4 Forward -320 -313 13.8055 0.0199
NP_442752.1_4 Reverse -311 -318 13.8055 0.0199
NP_442752.1_4 Forward -182 -175 13.8055 0.0199
NP_442752.1_4 Reverse -173 -180 13.8055 0.0199
NP_442752.1_4 Forward -94 -87 4.26735 0.293
NP_443027.1_4 Reverse -309 -319 16.2046 0.0437
NP_443027.1_4 Forward -322 -312 13.943 0.0452
NP_443027.1_4 Forward -184 -174 7.25653 0.24
NP_441812.1_3 Forward -321 -307 8.06273 0.254
NP_442975.1_10 Forward -186 -172 19.3701 0.00397
NP_442975.1_10 Forward -324 -310 12.782 0.0459
NP_442975.1_10 Reverse -307 -321 4.62054 0.241
NP_442975.1_10 Reverse -169 -183 1.67063 0.293
NP_440784.1_7 Forward -319 -312 15.9687 0.0123
NP_440784.1_7 Reverse -312 -319 15.9687 0.0123
NP_440784.1_7 Forward -181 -174 15.9687 0.0123
NP_440784.1_7 Reverse -174 -181 15.9687 0.0123
NP_440061.1_9 Forward -184 -170 11.897 0.105
NP_440061.1_9 Forward -96 -82 8.25877 0.177
NP_441054.1_4 Reverse -163 -181 10.9339 0.0619
NP_441476.1_5 Reverse -345 -364 -8.16202 0.296
NP_440878.1_9 Reverse -163 -182 2.45773 0.177
NP_440878.1_9 Reverse -301 -320 -3.24547 0.29
NP_442062.1_8 Reverse -311 -321 19.4496 0.000558
NP_442062.1_8 Forward -182 -172 17.3846 0.00193
NP_442062.1_8 Reverse -173 -183 10.3048 0.0493
NP_442062.1_8 Forward -320 -310 10.3048 0.0493
NP_440761.1_4 Forward -325 -306 14.7491 0.0143
NP_440761.1_4 Forward -307 -288 -13.3736 0.257
NP_441859.1_3 Reverse -310 -329 12.0933 0.102
NP_440304.1_4 Reverse -309 -319 19.9412 0.00364
NP_440304.1_4 Forward -184 -174 10.8948 0.051
NP_440304.1_4 Forward -322 -312 9.91146 0.051
NP_440304.1_4 Reverse -171 -181 1.84832 0.299
NP_442242.1_4 Forward -319 -312 14.3954 0.0124
NP_442242.1_4 Reverse -312 -319 14.3954 0.0124
NP_442242.1_4 Forward -181 -174 14.3954 0.0124
NP_442242.1_4 Reverse -174 -181 14.3954 0.0124
NP_442242.1_4 Reverse -194 -201 9.87221 0.2
NP_440044.1_8 Reverse -174 -193 1.37609 0.175
NP_440044.1_8 Forward -319 -300 -0.0988766 0.21
NP_441781.1_7 Forward -320 -301 3.34271 0.194
NP_441200.1_4 Forward -120 -101 11.0125 0.18
NP_441935.1_2 Reverse -224 -243 -4.32711 0.27
NP_441619.1_8 Forward -188 -174 12.8803 0.122
NP_441208.1_9 Reverse -170 -184 8.65272 0.219
NP_441208.1_9 Reverse -33 -47 8.65272 0.219
NP_441208.1_9 Reverse -308 -322 8.25939 0.219
NP_441208.1_9 Forward -323 -309 5.70279 0.262
NP_441594.1_6 Reverse -302 -321 1.47442 0.268
NP_440370.1_10 Reverse -302 -321 6.39097 0.296
NP_440132.1_1 Forward -322 -304 20.8653 0.021
NP_442110.1_7 Forward -320 -306 21.1407 0.013
NP_442110.1_7 Reverse -173 -187 11.406 0.0595
NP_441082.1_10 Forward -134 -121 7.6891 0.297
NP_440856.1_4 Reverse -304 -323 -3.04881 0.226
NP_441083.1_5 Forward -182 -172 20.3345 0.00053
NP_441083.1_5 Forward -94 -84 15.2213 0.0126
NP_441083.1_5 Reverse -311 -321 11.3864 0.0159
NP_441083.1_5 Forward -320 -310 11.2881 0.0159
NP_441083.1_5 Reverse -173 -183 11.2881 0.0159
NP_441083.1_5 Reverse -85 -95 9.41981 0.0267
NP_442827.1_8 Forward -328 -309 12.585 0.0454
NP_441434.1_7 Reverse -313 -327 5.21113 0.225
NP_441738.1_2 Forward -318 -311 15.28 0.0102
NP_441738.1_2 Reverse -313 -320 15.28 0.0102
NP_441738.1_2 Forward -180 -173 15.28 0.0102
NP_441738.1_2 Reverse -175 -182 15.28 0.0102
NP_441738.1_2 Forward -200 -193 10.0685 0.125
NP_441738.1_2 Reverse -123 -130 6.52862 0.261
NP_441738.1_4 Forward -192 -173 6.78429 0.203
NP_441558.1_5 Reverse -309 -328 19.9606 0.00612
NP_441558.1_5 Reverse -171 -190 4.81767 0.269
NP_440209.1_1 Reverse -311 -319 18.1123 0.00295
NP_440209.1_1 Reverse -173 -181 18.1123 0.00295
NP_440209.1_1 Forward -320 -312 18.1123 0.00295
NP_440209.1_1 Forward -182 -174 18.1123 0.00295
NP_442889.1_8 Forward -185 -171 18.4851 0.0104
NP_442889.1_8 Forward -323 -309 11.1104 0.0748
NP_440447.1_1 Reverse -306 -324 6.11567 0.194
NP_440447.1_1 Forward -187 -169 2.0841 0.285
NP_440447.1_6 Forward -328 -310 9.45892 0.135
NP_440447.1_6 Reverse -165 -183 4.73903 0.163
NP_441713.1_1 Forward -326 -307 -3.54046 0.113
NP_441713.1_1 Reverse -167 -186 -5.21209 0.113
NP_441713.1_1 Reverse -344 -363 -9.83364 0.187
NP_441713.1_1 Reverse -305 -324 -16.8151 0.286
NP_441713.1_1 Reverse -79 -98 -16.8151 0.286
NP_440178.1_7 Reverse -172 -191 -3.83545 0.0512
NP_442570.1_3 Forward -132 -113 -8.65367 0.291
NP_441716.1_1 Forward -182 -168 7.57108 0.166
NP_441716.1_1 Forward -320 -306 3.53951 0.261
NP_442111.1_4 Reverse -172 -186 11.406 0.0509
NP_442111.1_4 Forward -321 -307 11.2093 0.0515
NP_441624.1_7 Forward -135 -121 10.4227 0.217
NP_440906.1_5 Forward -319 -312 15.8704 0.0124
NP_440906.1_5 Reverse -312 -319 15.8704 0.0124
NP_440906.1_5 Forward -181 -174 15.8704 0.0124
NP_440906.1_5 Reverse -174 -181 15.8704 0.0124
NP_440747.1_10 Reverse -170 -182 14.9853 0.00221
NP_440747.1_10 Reverse -308 -320 7.80712 0.00223
NP_440747.1_10 Forward -185 -173 5.54551 0.0128
NP_440747.1_10 Forward -323 -311 -2.02597 0.0196
NP_440747.1_10 Forward -97 -85 -4.48425 0.101
NP_440747.1_10 Reverse -82 -94 -12.1541 0.227
NP_440747.1_10 Forward -133 -121 -12.5474 0.297
NP_441130.1_10 Reverse -309 -323 11.0127 0.107
NP_441854.1_10 Forward -322 -303 0.392778 0.282
NP_442973.1_5 Forward -191 -172 15.4374 0.114
NP_441486.1_1 Reverse -170 -184 15.4376 0.00596
NP_441486.1_1 Forward -185 -171 14.9459 0.00628
NP_441486.1_1 Forward -323 -309 3.34284 0.0619
NP_441486.1_1 Reverse -82 -96 -4.52363 0.201
NP_441486.1_1 Reverse -308 -322 -4.81863 0.209
NP_441486.1_1 Forward -97 -83 -4.91696 0.213
NP_441486.1_10 Forward -69 -52 12.0007 0.257
NP_442330.1_4 Forward -322 -303 16.1172 0.233
NP_442634.1_4 Forward -322 -308 15.6342 0.0115
NP_442634.1_4 Reverse -309 -323 -3.54032 0.161
NP_440057.1_8 Reverse -25 -44 11.5042 0.298
NP_441014.1_10 Reverse -172 -191 3.53858 0.213
NP_441014.1_10 Reverse -310 -329 0.293673 0.244
NP_442848.1_1 Forward -188 -174 6.3911 0.0791
NP_442848.1_1 Reverse -305 -319 -2.16369 0.263
NP_441012.1_4 Reverse -307 -320 5.91914 0.286
NP_443018.1_3 Forward -319 -312 14.8871 0.0123
NP_443018.1_3 Reverse -312 -319 14.8871 0.0123
NP_443018.1_3 Forward -181 -174 14.8871 0.0123
NP_443018.1_3 Reverse -174 -181 14.8871 0.0123
NP_441316.1_7 Reverse -309 -324 4.89645 0.121
NP_441316.1_7 Forward -322 -307 4.1098 0.135
NP_441634.1_8 Reverse -309 -323 12.291 0.0529
NP_441634.1_8 Reverse -171 -185 -4.62196 0.295
NP_440376.1_1 Forward -320 -311 19.4693 0.000692
NP_440376.1_1 Reverse -311 -320 19.4693 0.000692
NP_440376.1_1 Forward -182 -173 19.4693 0.000692
NP_440376.1_1 Reverse -173 -182 19.4693 0.000692
NP_440376.1_1 Forward -94 -85 5.99792 0.111
NP_440376.1_1 Reverse -133 -142 1.57302 0.246
NP_440376.1_1 Reverse -85 -94 -0.000272808 0.285
NP_440376.1_1 Forward -130 -121 -0.0986038 0.285
NP_441857.1_5 Forward -327 -309 9.95058 0.185
NP_441857.1_5 Reverse -166 -184 5.03403 0.217
NP_441588.1_4 Reverse -175 -185 16.2046 0.0369
NP_441588.1_4 Forward -180 -170 8.92815 0.14
NP_441588.1_4 Reverse -87 -97 8.33817 0.151
NP_441588.1_4 Reverse -313 -323 6.96153 0.178
NP_442687.1_7 Forward -321 -311 15.8113 0.0125
NP_442687.1_7 Reverse -310 -320 9.02648 0.0994
NP_442687.1_7 Forward -183 -173 9.02648 0.0994
NP_442687.1_7 Reverse -172 -182 8.92815 0.0994
NP_442485.1_3 Forward -325 -306 5.99764 0.167
NP_442485.1_3 Forward -96 -77 -4.91709 0.286
NP_441013.1_2 Forward -325 -307 0.0191479 0.254
NP_440042.1_2 Forward -330 -311 -0.983855 0.233
NP_441422.1_7 Forward -322 -305 -1.82945 0.194
NP_441763.1_10 Forward -331 -312 14.6499 0.121
NP_442658.1_1 Forward -322 -312 18.7607 0.00222
NP_442658.1_1 Reverse -309 -319 13.0576 0.04
NP_442658.1_1 Forward -184 -174 13.0576 0.04
NP_442658.1_1 Reverse -171 -181 6.76441 0.214
NP_442198.1_7 Forward -323 -304 10.1267 0.248
NP_440141.1_8 Reverse -158 -177 7.47261 0.24
NP_441855.2_4 Reverse -112 -131 14.5362 0.149
NP_442782.1_2 Forward -320 -306 11.2093 0.173
NP_442205.1_9 Forward -188 -172 -3.08806 0.278
NP_442544.1_2 Forward -137 -123 -1.18038 0.272
NP_441414.1_9 Reverse -311 -330 4.81767 0.0516
NP_441414.1_9 Forward -94 -75 -9.14533 0.254
NP_441414.1_9 Forward -182 -163 -10.7186 0.293
NP_440184.1_1 Forward -61 -42 5.46015 0.213
NP_440607.1_8 Forward -131 -112 -0.885524 0.292
NP_442937.1_5 Forward -187 -168 7.17762 0.26
NP_442937.1_5 Reverse -338 -357 7.17762 0.26
NP_441958.1_5 Reverse -310 -320 21.2195 0.000805
NP_441958.1_5 Forward -183 -173 21.2195 0.000805
NP_441958.1_5 Forward -321 -311 12.2714 0.00183
NP_441958.1_5 Reverse -172 -182 12.2714 0.00183
NP_441958.1_5 Forward -95 -85 0.275027 0.162
NP_442836.1_5 Reverse -79 -98 7.66927 0.157
NP_442836.1_5 Reverse -167 -186 1.27776 0.287
NP_440203.1_5 Forward -317 -307 14.9258 0.0886
NP_440203.1_5 Forward -179 -169 10.9926 0.206
NP_440203.1_5 Reverse -123 -133 10.796 0.213
NP_442025.1_4 Forward -20 -1 13.9625 0.272
NP_439905.1_1 Forward -181 -168 10.049 0.216
NP_439905.1_1 Reverse -312 -325 9.75405 0.216
NP_440984.1_7 Reverse -168 -182 11.2093 0.122
NP_440984.1_7 Forward -325 -311 10.226 0.126
NP_439990.1_5 Reverse -168 -181 8.9674 0.155
NP_439990.1_5 Forward -325 -312 8.47575 0.17
NP_439990.1_5 Reverse -306 -319 8.18076 0.18
NP_439990.1_5 Forward -187 -174 6.90245 0.22
NP_442911.1_2 Forward -330 -311 0.294447 0.0682
NP_442911.1_2 Reverse -75 -94 -3.3438 0.111
NP_442911.1_2 Reverse -163 -182 -4.81876 0.142
NP_441580.1_6 Reverse -300 -319 -4.91709 0.235
NP_441580.1_6 Forward -331 -312 -5.01543 0.235
NP_441591.1_10 Reverse -309 -328 4.71934 0.297
NP_441941.1_9 Forward -147 -128 2.55606 0.268
NP_442064.1_1 Reverse -168 -187 -11.1119 0.259
NP_440993.1_2 Reverse -306 -322 12.3499 0.0735
NP_441099.1_5 Reverse -301 -320 -0.0988766 0.0887
NP_441099.1_5 Forward -330 -311 -5.50708 0.152
NP_441099.1_5 Reverse -163 -182 -10.0303 0.24
NP_441099.1_5 Forward -192 -173 -11.5053 0.283
NP_442002.1_9 Forward -321 -314 10.7572 0.185
NP_440809.1_9 Reverse -76 -94 -7.94566 0.225
NP_441294.1_7 Forward -186 -172 17.8896 0.00674
NP_441294.1_7 Forward -98 -84 16.3538 0.0156
NP_441294.1_7 Reverse -88 -102 11.1704 0.153
NP_441646.1_1 Forward -189 -170 -0.885524 0.273
NP_442438.1_10 Reverse -306 -320 10.7177 0.0491
NP_442438.1_10 Forward -325 -311 2.85119 0.168
NP_442438.1_10 Forward -187 -173 0.196253 0.236
NP_442885.1_5 Reverse -313 -332 15.6332 0.216
NP_441000.1_6 Reverse -310 -324 -3.34366 0.221
NP_442771.1_1 Forward -322 -304 -4.99573 0.166
NP_440147.1_4 Forward -96 -83 15.9489 0.0141
NP_440147.1_4 Forward -184 -171 12.999 0.0326
NP_440147.1_4 Reverse -309 -322 11.819 0.0326
NP_440147.1_4 Reverse -171 -184 10.8357 0.0353
NP_440147.1_4 Forward -322 -309 2.77255 0.202
NP_441175.1_7 Reverse -173 -192 5.01433 0.294
NP_441550.1_8 Forward -184 -174 15.3192 0.0132
NP_441550.1_8 Reverse -171 -181 14.6309 0.0132
NP_441550.1_8 Reverse -83 -93 13.2542 0.0267
NP_441550.1_8 Reverse -309 -319 13.0576 0.0273
NP_441550.1_8 Forward -322 -312 10.501 0.066
NP_441550.1_8 Forward -96 -86 8.23937 0.127
NP_441916.1_7 Forward -320 -310 18.9579 0.00144
NP_441916.1_7 Reverse -173 -183 18.9579 0.00144
NP_441916.1_7 Reverse -311 -321 18.4663 0.00144
NP_441916.1_7 Forward -182 -172 10.3048 0.0261
NP_440465.1_4 Forward -321 -302 11.8975 0.217
NP_441041.1_4 Reverse -173 -192 3.73603 0.0627
NP_441041.1_4 Forward -320 -301 1.57275 0.0804
NP_441041.1_4 Reverse -311 -330 -1.57384 0.101
NP_441041.1_4 Forward -116 -97 -9.93197 0.226
NP_441041.1_4 Reverse -121 -140 -12.1936 0.26
NP_441041.1_7 Forward -323 -311 19.5648 0.00277
NP_441041.1_7 Forward -185 -173 17.7184 0.00706
NP_441041.1_7 Reverse -308 -320 6.34865 0.211
NP_442642.1_9 Forward -189 -172 5.84037 0.192
NP_442396.1_5 Reverse -169 -182 11.7207 0.0913
NP_441547.1_2 Reverse -300 -318 14.8671 0.0948
NP_442004.1_6 Forward -320 -306 16.3225 0.0577
NP_442004.1_6 Forward -182 -168 7.47274 0.159
NP_442004.1_6 Reverse -173 -187 6.88276 0.17
NP_441725.1_4 Reverse -306 -320 12.2903 0.0693
NP_441725.1_4 Forward -187 -173 3.04726 0.279
NP_441725.1_5 Forward -319 -309 11.1898 0.0247
NP_441725.1_5 Reverse -312 -322 9.02648 0.0553
NP_441725.1_5 Forward -181 -171 2.04498 0.115
NP_441725.1_5 Reverse -174 -184 1.94665 0.115
NP_439966.1_7 Forward -322 -312 17.4824 0.00636
NP_439966.1_7 Reverse -309 -319 14.8275 0.0177
NP_439966.1_7 Reverse -119 -129 10.1076 0.0968
NP_439966.1_7 Reverse -171 -181 7.25606 0.15
NP_439966.1_7 Forward -184 -174 6.27276 0.185
NP_439966.1_7 Reverse -83 -93 4.01116 0.295
NP_439966.1_9 Forward -322 -313 10.7178 0.0863
NP_439966.1_9 Reverse -191 -200 6.39124 0.253
NP_442941.1_3 Forward -319 -309 19.9412 0.00262
NP_442941.1_3 Forward -181 -171 11.0914 0.0116
NP_442941.1_3 Reverse -174 -184 11.0914 0.0116
NP_442941.1_3 Reverse -312 -322 2.53664 0.14
NP_442941.1_3 Forward -93 -83 -1.29827 0.297
NP_440289.1_2 Forward -323 -310 12.9006 0.0132
NP_440289.1_2 Forward -185 -172 4.64084 0.0657
NP_440289.1_2 Reverse -308 -321 -2.83231 0.262
NP_440983.1_5 Forward -179 -160 -1.47551 0.228
NP_442281.1_1 Forward -187 -173 16.2235 0.0087
NP_442281.1_1 Reverse -306 -320 15.6336 0.0113
NP_442281.1_1 Forward -325 -311 9.04542 0.0747
NP_441334.1_7 Forward -322 -303 -9.83364 0.12
NP_440437.1_1 Reverse -305 -324 3.83436 0.115
NP_440437.1_1 Forward -188 -169 -1.18052 0.196
NP_441556.1_6 Reverse -30 -48 12.384 0.299
NP_441556.1_10 Reverse -168 -182 17.6194 0.0841
NP_441644.1_6 Forward -320 -310 19.0557 0.000803
NP_441644.1_6 Reverse -173 -183 19.0557 0.000803
NP_441644.1_6 Forward -182 -172 17.3841 0.00127
NP_441644.1_6 Reverse -311 -321 10.1076 0.0628
NP_441644.1_6 Reverse -85 -95 7.25606 0.132
NP_441644.1_6 Reverse -361 -371 6.96107 0.141
NP_441644.1_6 Forward -94 -84 4.50281 0.235
NP_442215.1_2 Reverse -171 -187 9.39998 0.0582
NP_442215.1_2 Forward -322 -306 3.79511 0.0918
NP_442215.1_2 Reverse -83 -99 -0.138127 0.162
NP_442215.1_2 Forward -184 -168 -3.97304 0.225
NP_442215.1_2 Forward -144 -128 -4.85801 0.24
NP_442215.1_2 Reverse -118 -134 -5.54633 0.251
NP_440253.1_2 Reverse -311 -329 6.31233 0.0823
NP_440929.1_8 Forward -320 -311 19.2726 0.000701
NP_440929.1_8 Reverse -311 -320 19.2726 0.000701
NP_440929.1_8 Forward -182 -173 19.2726 0.000701
NP_440929.1_8 Reverse -173 -182 19.2726 0.000701
NP_440929.1_8 Reverse -85 -94 6.68623 0.0887
NP_442933.1_10 Forward -320 -311 17.601 0.00325
NP_442933.1_10 Reverse -311 -320 17.601 0.00325
NP_442933.1_10 Forward -182 -173 17.601 0.00325
NP_442933.1_10 Reverse -173 -182 17.601 0.00325
NP_442933.1_10 Reverse -85 -94 4.42462 0.246
NP_441751.2_8 Forward -319 -305 6.58777 0.0348
NP_441751.2_8 Reverse -312 -326 1.76955 0.0968
NP_441751.2_8 Reverse -174 -188 -4.52363 0.174
NP_441751.2_8 Forward -181 -167 -4.7203 0.179
NP_442554.1_8 Forward -319 -309 16.9913 0.0065
NP_442554.1_8 Reverse -174 -184 16.4013 0.0065
NP_442554.1_8 Reverse -312 -322 16.008 0.0065
NP_442554.1_8 Forward -181 -171 15.3197 0.00882
NP_442554.1_8 Forward -93 -83 5.97822 0.13
NP_441762.1_7 Reverse -310 -322 12.527 0.0142
NP_441762.1_7 Forward -321 -309 2.20226 0.0676
NP_441762.1_7 Forward -183 -171 0.530633 0.0747
NP_441762.1_7 Reverse -172 -184 0.333971 0.0747
NP_442142.1_4 Reverse -308 -321 17.4232 0.0264
NP_442142.1_4 Forward -323 -310 14.4733 0.0311
NP_442142.1_4 Forward -185 -172 10.3434 0.0744
NP_442142.1_4 Reverse -170 -183 3.65697 0.248
NP_442142.1_9 Forward -327 -308 0.491109 0.294
NP_442292.1_1 Forward -181 -172 18.486 0.00229
NP_442292.1_1 Forward -319 -310 17.5026 0.00435
NP_442292.1_1 Reverse -174 -183 17.5026 0.00435
NP_442292.1_1 Reverse -312 -321 9.63616 0.0183
NP_442292.1_1 Reverse -86 -95 -0.786921 0.287
NP_442476.1_6 Forward -181 -167 5.99778 0.13
NP_440895.1_6 Reverse -76 -89 13.4906 0.202
NP_440895.1_6 Reverse -167 -180 11.819 0.202
NP_440421.1_1 Forward -266 -252 15.5359 0.19
NP_442381.1_8 Forward -323 -304 -13.3736 0.271
NP_441523.1_6 Forward -186 -167 9.14423 0.18
NP_443009.1_5 Reverse -310 -321 19.626 0.00102
NP_443009.1_5 Reverse -172 -183 14.5128 0.02
NP_443009.1_5 Forward -183 -172 10.1862 0.0792
NP_443009.1_5 Forward -321 -310 7.82632 0.118
NP_443009.1_5 Forward -203 -192 3.5981 0.286
NP_441715.1_4 Forward -319 -309 14.238 0.0295
NP_441715.1_4 Reverse -312 -322 9.32148 0.097
NP_441715.1_4 Forward -181 -171 7.94484 0.107
NP_441715.1_4 Reverse -174 -184 7.35486 0.108
NP_441198.1_8 Reverse -309 -319 13.2713 0.108
NP_441198.1_8 Forward -184 -174 12.783 0.116
NP_440379.1_5 Reverse -302 -321 4.916 0.133
NP_440379.1_5 Reverse -311 -330 -6.88371 0.24
NP_440464.1_10 Forward -181 -171 13.0082 0.169
NP_441468.1_1 Forward -319 -312 15.8704 0.0124
NP_441468.1_1 Reverse -312 -319 15.8704 0.0124
NP_441468.1_1 Forward -181 -174 15.8704 0.0124
NP_441468.1_1 Reverse -174 -181 15.8704 0.0124
NP_441618.1_6 Forward -313 -294 7.47261 0.3
NP_441020.2_6 Forward -322 -305 12.8219 0.0847
NP_441020.2_6 Reverse -309 -326 10.3636 0.146
NP_441020.2_6 Reverse -171 -188 9.67528 0.165
NP_441015.1_10 Forward -307 -288 -4.32711 0.202
NP_441673.1_1 Forward -320 -311 20.8459 0.000698
NP_441673.1_1 Reverse -311 -320 20.8459 0.000698
NP_441673.1_1 Forward -182 -173 20.8459 0.000698
NP_441673.1_1 Reverse -173 -182 20.8459 0.000698
NP_441673.1_1 Forward -94 -85 1.37636 0.114
NP_441673.1_1 Reverse -85 -94 1.1797 0.163
NP_441426.1_6 Reverse -73 -92 13.8641 0.216
NP_441826.1_2 Reverse -305 -319 -2.75368 0.275
NP_441826.1_2 Forward -188 -174 -3.63866 0.286
NP_441637.1_9 Reverse -8 -26 -1.75081 0.292
NP_442490.1_6 Forward -365 -346 17.7974 0.241
NP_442490.1_9 Reverse -299 -318 -2.85214 0.219
NP_442490.1_9 Forward -332 -313 -2.85214 0.219
NP_441764.1_8 Forward -47 -37 11.7892 0.284
NP_442868.1_6 Reverse -171 -181 9.81313 0.038
NP_442868.1_6 Forward -322 -312 8.53483 0.0555
NP_442868.1_6 Reverse -309 -319 1.06167 0.205
NP_442868.1_6 Forward -184 -174 0.963343 0.205
NP_441056.1_1 Forward -320 -301 -3.04881 0.224
NP_441612.1_2 Forward -182 -172 8.54929 0.21
NP_442361.1_3 Forward -188 -175 13.589 0.14
NP_442361.1_3 Reverse -305 -318 8.37742 0.285
NP_442808.1_1 Forward -321 -311 18.4657 0.00201
NP_442808.1_1 Reverse -310 -320 8.73102 0.0481
NP_442808.1_1 Forward -183 -173 8.73102 0.0481
NP_442808.1_1 Reverse -172 -182 8.63269 0.0481
NP_440145.1_3 Forward -192 -173 16.1257 0.00993
NP_440145.1_3 Forward -104 -85 2.45773 0.118
NP_442542.1_2 Forward -322 -309 12.3107 0.114
NP_442542.1_9 Forward -327 -313 10.9137 0.111
NP_442050.1_1 Forward -122 -103 6.88262 0.281
NP_442050.1_5 Reverse -309 -319 18.0724 0.00365
NP_442050.1_5 Forward -184 -174 9.22267 0.193
NP_442050.1_5 Forward -322 -312 8.23937 0.234
NP_442050.1_5 Reverse -171 -181 7.64939 0.243
NP_442050.1_8 Forward -326 -307 13.5987 0.272
NP_442903.1_2 Forward -65 -46 5.29938 0.196
NP_442342.1_9 Forward -322 -306 19.9214 0.0512
NP_442342.1_9 Reverse -171 -187 4.48343 0.249
NP_440558.1_2 Reverse -302 -321 7.66927 0.118
NP_440558.1_2 Reverse -290 -309 2.85105 0.164
NP_442789.1_4 Forward -337 -318 19.8623 0.0361
NP_442789.1_4 Forward -322 -303 1.57275 0.185
NP_441518.1_3 Forward -330 -311 -6.1954 0.132
NP_441878.1_6 Reverse -310 -320 10.5014 0.0176
NP_441878.1_6 Forward -183 -173 10.5014 0.0176
NP_441878.1_6 Forward -321 -311 10.4031 0.0176
NP_441878.1_6 Reverse -172 -182 10.4031 0.0176
NP_441036.1_8 Forward -321 -311 17.7779 0.000554
NP_441036.1_8 Reverse -310 -320 15.713 0.00724
NP_441036.1_8 Forward -183 -173 15.713 0.00724
NP_441036.1_8 Reverse -172 -182 8.33817 0.174
NP_442650.1_2 Forward -320 -306 6.88276 0.13
NP_441557.1_5 Forward -320 -311 19.9609 0.000699
NP_441557.1_5 Reverse -311 -320 19.9609 0.000699
NP_441557.1_5 Forward -182 -173 19.9609 0.000699
NP_441557.1_5 Reverse -173 -182 19.9609 0.000699
NP_441557.1_5 Forward -94 -85 0.491382 0.144
NP_441557.1_5 Reverse -85 -94 0.29472 0.174
NP_441445.1_1 Reverse -76 -95 9.93088 0.0994
NP_441445.1_1 Reverse -164 -183 8.16093 0.122
NP_441445.1_1 Forward -103 -84 1.17943 0.259
NP_441445.1_1 Forward -329 -310 -0.197208 0.286
NP_442066.2_4 Forward -363 -344 -0.4922 0.173
NP_442066.2_4 Reverse -173 -192 -8.35868 0.294
NP_442066.2_9 Forward -324 -311 17.9155 0.0209
NP_441308.1_8 Reverse -309 -319 13.353 0.218
NP_441308.1_8 Forward -322 -312 9.22315 0.226
NP_440101.1_3 Forward -325 -306 8.35759 0.164
NP_440101.1_3 Reverse -168 -187 2.0644 0.259
NP_441458.1_10 Reverse -302 -321 6.68596 0.197
NP_441458.1_10 Forward -191 -172 6.58763 0.197
NP_442183.1_1 Forward -320 -306 16.0275 0.0167
NP_442183.1_1 Reverse -311 -325 12.8809 0.05
NP_442183.1_1 Reverse -173 -187 9.2427 0.0999
NP_441819.1_5 Reverse -35 -54 9.7875 0.261
NP_441549.1_9 Forward -324 -306 3.85406 0.0925
NP_441549.1_9 Reverse -169 -187 -3.32411 0.198
NP_440540.1_2 Forward -106 -87 8.75091 0.252
NP_442347.1_2 Reverse -86 -95 12.5861 0.056
NP_442347.1_2 Forward -181 -172 12.4878 0.056
NP_442347.1_2 Reverse -312 -321 11.1111 0.056
NP_442347.1_2 Forward -358 -349 6.68623 0.156
NP_442347.1_2 Forward -319 -310 3.34298 0.284
NP_442347.1_2 Reverse -174 -183 3.34298 0.284
NP_442347.1_10 Reverse -148 -162 16.3219 0.183
NP_442645.1_2 Forward -190 -171 -3.14714 0.0487
NP_442645.1_2 Reverse -165 -184 -12.3902 0.144
NP_442645.1_2 Forward -322 -303 -18.0934 0.269
NP_440547.1_8 Forward -364 -345 11.9958 0.298
NP_441037.1_4 Forward -322 -312 16.2838 0.0168
NP_441037.1_4 Forward -184 -174 15.0168 0.028
NP_441037.1_4 Reverse -171 -181 7.9999 0.237
NP_441037.1_4 Reverse -309 -319 7.31769 0.237
NP_442594.1_2 Forward -290 -271 11.5042 0.222
NP_441633.1_3 Reverse -309 -322 3.95252 0.0699
NP_441633.1_3 Reverse -171 -184 1.10092 0.109
NP_441633.1_3 Reverse -90 -103 -0.0790467 0.138
NP_441633.1_3 Forward -96 -83 -1.06236 0.152
NP_441633.1_3 Forward -322 -309 -3.91395 0.177
NP_441633.1_3 Forward -184 -171 -5.97891 0.236
NP_441633.1_3 Forward -132 -119 -6.66722 0.265
NP_440136.1_2 Forward -319 -312 15.9687 0.0123
NP_440136.1_2 Reverse -312 -319 15.9687 0.0123
NP_440136.1_2 Forward -181 -174 15.9687 0.0123
NP_440136.1_2 Reverse -174 -181 15.9687 0.0123
NP_442590.1_10 Forward -327 -308 5.89931 0.257
NP_442998.1_5 Forward -46 -36 8.4365 0.263
NP_442998.1_10 Forward -318 -311 15.5754 0.0102
NP_442998.1_10 Reverse -313 -320 15.5754 0.0102
NP_442998.1_10 Forward -180 -173 15.5754 0.0102
NP_442998.1_10 Reverse -175 -182 15.5754 0.0102
NP_442998.1_10 Reverse -87 -94 5.93897 0.206
NP_440731.1_2 Forward -121 -102 6.88262 0.293
NP_440299.1_1 Reverse -307 -320 13.195 0.0319
NP_440299.1_1 Reverse -169 -182 10.2451 0.058
NP_440299.1_1 Reverse -289 -302 5.13193 0.187
NP_440299.1_1 Forward -186 -173 4.93527 0.193
NP_441799.1_1 Reverse -169 -183 20.5501 0.00485
NP_441799.1_1 Forward -324 -310 12.2903 0.0441
NP_441799.1_1 Reverse -307 -321 9.04542 0.1
NP_441799.1_1 Forward -186 -172 8.16044 0.122
NP_442802.1_6 Reverse -310 -329 7.86593 0.0979
NP_441007.1_10 Forward -325 -312 5.72248 0.18
NP_441007.1_10 Forward -187 -174 4.54251 0.182
NP_441007.1_10 Reverse -306 -319 3.36254 0.182
NP_441007.1_10 Reverse -168 -181 1.59258 0.203
NP_442201.1_10 Forward -193 -174 -13.9635 0.28
NP_440256.1_1 Reverse -308 -327 1.57275 0.0733
NP_440256.1_1 Forward -323 -304 -0.4922 0.0936
NP_440256.1_1 Reverse -170 -189 -1.67217 0.106
NP_440256.1_1 Forward -185 -166 -8.752 0.266
NP_441229.1_10 Forward -192 -173 -4.91709 0.288
NP_441559.1_8 Reverse -306 -320 1.27789 0.156
NP_441559.1_8 Forward -325 -311 -6.29359 0.276
NP_441559.1_8 Reverse -168 -182 -6.88358 0.281
NP_441559.1_8 Forward -187 -173 -7.57189 0.295
NP_440915.1_6 Forward -324 -310 15.3392 0.0183
NP_440915.1_6 Forward -186 -172 4.42448 0.0953
NP_440915.1_6 Reverse -307 -321 3.8345 0.1
NP_442785.1_7 Forward -184 -170 17.6008 0.0996
NP_441704.1_8 Reverse -300 -319 11.405 0.141
NP_441704.1_8 Reverse -162 -181 8.55343 0.208
NP_442866.1_1 Forward -325 -306 -1.18052 0.202
NP_440748.1_2 Reverse -73 -92 23.2674 0.0404
NP_441464.1_8 Reverse -311 -325 7.66941 0.206
NP_441464.1_8 Forward -182 -168 6.19444 0.243
NP_441464.1_8 Forward -94 -80 5.21113 0.26
NP_441464.1_10 Forward -372 -358 12.8809 0.201
NP_440787.1_5 Forward -23 -9 8.94771 0.297
NP_440695.1_6 Reverse -248 -262 9.82961 0.276
NP_441939.1_3 Reverse -312 -331 9.24257 0.151
NP_441939.1_3 Reverse -174 -193 5.30933 0.28
NP_441199.1_6 Reverse -307 -326 10.6192 0.0761
NP_441494.1_6 Reverse -306 -319 8.86907 0.227
NP_442957.1_8 Forward -165 -146 7.86593 0.287
NP_442993.1_1 Reverse -311 -327 -0.236458 0.071
NP_442993.1_1 Forward -320 -304 -10.7579 0.226
NP_442993.1_1 Reverse -173 -189 -10.9545 0.231
NP_440677.1_1 Forward -329 -310 10.7175 0.163
NP_442386.1_9 Forward -321 -312 15.7322 0.0144
NP_442386.1_9 Reverse -172 -181 13.8639 0.0289
NP_442386.1_9 Reverse -304 -313 8.84908 0.182
NP_442386.1_9 Reverse -310 -319 6.39082 0.219
NP_442386.1_9 Forward -183 -174 6.39082 0.219
NP_442386.1_9 Reverse -120 -129 5.40752 0.253
NP_441340.1_5 Forward -319 -312 15.6737 0.0124
NP_441340.1_5 Reverse -312 -319 15.6737 0.0124
NP_441340.1_5 Forward -181 -174 15.6737 0.0124
NP_441340.1_5 Reverse -174 -181 15.6737 0.0124
NP_441340.1_9 Forward -47 -37 8.15881 0.256
NP_441271.1_1 Reverse -305 -323 13.4897 0.222
NP_441947.1_10 Forward -322 -304 3.3624 0.276
NP_442484.1_2 Reverse -162 -181 8.45592 0.144
NP_440059.1_3 Reverse -101 -120 11.11 0.17
NP_442240.1_2 Reverse -174 -193 -10.6203 0.137
NP_442240.1_2 Reverse -72 -91 -19.5684 0.295
NP_442714.1_7 Forward -181 -162 7.47261 0.16
NP_440586.1_8 Forward -319 -312 13.2151 0.026
NP_440586.1_8 Forward -181 -174 13.2151 0.026
NP_440586.1_8 Reverse -312 -319 13.2151 0.026
NP_440586.1_8 Reverse -174 -181 13.2151 0.026
NP_440586.1_8 Forward -175 -168 7.1186 0.272
NP_442251.1_6 Forward -319 -312 15.2804 0.0124
NP_442251.1_6 Reverse -312 -319 15.2804 0.0124
NP_442251.1_6 Forward -181 -174 15.2804 0.0124
NP_442251.1_6 Reverse -174 -181 15.2804 0.0124
NP_441262.1_3 Reverse -311 -318 14.7888 0.0223
NP_441262.1_3 Reverse -173 -180 14.7888 0.0223
NP_441262.1_3 Forward -320 -313 14.7888 0.0223
NP_441262.1_3 Forward -182 -175 14.7888 0.0223
NP_441262.1_3 Reverse -193 -200 11.6422 0.0477
NP_440027.1_3 Forward -192 -174 5.32826 0.245
NP_443051.1_1 Reverse -310 -319 19.5676 0.00335
NP_443051.1_1 Forward -183 -174 19.5676 0.00335
NP_443051.1_1 Reverse -172 -181 10.4228 0.00754
NP_443051.1_1 Forward -321 -312 10.4228 0.00754
NP_439984.1_5 Forward -103 -84 20.354 0.086
NP_439937.1_8 Forward -322 -303 4.12936 0.202
NP_439937.1_9 Forward -183 -166 -14.2198 0.287
NP_439937.1_9 Reverse -310 -327 -15.9897 0.287
NP_441595.1_2 Forward -20 -7 8.36957 0.292
NP_440408.1_7 Forward -320 -301 8.65258 0.272
NP_440408.1_7 Forward -121 -102 8.16093 0.282
NP_440408.1_7 Forward -182 -163 6.78429 0.299
NP_440408.1_10 Forward -308 -289 9.73422 0.176
NP_440626.1_1 Reverse -312 -331 11.8967 0.204
NP_440439.1_1 Reverse -308 -321 16.2439 0.0128
NP_440439.1_1 Forward -323 -310 9.36073 0.0465
NP_440439.1_1 Reverse -170 -183 2.2809 0.136
NP_440372.1_2 Forward -319 -312 16.3621 0.0124
NP_440372.1_2 Reverse -312 -319 16.3621 0.0124
NP_440372.1_2 Forward -181 -174 16.3621 0.0124
NP_440372.1_2 Reverse -174 -181 16.3621 0.0124
NP_440372.1_2 Forward -93 -86 4.07068 0.262
NP_441803.1_2 Reverse -306 -325 18.9773 0.0309
NP_441803.1_2 Forward -187 -168 0.58944 0.249
NP_439977.1_5 Forward -326 -307 18.289 0.0361
NP_439977.1_5 Reverse -305 -324 -2.65548 0.287
NP_442384.1_10 Forward -182 -169 17.1289 0.00642
NP_442384.1_10 Forward -320 -307 15.4572 0.00986
NP_442384.1_10 Reverse -173 -186 8.08242 0.0692
NP_442384.1_10 Reverse -85 -98 4.8375 0.145
NP_442384.1_10 Forward -142 -129 1.10092 0.268
NP_442384.1_10 Reverse -311 -324 0.412608 0.291
NP_442114.1_4 Reverse -311 -322 12.1534 0.107
NP_440364.1_6 Forward -321 -308 13.6867 0.275
NP_441018.1_7 Reverse -169 -188 11.2092 0.19
NP_441018.1_7 Forward -324 -305 10.7175 0.199
NP_441018.1_7 Forward -212 -193 8.55425 0.242
NP_442262.1_10 Forward -319 -312 14.1988 0.0123
NP_442262.1_10 Reverse -312 -319 14.1988 0.0123
NP_442262.1_10 Forward -181 -174 14.1988 0.0123
NP_442262.1_10 Reverse -174 -181 14.1988 0.0123
NP_441689.1_5 Reverse -309 -319 17.8758 0.0158
NP_441689.1_5 Forward -184 -174 8.3377 0.132
NP_441689.1_5 Reverse -171 -181 5.78111 0.197
NP_440344.1_10 Reverse -304 -321 8.98696 0.00932
NP_440344.1_10 Forward -327 -310 7.217 0.0146
NP_440344.1_10 Forward -189 -172 2.20212 0.0286
NP_440344.1_10 Reverse -166 -183 -10.1876 0.17
NP_440344.1_10 Reverse -126 -143 -11.6625 0.223
NP_440531.1_6 Reverse -165 -184 7.07928 0.102
NP_440531.1_6 Forward -328 -309 -5.11376 0.293
NP_440189.1_2 Reverse -303 -322 3.83436 0.268
NP_441335.1_8 Reverse -81 -100 6.58763 0.281
NP_441965.1_10 Forward -185 -169 9.59664 0.117
NP_441965.1_10 Forward -323 -307 8.90832 0.123
NP_442529.1_4 Forward -329 -310 12.7825 0.175
NP_440297.1_9 Forward -319 -309 9.22315 0.0917
NP_440297.1_9 Forward -181 -171 -0.118297 0.282
NP_440297.1_9 Reverse -312 -322 -0.216628 0.282
NP_440297.1_9 Reverse -174 -184 -0.216628 0.282
NP_441896.1_3 Forward -329 -310 15.0441 0.0527
NP_441896.1_3 Reverse -164 -183 6.68596 0.1
NP_440894.1_10 Forward -325 -306 21.4356 0.0278
NP_440894.1_10 Reverse -168 -187 7.17762 0.208
NP_440999.1_9 Forward -324 -310 18.0925 0.0163
NP_440999.1_9 Forward -186 -172 4.32615 0.116
NP_440999.1_9 Reverse -81 -95 0.294584 0.189
NP_440999.1_9 Reverse -169 -183 -3.34366 0.291
NP_440888.1_2 Reverse -311 -325 15.6336 0.00976
NP_440888.1_2 Forward -320 -306 14.8469 0.0144
NP_440888.1_2 Reverse -173 -187 9.34041 0.13
NP_440888.1_2 Forward -182 -168 7.3738 0.198
NP_440888.1_2 Reverse -293 -307 6.19383 0.243
NP_440888.1_2 Reverse -85 -99 6.19383 0.243
NP_440600.1_4 Forward -190 -172 -4.70074 0.268
NP_441748.1_3 Reverse -77 -96 23.1463 0.0111
NP_442948.1_2 Forward -321 -302 12.5858 0.121
NP_442277.1_4 Forward -329 -310 2.75194 0.239
NP_442033.1_10 Forward -322 -303 -8.85033 0.207
NP_441543.1_2 Reverse -312 -321 18.486 0.00236
NP_441543.1_2 Forward -181 -172 16.9127 0.00359
NP_441543.1_2 Forward -319 -310 15.9293 0.00518
NP_441543.1_2 Reverse -174 -183 15.9293 0.00518
NP_441543.1_2 Forward -93 -84 4.52295 0.234
NP_442845.1_2 Reverse -305 -319 14.8476 0.0774
NP_442845.1_2 Reverse -167 -181 13.2743 0.0955
NP_442845.1_2 Forward -320 -306 6.98109 0.199
NP_442845.1_2 Forward -188 -174 5.40779 0.233
NP_440380.1_5 Forward -307 -288 6.19431 0.236
NP_441551.1_5 Forward -324 -308 13.8241 0.119
NP_441469.1_8 Forward -321 -312 16.126 0.00797
NP_441469.1_8 Reverse -310 -319 6.5879 0.227
NP_441469.1_8 Forward -183 -174 6.5879 0.227
NP_441469.1_8 Reverse -172 -181 6.48957 0.227
NP_442637.1_1 Forward -137 -118 -9.83364 0.249
NP_443064.1_6 Forward -94 -84 15.2817 0.0796
NP_443064.1_6 Forward -182 -172 12.5669 0.0796
NP_443064.1_6 Reverse -133 -143 12.1791 0.0975
NP_443064.1_6 Forward -320 -310 10.8217 0.13
NP_443064.1_6 Reverse -173 -183 10.8217 0.13
NP_442578.1_7 Forward -319 -312 14.5921 0.026
NP_442578.1_7 Forward -181 -174 14.5921 0.026
NP_442578.1_7 Reverse -312 -319 14.5921 0.026
NP_442578.1_7 Reverse -174 -181 14.5921 0.026
NP_440710.1_1 Forward -190 -172 -3.22577 0.208
NP_440220.1_4 Reverse -292 -311 -2.45958 0.271
NP_441462.1_2 Forward -320 -310 20.2362 0.000805
NP_441462.1_2 Reverse -173 -183 20.2362 0.000805
NP_441462.1_2 Reverse -311 -321 11.5831 0.00406
NP_441462.1_2 Forward -182 -172 11.5831 0.00406
NP_441462.1_2 Forward -94 -84 0.0783647 0.168
NP_441621.1_7 Forward -322 -308 13.9626 0.0266
NP_441621.1_7 Reverse -309 -323 -3.24533 0.188
NP_441621.1_7 Forward -331 -317 -4.91696 0.248
NP_443062.1_1 Reverse -173 -191 6.98581 0.188
NP_443062.1_1 Reverse -311 -329 6.10824 0.209
NP_443062.1_6 Forward -328 -309 3.24438 0.243
NP_441601.1_2 Forward -100 -81 -4.6221 0.286
NP_440939.1_1 Reverse -53 -66 18.4072 0.183
NP_442204.1_1 Reverse -307 -318 19.2332 0.0136
NP_442204.1_1 Forward -186 -175 8.90846 0.0852
NP_442204.1_5 Forward -192 -173 3.6377 0.186
NP_441560.1_8 Reverse -306 -325 19.6933 0.0119
NP_441560.1_10 Forward -102 -83 8.94757 0.235
NP_440544.1_2 Forward -132 -113 10.5209 0.166
NP_440516.1_2 Reverse -167 -185 6.01734 0.122
NP_440516.1_2 Forward -188 -170 1.39578 0.198
NP_440516.1_8 Forward -320 -311 16.9127 0.00442
NP_440516.1_8 Reverse -311 -320 16.9127 0.00442
NP_440516.1_8 Forward -182 -173 16.9127 0.00442
NP_440516.1_8 Reverse -173 -182 16.9127 0.00442
NP_440516.1_8 Forward -94 -85 7.17789 0.0754
NP_440516.1_8 Reverse -85 -94 5.01461 0.118
NP_442428.1_5 Forward -319 -312 15.8704 0.0124
NP_442428.1_5 Reverse -312 -319 15.8704 0.0124
NP_442428.1_5 Forward -181 -174 15.8704 0.0124
NP_442428.1_5 Reverse -174 -181 15.8704 0.0124
NP_442120.1_10 Forward -326 -307 -14.2585 0.288
NP_441867.1_2 Forward -164 -145 -13.3736 0.277
NP_440673.1_2 Forward -192 -173 15.1696 0.0942
NP_440673.1_3 Forward -318 -311 12.4288 0.0426
NP_440673.1_3 Forward -180 -173 12.4288 0.0426
NP_440673.1_3 Reverse -313 -320 12.4288 0.0426
NP_440673.1_3 Reverse -175 -182 12.4288 0.0426
NP_440673.1_3 Reverse -87 -94 10.1672 0.149
NP_440673.1_4 Forward -105 -86 14.7491 0.157
NP_441714.1_3 Reverse -78 -96 13.4897 0.237
NP_440865.1_9 Reverse -305 -324 -3.93378 0.201
NP_441052.1_2 Forward -182 -172 19.9412 0.00106
NP_441052.1_2 Reverse -311 -321 10.5014 0.0285
NP_441052.1_2 Forward -320 -310 10.4031 0.0285
NP_441052.1_2 Reverse -173 -183 10.4031 0.0285
NP_441052.1_2 Reverse -85 -95 7.84651 0.0605
NP_441052.1_2 Forward -94 -84 7.35486 0.0742
NP_441052.1_2 Forward -352 -342 1.455 0.244
NP_442219.1_9 Forward -181 -172 17.7976 0.00718
NP_442219.1_9 Reverse -312 -321 8.35786 0.0681
NP_442219.1_9 Forward -319 -310 8.25953 0.0681
NP_442219.1_9 Reverse -174 -183 8.25953 0.0681
NP_442219.1_9 Reverse -86 -95 4.71961 0.198
NP_440592.1_2 Forward -106 -87 -0.295539 0.271
NP_440436.1_4 Reverse -312 -321 18.1905 0.00233
NP_440436.1_4 Forward -181 -172 17.2072 0.00233
NP_440436.1_4 Forward -319 -310 9.24241 0.0871
NP_440436.1_4 Reverse -174 -183 9.24241 0.0871
NP_441884.1_9 Forward -323 -304 -12.8819 0.138
NP_441884.1_9 Forward -185 -166 -13.6686 0.138
NP_441884.1_9 Forward -97 -78 -21.9284 0.272
NP_441884.1_9 Reverse -308 -327 -22.9117 0.284
NP_440314.1_9 Forward -181 -162 -0.295539 0.106
NP_440577.1_8 Reverse -102 -121 19.8614 0.138
NP_441719.1_4 Forward -319 -312 16.3621 0.0124
NP_441719.1_4 Reverse -312 -319 16.3621 0.0124
NP_441719.1_4 Forward -181 -174 16.3621 0.0124
NP_441719.1_4 Reverse -174 -181 16.3621 0.0124
NP_441733.1_10 Forward -323 -310 10.5407 0.106
NP_441733.1_10 Reverse -308 -321 5.91914 0.203
NP_442366.1_3 Forward -321 -303 6.11567 0.0819
NP_442366.1_3 Forward -102 -84 -1.94747 0.219
NP_442366.1_3 Reverse -172 -190 -4.50408 0.272
NP_442366.1_3 Reverse -192 -210 -5.88071 0.298
NP_442366.1_5 Reverse -170 -180 17.2858 0.0141
NP_442366.1_5 Forward -185 -175 14.8275 0.0375
NP_442366.1_5 Forward -97 -87 13.9425 0.0549
NP_442873.1_3 Forward -330 -311 6.88182 0.22
NP_441115.1_4 Reverse -310 -328 10.2448 0.183
NP_442694.1_8 Reverse -37 -55 11.4255 0.269
NP_442206.1_10 Forward -320 -305 4.69978 0.178
NP_440328.1_4 Forward -188 -169 2.55606 0.199
NP_443054.1_2 Reverse -309 -323 21.7307 0.00482
NP_443054.1_2 Reverse -171 -185 1.67122 0.245
NP_442430.1_4 Forward -322 -303 19.174 0.137
NP_442430.1_10 Forward -330 -311 9.53674 0.287
NP_441966.1_7 Reverse -301 -320 12.1917 0.152
NP_441851.1_10 Forward -321 -311 16.008 0.00552
NP_441851.1_10 Reverse -172 -182 15.8113 0.00552
NP_441851.1_10 Forward -150 -140 11.5831 0.0685
NP_441851.1_10 Reverse -310 -320 8.53483 0.114
NP_441851.1_10 Forward -183 -173 8.53483 0.114
NP_442622.1_1 Reverse -310 -329 -11.1119 0.257
NP_442622.1_5 Forward -322 -303 16.2241 0.00871
NP_442515.1_1 Forward -95 -81 9.93102 0.058
NP_442515.1_1 Forward -183 -169 2.45787 0.135
NP_442515.1_1 Reverse -310 -324 -2.06536 0.268
NP_440593.1_3 Forward -319 -300 -2.45882 0.226
NP_440593.1_3 Forward -134 -115 -4.81876 0.253
NP_440593.1_3 Forward -187 -168 -6.09707 0.27
NP_440165.1_5 Reverse -120 -139 -7.86702 0.281
NP_442709.1_7 Forward -26 -7 13.0766 0.278
NP_440940.1_7 Forward -330 -312 8.96649 0.167
NP_441349.1_10 Forward -192 -173 5.70265 0.0416
NP_441349.1_10 Reverse -301 -320 -1.96717 0.112
NP_441349.1_10 Forward -104 -85 -2.55715 0.121
NP_441409.1_6 Reverse -305 -324 0.58944 0.0648
NP_441409.1_6 Reverse -167 -186 0.58944 0.0648
NP_441409.1_6 Forward -326 -307 -14.4552 0.257
NP_440432.1_9 Reverse -312 -327 0.864876 0.156
NP_440432.1_9 Reverse -174 -189 -4.34667 0.207
NP_439960.1_4 Forward -321 -302 12.0933 0.294
NP_439960.1_6 Reverse -305 -324 10.1275 0.22
NP_439960.1_10 Reverse -304 -322 4.44404 0.161
NP_440474.1_8 Reverse -312 -326 16.9119 0.0468
NP_441150.1_4 Reverse -326 -345 17.2065 0.149
NP_441124.1_5 Reverse -386 -396 10.7163 0.286
NP_440431.1_3 Forward -183 -164 -4.03212 0.178
NP_442450.1_5 Reverse -309 -319 9.41981 0.115
NP_442450.1_5 Forward -184 -174 7.64985 0.13
NP_442450.1_5 Reverse -171 -181 7.55152 0.13
NP_440588.1_2 Reverse -302 -321 14.2574 0.0171
NP_440588.1_2 Forward -132 -113 -1.96717 0.158
NP_441570.1_1 Forward -320 -302 1.10079 0.0331
NP_441570.1_1 Reverse -173 -191 0.314141 0.0395
NP_441570.1_1 Reverse -311 -329 -15.7138 0.233
NP_440078.1_8 Reverse -6 -25 3.14605 0.257
NP_440078.1_10 Reverse -121 -140 3.73603 0.26
NP_441078.1_4 Forward -320 -311 19.6659 0.0007
NP_441078.1_4 Reverse -311 -320 19.6659 0.0007
NP_441078.1_4 Forward -182 -173 19.6659 0.0007
NP_441078.1_4 Reverse -173 -182 19.6659 0.0007
NP_441078.1_4 Forward -94 -85 0.393051 0.205
NP_441078.1_4 Reverse -85 -94 -0.000272808 0.205
NP_442729.1_8 Forward -324 -311 9.75405 0.125
NP_440526.1_3 Reverse -312 -323 11.7595 0.0646
NP_440526.1_3 Reverse -194 -205 7.03967 0.168
NP_440526.1_3 Reverse -174 -185 1.92649 0.267
NP_440526.1_3 Forward -181 -170 0.943182 0.267
NP_441432.1_8 Reverse -310 -319 16.8143 0.00595
NP_441432.1_8 Reverse -172 -181 16.8143 0.00595
NP_441432.1_8 Forward -183 -174 16.8143 0.00595
NP_441432.1_8 Forward -95 -86 11.0128 0.0629
NP_441432.1_8 Forward -321 -312 8.25953 0.0755
NP_441432.1_8 Forward -130 -121 2.55633 0.298
NP_442320.1_8 Reverse -305 -319 7.27608 0.0204
NP_442320.1_8 Forward -326 -312 -1.37704 0.0817
NP_442320.1_8 Forward -188 -174 -1.5737 0.0821
NP_442344.1_7 Reverse -312 -331 -7.76869 0.191
NP_441732.1_2 Forward -186 -170 12.5466 0.00448
NP_441732.1_2 Reverse -307 -323 11.7599 0.00594
NP_441732.1_2 Forward -98 -82 -16.4611 0.167
NP_441732.1_2 Reverse -169 -185 -17.4444 0.258
NP_442003.1_4 Forward -181 -162 11.7992 0.272
NP_442003.1_9 Forward -129 -110 9.0459 0.219
NP_442003.1_9 Forward -163 -144 8.55425 0.219
NP_440760.1_1 Reverse -173 -192 -11.4069 0.0851
NP_440760.1_1 Forward -182 -163 -14.6519 0.134
NP_440760.1_1 Reverse -311 -330 -22.3217 0.253
NP_440760.1_1 Forward -320 -301 -22.8133 0.271
NP_442274.1_3 Reverse -178 -197 6.98095 0.298
NP_441945.1_10 Reverse -157 -176 11.5042 0.235
NP_442353.1_4 Forward -188 -169 7.57013 0.165
NP_442510.1_5 Forward -323 -304 15.5357 0.203
NP_440713.1_4 Reverse -301 -320 12.4875 0.105
NP_442489.1_7 Forward -320 -311 20.1576 0.000695
NP_442489.1_7 Reverse -311 -320 20.1576 0.000695
NP_442489.1_7 Forward -182 -173 20.1576 0.000695
NP_442489.1_7 Reverse -173 -182 20.1576 0.000695
NP_442489.1_7 Forward -94 -85 0.688044 0.152
NP_442489.1_7 Reverse -85 -94 0.688044 0.152
NP_442079.1_6 Reverse -303 -322 17.3057 0.244
NP_442079.1_7 Reverse -312 -331 14.4541 0.0773
NP_440559.1_1 Forward -181 -172 17.4043 0.00658
NP_440559.1_1 Reverse -312 -321 8.75118 0.0586
NP_440559.1_1 Reverse -174 -183 8.65285 0.0586
NP_440559.1_1 Forward -319 -310 8.65285 0.0586
NP_440559.1_1 Forward -93 -84 4.91628 0.175
NP_441659.2_8 Forward -320 -310 20.9245 0.000805
NP_441659.2_8 Reverse -173 -183 20.9245 0.000805
NP_441659.2_8 Forward -182 -172 18.1713 0.00133
NP_441659.2_8 Reverse -311 -321 11.9764 0.0147
NP_441659.2_8 Reverse -85 -95 5.19158 0.113
NP_442913.1_10 Forward -191 -172 0.687771 0.153
NP_442913.1_10 Reverse -76 -95 -6.09707 0.291
NP_441040.1_2 Reverse -285 -304 -14.3569 0.285
NP_441040.1_5 Reverse -300 -319 6.19431 0.229
NP_439956.1_7 Forward -111 -92 0.884433 0.294
NP_442776.1_1 Reverse -121 -140 18.3873 0.0502
NP_440779.1_5 Reverse -311 -328 -14.0225 0.238
NP_442346.1_5 Reverse -172 -182 16.6963 0.00248
NP_442346.1_5 Forward -183 -173 16.303 0.00248
NP_442346.1_5 Reverse -310 -320 16.303 0.00248
NP_442346.1_5 Forward -321 -311 9.02648 0.118
NP_442346.1_5 Forward -95 -85 4.20827 0.296
NP_440545.1_3 Reverse -307 -324 6.82368 0.0536
NP_440545.1_3 Forward -324 -307 0.0388413 0.146
NP_440545.1_3 Forward -186 -169 -2.22277 0.181
NP_440545.1_3 Reverse -169 -186 -2.41943 0.184
NP_441856.1_3 Reverse -323 -342 4.71934 0.148
NP_440025.1_4 Reverse -110 -129 13.3725 0.222
NP_441629.1_3 Reverse -146 -165 -4.32786 0.29
NP_442900.1_2 Reverse -76 -95 3.04771 0.285
NP_442603.1_7 Forward -94 -80 16.5185 0.0304
NP_442603.1_7 Forward -182 -168 10.2254 0.132
NP_440449.1_6 Forward -190 -172 4.85163 0.288
NP_441047.1_2 Reverse -306 -325 -2.45882 0.277
NP_441502.1_3 Forward -304 -285 4.42435 0.299
NP_441833.1_4 Forward -319 -312 15.9687 0.0124
NP_441833.1_4 Reverse -312 -319 15.9687 0.0124
NP_441833.1_4 Forward -181 -174 15.9687 0.0124
NP_441833.1_4 Reverse -174 -181 15.9687 0.0124
NP_441329.1_6 Forward -59 -40 4.05798 0.209
NP_442162.1_9 Forward -319 -312 16.2637 0.0124
NP_442162.1_9 Reverse -312 -319 16.2637 0.0124
NP_442162.1_9 Forward -181 -174 16.2637 0.0124
NP_442162.1_9 Reverse -174 -181 16.2637 0.0124
NP_440671.1_4 Reverse -305 -319 19.2725 0.00971
NP_440671.1_4 Forward -188 -174 7.47274 0.217
NP_443026.1_5 Forward -109 -90 -1.67217 0.283
NP_440224.1_1 Reverse -300 -319 -0.590531 0.144
NP_442045.1_5 Reverse -302 -321 0.786102 0.266
NP_442073.1_6 Reverse -302 -321 0.294447 0.25
NP_442199.1_5 Reverse -303 -322 -1.57384 0.181
NP_442140.1_3 Reverse -312 -322 17.4829 0.0159
NP_442140.1_3 Forward -181 -171 12.2714 0.0632
NP_442140.1_3 Reverse -174 -184 6.66654 0.159
NP_442140.1_3 Reverse -194 -204 3.91327 0.271
NP_440875.1_9 Reverse -313 -323 17.619 0.0104
NP_440875.1_9 Forward -318 -308 8.27469 0.233
NP_440875.1_9 Reverse -175 -185 7.69067 0.255
NP_441813.1_5 Reverse -309 -319 15.9097 0.01
NP_441813.1_5 Forward -322 -312 10.0098 0.0208
NP_441813.1_5 Reverse -171 -181 8.63316 0.0367
NP_441813.1_5 Forward -184 -174 8.63316 0.0367
NP_442089.1_1 Forward -126 -107 -1.7705 0.28
NP_440590.1_4 Reverse -312 -325 13.9823 0.0112
NP_440590.1_4 Forward -181 -168 11.7207 0.0187
NP_440590.1_4 Reverse -174 -187 10.8357 0.0239
NP_440590.1_4 Forward -93 -80 3.46087 0.0735
NP_440590.1_4 Forward -129 -116 -1.06236 0.21
NP_440590.1_4 Forward -319 -306 -4.20895 0.258
NP_440590.1_4 Forward -358 -345 -5.48725 0.28
NP_440567.1_1 Forward -319 -305 15.6342 0.017
NP_440567.1_1 Reverse -312 -326 9.14437 0.0488
NP_440567.1_1 Forward -181 -167 7.76774 0.0654
NP_440567.1_1 Reverse -174 -188 6.3911 0.0837
NP_442497.1_10 Forward -319 -310 17.601 0.00813
NP_442497.1_10 Reverse -174 -183 17.601 0.00813
NP_442497.1_10 Forward -181 -172 10.4228 0.0087
NP_442497.1_10 Reverse -312 -321 10.4228 0.0087
NP_440821.1_4 Forward -322 -312 18.7612 0.00422
NP_440821.1_4 Reverse -309 -319 11.0914 0.0146
NP_440821.1_4 Reverse -171 -181 9.41981 0.0286
NP_440821.1_4 Forward -184 -174 2.24165 0.131
NP_440227.1_2 Forward -24 -8 7.53169 0.295
NP_441239.1_9 Forward -322 -310 16.0669 0.0175
NP_441239.1_9 Reverse -309 -321 14.6903 0.0258
NP_441239.1_9 Forward -184 -172 11.1504 0.0648
NP_441239.1_9 Reverse -171 -183 3.38223 0.285
NP_441009.1_4 Forward -320 -301 11.1109 0.26
NP_441892.1_1 Forward -191 -174 7.217 0.0915
NP_441892.1_1 Reverse -302 -319 -4.28772 0.258
NP_440604.1_6 Forward -320 -301 -5.70374 0.285
NP_442044.1_1 Reverse -306 -325 -1.96717 0.176
NP_442044.1_1 Forward -187 -168 -2.65548 0.176
NP_442772.1_4 Reverse -294 -313 -4.42544 0.249
NP_441769.1_1 Forward -328 -309 11.8975 0.188
NP_441874.1_1 Forward -374 -360 11.111 0.249
NP_440949.1_7 Reverse -312 -331 19.4681 0.108
NP_440546.1_4 Reverse -173 -183 13.5365 0.0459
NP_440546.1_4 Forward -320 -310 13.5365 0.0459
NP_440546.1_4 Reverse -311 -321 11.8882 0.0679
NP_440546.1_4 Forward -182 -172 10.046 0.109
NP_443033.1_7 Forward -105 -86 11.7992 0.281
NP_441230.1_5 Forward -325 -306 7.27595 0.166
NP_441230.1_5 Forward -187 -168 -0.000545616 0.277
NP_440462.1_6 Forward -322 -312 17.9746 0.00578
NP_440462.1_6 Reverse -309 -319 16.893 0.00853
NP_440462.1_6 Forward -184 -174 10.5014 0.0396
NP_440462.1_6 Reverse -171 -181 1.35667 0.294
NP_442144.1_1 Reverse -170 -186 11.3666 0.296
NP_440868.1_4 Reverse -169 -181 17.7386 0.0124
NP_440868.1_4 Forward -324 -312 12.0354 0.0254
NP_440868.1_4 Reverse -307 -319 6.1355 0.0878
NP_440868.1_4 Reverse -81 -93 -0.157684 0.248
NP_440868.1_4 Forward -186 -174 -0.846001 0.282
NP_442499.1_1 Reverse -306 -325 6.98095 0.203
NP_442258.1_7 Reverse -336 -355 27.2371 0.00262
NP_441084.1_6 Reverse -309 -323 12.1559 0.169
NP_440653.1_10 Reverse -121 -140 10.7175 0.149
NP_440696.1_3 Forward -324 -306 3.3624 0.207
NP_440696.1_3 Reverse -173 -191 -3.6191 0.287
NP_442039.1_3 Forward -91 -72 16.0274 0.211
NP_442039.1_4 Forward -319 -312 15.1821 0.0124
NP_442039.1_4 Reverse -312 -319 15.1821 0.0124
NP_442039.1_4 Forward -181 -174 15.1821 0.0124
NP_442039.1_4 Reverse -174 -181 15.1821 0.0124
NP_442039.1_7 Forward -312 -302 15.8113 0.211
NP_441811.1_8 Reverse -79 -93 7.76774 0.241
NP_441811.1_8 Reverse -167 -181 6.88276 0.259
NP_442829.1_2 Forward -23 -7 7.94782 0.291
NP_440825.1_7 Forward -181 -171 12.9096 0.152
NP_440825.1_7 Reverse -86 -96 10.8602 0.286
NP_442837.1_3 Forward -319 -312 15.7721 0.0124
NP_442837.1_3 Reverse -312 -319 15.7721 0.0124
NP_442837.1_3 Forward -181 -174 15.7721 0.0124
NP_442837.1_3 Reverse -174 -181 15.7721 0.0124
NP_442053.1_1 Forward -320 -311 18.3876 0.0007
NP_442053.1_1 Reverse -311 -320 18.3876 0.0007
NP_442053.1_1 Forward -182 -173 18.3876 0.0007
NP_442053.1_1 Reverse -173 -182 18.3876 0.0007
NP_442053.1_1 Reverse -85 -94 6.8829 0.111
NP_440505.1_3 Reverse -309 -319 15.123 0.014
NP_440505.1_3 Forward -322 -312 14.1397 0.0235
NP_440505.1_3 Reverse -171 -181 9.22315 0.122
NP_440505.1_3 Forward -184 -174 8.04317 0.147
NP_440505.1_7 Reverse -307 -326 -1.08219 0.271
NP_440505.1_7 Forward -134 -115 -2.0655 0.289
NP_441203.1_1 Forward -319 -300 -12.0953 0.143
NP_440914.1_1 Forward -182 -172 17.5935 0.000537
NP_440914.1_1 Forward -320 -310 16.3248 0.00196
NP_440914.1_1 Reverse -173 -183 16.3248 0.00196
NP_440914.1_1 Forward -94 -84 11.5428 0.0887
NP_440914.1_1 Reverse -121 -131 10.8597 0.118
NP_440914.1_1 Reverse -154 -164 8.71269 0.186
NP_440914.1_1 Reverse -311 -321 8.6151 0.186
NP_441011.1_8 Reverse -312 -321 16.9127 0.00602
NP_441011.1_8 Forward -319 -310 16.6177 0.00602
NP_441011.1_8 Reverse -174 -183 16.6177 0.00602
NP_441011.1_8 Forward -181 -172 8.25953 0.144
NP_442533.1_6 Forward -320 -311 17.2076 0.00137
NP_442533.1_6 Reverse -311 -320 17.2076 0.00137
NP_442533.1_6 Forward -182 -173 17.2076 0.00137
NP_442533.1_6 Reverse -173 -182 17.2076 0.00137
NP_442533.1_6 Forward -94 -85 4.91628 0.165
NP_442533.1_6 Reverse -85 -94 4.42462 0.179
NP_442232.1_3 Reverse -303 -322 -15.8318 0.296
NP_442229.1_1 Reverse -171 -185 8.45543 0.184
NP_441482.1_7 Reverse -305 -319 17.6008 0.00517
NP_441482.1_7 Forward -188 -174 8.65272 0.0162
NP_439944.1_9 Forward -319 -309 17.6796 0.00347
NP_439944.1_9 Forward -181 -171 10.5014 0.0887
NP_439944.1_9 Reverse -312 -322 10.4031 0.0887
NP_439944.1_9 Reverse -174 -184 9.12481 0.1
NP_439944.1_9 Reverse -194 -204 5.28991 0.262
NP_440116.1_5 Reverse -170 -187 3.67709 0.225
NP_440116.1_8 Reverse -86 -105 -3.83545 0.158
NP_440116.1_8 Forward -181 -162 -8.45701 0.253
NP_441527.1_5 Forward -184 -165 13.3767 0.297
NP_440115.1_6 Reverse -170 -180 8.33817 0.13
NP_440115.1_6 Reverse -308 -318 7.45319 0.147
NP_440007.1_9 Reverse -307 -321 3.8345 0.267
NP_440007.1_9 Forward -186 -172 3.04785 0.277
NP_439965.1_1 Reverse -302 -321 7.47261 0.076
NP_439965.1_7 Forward -333 -314 11.293 0.294
NP_441602.1_3 Reverse -168 -187 -2.36049 0.233
NP_441602.1_3 Forward -325 -306 -2.85214 0.239
NP_441602.1_3 Forward -369 -350 -4.03212 0.258
NP_441972.1_5 Reverse -312 -331 -7.57203 0.25
NP_441106.1_1 Reverse -310 -319 18.486 0.0028
NP_441106.1_1 Forward -183 -174 18.486 0.0028
NP_441106.1_1 Forward -321 -312 18.191 0.0028
NP_441106.1_1 Reverse -172 -181 9.63616 0.0311
NP_440429.1_2 Forward -181 -162 9.14423 0.272
NP_439903.1_6 Forward -323 -304 8.75009 0.134
NP_442306.1_10 Reverse -168 -187 -19.4701 0.197
NP_441286.1_1 Reverse -172 -184 5.93884 0.0258
NP_441286.1_1 Reverse -310 -322 5.34885 0.0259
NP_441286.1_1 Forward -321 -309 4.8572 0.0272
NP_441286.1_1 Forward -183 -171 3.48056 0.0467
NP_441286.1_1 Forward -95 -83 2.49725 0.06
NP_441286.1_1 Reverse -84 -96 -6.74586 0.278
NP_440670.1_8 Forward -320 -311 18.3876 0.000699
NP_440670.1_8 Reverse -311 -320 18.3876 0.000699
NP_440670.1_8 Forward -182 -173 18.3876 0.000699
NP_440670.1_8 Reverse -173 -182 18.3876 0.000699
NP_440670.1_8 Forward -94 -85 8.55452 0.066
NP_440670.1_8 Reverse -85 -94 5.99792 0.13
NP_440886.1_7 Forward -321 -311 17.7774 0.0011
NP_440886.1_7 Reverse -310 -320 8.04271 0.0805
NP_440886.1_7 Forward -183 -173 8.04271 0.0805
NP_440886.1_7 Reverse -172 -182 7.94438 0.0805
NP_440886.1_7 Reverse -91 -101 3.71617 0.267
NP_442614.1_2 Forward -182 -168 15.4376 0.0773
NP_442614.1_2 Forward -94 -80 11.5043 0.194
NP_442614.1_2 Reverse -311 -325 6.48943 0.291
NP_439995.1_4 Reverse -31 -50 17.8948 0.269
NP_439995.1_5 Forward -330 -311 9.73422 0.235
NP_442072.1_9 Reverse -172 -190 -5.09406 0.0578
NP_442072.1_9 Reverse -310 -328 -11.8789 0.0799
NP_440907.2_8 Reverse -312 -322 17.4824 0.00685
NP_440907.2_8 Reverse -174 -184 15.9091 0.0161
NP_440907.2_8 Forward -319 -309 9.51767 0.103
NP_440907.2_8 Forward -181 -171 7.64939 0.117
NP_442264.1_5 Forward -320 -306 12.1926 0.253
NP_441021.1_1 Reverse -294 -313 -3.04881 0.153
NP_441021.1_1 Reverse -194 -213 -4.22878 0.167
NP_441021.1_8 Forward -187 -169 2.47742 0.246
NP_441021.1_8 Reverse -306 -324 2.47742 0.246
NP_441463.1_3 Forward -330 -311 -0.0988766 0.132
NP_441463.1_6 Reverse -309 -323 7.86544 0.25
NP_441626.1_2 Forward -319 -312 15.7721 0.0124
NP_441626.1_2 Reverse -312 -319 15.7721 0.0124
NP_441626.1_2 Forward -181 -174 15.7721 0.0124
NP_441626.1_2 Reverse -174 -181 15.7721 0.0124
NP_441901.1_1 Forward -165 -146 2.55606 0.218
NP_442238.1_10 Reverse -92 -111 17.4032 0.212
NP_442794.1_1 Reverse -307 -319 10.2654 0.0721
NP_442794.1_1 Forward -186 -174 2.98891 0.286
NP_442794.1_1 Reverse -169 -181 2.59558 0.287
NP_442615.1_1 Forward -329 -311 3.3624 0.0549
NP_442615.1_1 Reverse -302 -320 -0.275845 0.114
NP_442615.1_1 Forward -191 -173 -1.45582 0.128
NP_442615.1_1 Forward -103 -85 -5.68405 0.22
NP_442615.1_1 Forward -132 -114 -6.27403 0.241
NP_442615.1_1 Reverse -76 -94 -7.25734 0.283
NP_441962.1_4 Reverse -306 -325 2.26107 0.103
NP_441962.1_4 Forward -319 -300 -10.522 0.229
NP_441962.1_4 Forward -307 -288 -14.8485 0.294
NP_440387.1_1 Reverse -173 -189 14.2182 0.00668
NP_440387.1_1 Forward -320 -304 6.35172 0.0282
NP_440387.1_1 Reverse -311 -327 -2.39974 0.147
NP_440387.1_1 Forward -182 -166 -4.46469 0.187
NP_441431.1_2 Forward -185 -171 10.9137 0.15
NP_441431.1_2 Forward -323 -309 9.14375 0.192
NP_441431.1_2 Reverse -170 -184 7.57046 0.238
NP_441488.1_8 Forward -187 -173 10.2254 0.146
NP_441836.1_1 Reverse -300 -319 17.5381 0.073
NP_441836.1_2 Forward -326 -307 -0.39387 0.212
NP_441993.1_1 Reverse -173 -192 5.06532 0.208
NP_441993.1_1 Reverse -287 -306 1.84923 0.269
NP_441993.1_1 Reverse -305 -324 0.484826 0.298
NP_441174.1_2 Reverse -308 -322 20.8458 0.00244
NP_440114.1_10 Reverse -311 -325 12.8809 0.0698
NP_440114.1_10 Reverse -173 -187 12.1926 0.0885
NP_442323.1_7 Forward -135 -116 6.48849 0.194
NP_442323.1_7 Reverse -306 -325 1.57197 0.278
NP_440287.1_6 Reverse -164 -183 3.44104 0.223
NP_440287.1_6 Reverse -309 -328 1.86774 0.262
NP_440766.1_4 Reverse -307 -321 16.5192 0.0256
NP_441237.1_9 Forward -181 -171 14.828 0.0242
NP_442743.1_5 Forward -319 -300 11.8975 0.142
NP_439910.1_2 Forward -328 -311 -11.8592 0.0788
NP_440457.1_1 Reverse -307 -319 8.39711 0.101
NP_440801.1_8 Reverse -346 -365 6.78429 0.166
NP_440801.1_8 Forward -353 -334 2.45773 0.229
NP_440801.1_10 Forward -134 -115 3.83436 0.297
NP_441436.1_2 Forward -179 -160 -1.67217 0.28
NP_442509.1_9 Reverse -311 -321 16.2041 0.00739
NP_442509.1_9 Forward -142 -132 13.4509 0.0553
NP_442509.1_9 Forward -182 -172 8.14104 0.192
NP_442509.1_9 Reverse -173 -183 8.04271 0.192
NP_442509.1_9 Forward -320 -310 8.04271 0.192
NP_442784.1_3 Forward -161 -142 12.0942 0.278
NP_440554.1_4 Forward -319 -309 16.1063 0.0189
NP_440554.1_4 Reverse -312 -322 13.943 0.0218
NP_440554.1_4 Reverse -174 -184 8.82982 0.0646
NP_441845.1_6 Forward -332 -314 7.00065 0.165
NP_441885.1_5 Forward -182 -172 20.9245 0.000538
NP_441885.1_5 Reverse -311 -321 11.4848 0.00668
NP_441885.1_5 Forward -320 -310 11.3864 0.00668
NP_441885.1_5 Reverse -173 -183 11.3864 0.00668
NP_441885.1_5 Forward -94 -84 9.22315 0.0223
NP_441885.1_5 Reverse -85 -95 1.25834 0.11
NP_441428.1_8 Forward -328 -309 16.1257 0.0703
NP_442341.1_7 Forward -95 -81 11.8976 0.0502
NP_442341.1_7 Reverse -172 -186 10.521 0.0625
NP_442341.1_7 Reverse -310 -324 9.83269 0.0697
NP_442341.1_7 Forward -321 -307 8.55439 0.0864
NP_442341.1_7 Forward -183 -169 5.50613 0.154
NP_442341.1_9 Forward -184 -170 16.9119 0.0319
NP_442341.1_9 Forward -322 -308 8.06211 0.179
NP_442341.1_9 Reverse -171 -185 6.58715 0.221
NP_441173.1_9 Reverse -302 -310 12.1137 0.21
NP_442395.2_4 Forward -321 -302 8.55343 0.123
NP_443000.1_7 Reverse -309 -319 17.4829 0.00719
NP_443000.1_7 Forward -184 -174 10.6981 0.0345
NP_443000.1_7 Reverse -171 -181 10.3048 0.0345
NP_443000.1_7 Forward -322 -312 2.04498 0.226
NP_441842.1_1 Forward -180 -167 18.8982 0.0142
NP_441842.1_10 Forward -327 -313 7.9644 0.238
NP_441842.1_10 Reverse -304 -318 6.58777 0.283
NP_440275.1_3 Forward -322 -312 17.9746 0.0082
NP_440275.1_3 Reverse -309 -319 9.12481 0.055
NP_440275.1_3 Forward -184 -174 9.02648 0.0563
NP_440275.1_3 Reverse -171 -181 8.04317 0.0602
NP_440275.1_3 Forward -204 -194 5.19158 0.161
NP_440091.1_1 Forward -324 -312 12.6253 0.0353
NP_440091.1_1 Forward -206 -194 8.29878 0.0653
NP_443060.1_5 Reverse -165 -184 8.35677 0.212
NP_442275.1_1 Reverse -311 -330 1.37609 0.284
NP_440679.1_10 Reverse -313 -332 -15.9302 0.25
NP_443010.1_10 Reverse -308 -325 3.6405 0.252
NP_442451.1_2 Reverse -303 -322 -9.53865 0.259
NP_439962.1_4 Reverse -303 -322 -6.1954 0.281
NP_440175.1_7 Forward -324 -306 12.5836 0.215
NP_440149.1_8 Forward -320 -301 7.37428 0.0628
NP_440149.1_8 Forward -182 -163 0.884433 0.132
NP_440149.1_8 Reverse -173 -192 -8.06369 0.298
NP_441105.1_3 Forward -193 -174 3.73603 0.0873
NP_441105.1_3 Reverse -300 -319 -8.26035 0.269
NP_440216.1_1 Reverse -311 -325 -1.47537 0.0328
NP_440216.1_1 Reverse -173 -187 -1.77037 0.0383
NP_440216.1_1 Forward -320 -306 -2.55701 0.0521
NP_440216.1_1 Forward -182 -168 -9.24352 0.145
NP_440216.1_1 Reverse -85 -99 -12.4884 0.274
NP_440172.1_1 Forward -320 -310 17.5813 0.00421
NP_440172.1_1 Reverse -173 -183 17.5813 0.00421
NP_440172.1_1 Forward -182 -172 15.0247 0.00945
NP_440172.1_1 Reverse -311 -321 8.73149 0.0586
NP_440172.1_1 Forward -94 -84 2.43831 0.279
NP_440172.1_1 Reverse -85 -95 2.24165 0.279
NP_442371.1_1 Reverse -385 -395 12.1726 0.258
NP_442015.1_10 Reverse -307 -320 11.229 0.0372
NP_442015.1_10 Reverse -169 -182 10.4424 0.0391
NP_442015.1_10 Forward -186 -173 3.65753 0.178
NP_442015.1_10 Forward -134 -121 1.9859 0.204
NP_441226.1_7 Forward -319 -312 14.4934 0.0123
NP_441226.1_7 Reverse -312 -319 14.4934 0.0123
NP_441226.1_7 Forward -181 -174 14.4934 0.0123
NP_441226.1_7 Reverse -174 -181 14.4934 0.0123
NP_441111.1_7 Forward -319 -311 18.7023 0.00294
NP_441111.1_7 Forward -181 -173 18.7023 0.00294
NP_441111.1_7 Reverse -312 -320 18.7023 0.00294
NP_441111.1_7 Reverse -174 -182 18.7023 0.00294
NP_441766.1_2 Forward -320 -311 17.5026 0.00297
NP_441766.1_2 Reverse -311 -320 17.5026 0.00297
NP_441766.1_2 Forward -182 -173 17.5026 0.00297
NP_441766.1_2 Reverse -173 -182 17.5026 0.00297
NP_441766.1_2 Reverse -85 -94 4.12963 0.194
NP_442417.1_5 Forward -320 -306 9.63603 0.128
NP_440416.1_9 Reverse -304 -323 -14.3569 0.176
NP_440416.1_9 Forward -137 -118 -18.9784 0.267
NP_443052.1_8 Forward -330 -311 -5.9004 0.137
NP_442116.1_2 Reverse -128 -147 16.2232 0.234
NP_440261.1_5 Reverse -312 -325 6.50913 0.0332
NP_440261.1_5 Forward -181 -168 5.03416 0.0478
NP_440261.1_5 Forward -93 -80 -5.09393 0.185
NP_440261.1_5 Forward -319 -306 -10.6005 0.201
NP_440988.1_10 Reverse -83 -97 3.83388 0.277
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACAGAAATTCACCCAGGTATTATCTTCATTTGTGATGGGGAGTTGATCCGCGCTGAACAAATCGAGGTTGTCACCTTAGCGGCGATCGCCTTGGCAGAAGAAATGGCTACAGGAAGAGACATGATCAACCGTGTGCTTTATGTGGAAATTGATAGGTCACTCCGCTTTGAGACTATGCCAAACTGAAACTTAGGGAGTTACAATCGCAGTCAAGCATAGGCGATCGCCAACAAAGCTGGGGTTTGGTCAAGTGGGAATGCTGAACCCCCTTGGGATTGGCGCAAGCGGAATGAGTAGGGGTTGATTGGCGATCAGCACCAAGAAACCGTATACTAACTCTGTAAAGATATTGAAAGGCAAAATTCTCTCTTATATCGAAAATCTCGACAAACTTGAACCA

CDS

ATGCCTGACATTCAAACTTGGGAATACAAAACTATCCGCTTTGATTTTCTCGGTCGGGGTATAACCCAAGAGTTCAATCTTCTCGATGTTGACGGCACTCGTGTCAAAGGCTGGTCAATGAATAACACTGCCATCAAAACTTTGCCACAGATGATGTTAGCTCTGGGCCAGGAAGGTTGGGAATTGGTTTCCCATGTTGTTAATCAAGACAACCAAGCCAACAATGTAACTCTTCACTATATGACTTTCAAGCGTCCCGGTGAGCTACTAGTTGAGACCGAAGACCCTGCGCTAACTGGTTCTGCCAATATTAGACAAATTCGCGACAAGTTTTTTGTCATTCCATAA

Protein

No sequence available