Your browser is old and dusty. Try Google Chrome!

Details for sll2005

ORF sll2005
Accession NP_441040.1
Symbol gyrB
Category DNA gyrase B subunit [Contains: Ssp gyrB intein]
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -395 -381 10.226 0.0636
NP_441061.1_2 Reverse -168 -182 10.226 0.0636
NP_440795.1_7 Forward -175 -168 8.00392 0.218
NP_440795.1_7 Reverse -36 -43 8.00392 0.218
NP_441418.1_6 Reverse -167 -186 -22.125 0.169
NP_441418.1_6 Forward -176 -157 -29.0082 0.215
NP_441453.1_7 Reverse -246 -253 14.1988 0.175
NP_442151.1_6 Forward -191 -177 7.86607 0.188
NP_440996.1_3 Forward -235 -217 12.0155 0.221
NP_442744.1_8 Reverse -151 -170 0.982764 0.217
NP_442655.1_1 Forward -194 -175 3.44104 0.235
NP_442173.1_1 Reverse -183 -191 7.29591 0.176
NP_442173.1_1 Reverse -388 -396 5.0343 0.24
NP_442752.1_4 Forward -176 -169 12.1338 0.0546
NP_442752.1_4 Reverse -374 -381 5.25066 0.256
NP_442752.1_4 Reverse -115 -122 5.25066 0.256
NP_443027.1_4 Reverse -113 -123 10.5998 0.124
NP_443027.1_4 Forward -193 -183 6.27322 0.286
NP_441337.1_1 Forward -66 -47 20.944 0.0384
NP_440110.1_4 Reverse -376 -395 13.4708 0.0777
NP_439979.1_2 Forward -185 -166 6.39097 0.292
NP_442062.1_8 Reverse -387 -397 5.78156 0.152
NP_442062.1_8 Forward -396 -386 3.61828 0.26
NP_440304.1_4 Reverse -385 -395 6.76487 0.146
NP_440304.1_4 Forward -178 -168 6.56821 0.15
NP_441781.1_7 Forward -50 -31 5.11266 0.186
NP_441781.1_7 Reverse -167 -186 -1.47551 0.274
NP_442762.1_10 Forward -188 -169 -10.7186 0.257
NP_440893.1_3 Reverse -157 -176 1.17865 0.273
NP_441208.1_9 Forward -179 -165 5.99778 0.254
NP_441208.1_9 Forward -285 -271 5.01447 0.282
NP_442110.1_7 Forward -191 -177 4.03116 0.208
NP_442110.1_7 Forward -396 -382 0.392915 0.261
NP_441082.1_10 Reverse -246 -259 8.67241 0.264
NP_441925.1_4 Reverse -159 -178 -11.0143 0.244
NP_441083.1_5 Reverse -167 -177 5.97822 0.0967
NP_441738.1_2 Forward -122 -115 8.00357 0.235
NP_441558.1_5 Forward -392 -373 9.3409 0.124
NP_441558.1_5 Forward -121 -102 4.52268 0.28
NP_441713.1_1 Forward -182 -163 -16.9135 0.289
NP_442920.1_3 Reverse -114 -133 16.6629 0.278
NP_440178.1_7 Forward -51 -32 -22.0267 0.249
NP_441792.1_5 Forward -44 -28 7.72835 0.299
NP_441716.1_1 Reverse -329 -343 8.84938 0.13
NP_441163.1_1 Forward -184 -167 5.15133 0.28
NP_440343.1_3 Reverse -326 -344 2.67334 0.291
NP_440343.1_9 Reverse -241 -260 8.65258 0.251
NP_440851.1_5 Forward -39 -20 14.5516 0.216
NP_440747.1_10 Reverse -384 -396 -12.1541 0.227
NP_441847.1_9 Forward -249 -231 7.4923 0.272
NP_441486.1_1 Forward -393 -379 -2.16369 0.175
NP_441486.1_1 Reverse -384 -398 -3.63866 0.18
NP_441012.1_4 Reverse -383 -396 7.09911 0.272
NP_443018.1_3 Forward -175 -168 4.07068 0.299
NP_443018.1_3 Reverse -36 -43 4.07068 0.299
NP_441634.1_8 Forward -392 -378 -0.0987402 0.247
NP_440376.1_1 Forward -50 -41 4.32629 0.163
NP_440376.1_1 Forward -176 -167 3.93297 0.188
NP_441846.1_10 Forward -186 -167 -23.4033 0.285
NP_441013.1_2 Forward -260 -242 -4.60241 0.299
NP_441950.1_8 Forward -226 -212 5.30946 0.281
NP_441451.2_4 Forward -291 -272 19.1468 0.29
NP_442296.1_5 Reverse -26 -45 0.392778 0.289
NP_441763.1_10 Forward -233 -214 10.9134 0.143
NP_442658.1_1 Forward -178 -168 7.0594 0.214
NP_442658.1_1 Forward -224 -214 4.89613 0.292
NP_442782.1_7 Reverse -379 -398 0.0977854 0.253
NP_440203.1_5 Reverse -170 -180 13.4509 0.115
NP_440203.1_5 Forward -393 -383 12.8609 0.137
NP_443001.1_7 Forward -188 -169 5.60432 0.279
NP_441162.1_3 Forward -260 -241 11.2092 0.21
NP_443055.1_6 Reverse -373 -391 -2.63651 0.298
NP_440138.1_6 Forward -395 -376 1.96529 0.273
NP_439975.1_2 Reverse -105 -123 8.08229 0.215
NP_441913.1_3 Reverse -268 -281 15.1495 0.218
NP_441099.1_5 Forward -186 -167 -1.57384 0.11
NP_441099.1_5 Forward -317 -298 -8.752 0.203
NP_442002.1_1 Forward -185 -167 -9.71562 0.283
NP_442002.1_9 Reverse -231 -238 11.3472 0.185
NP_440809.1_9 Forward -59 -41 -7.84733 0.225
NP_442438.1_10 Forward -395 -381 2.85119 0.168
NP_442431.1_10 Forward -182 -164 3.06741 0.225
NP_442004.1_4 Reverse -276 -295 7.37347 0.299
NP_441725.1_4 Forward -129 -115 6.0955 0.278
NP_441725.1_5 Reverse -168 -178 6.37155 0.115
NP_441725.1_5 Forward -395 -385 0.176696 0.206
NP_439966.1_7 Reverse -165 -175 12.9592 0.0339
NP_439966.1_9 Reverse -113 -122 6.68623 0.253
NP_440202.1_8 Reverse -159 -178 12.2379 0.272
NP_442941.1_3 Forward -395 -385 0.373358 0.212
NP_440260.1_8 Forward -53 -35 -0.570838 0.216
NP_441514.1_6 Reverse -256 -263 14.2971 0.248
NP_442281.1_1 Forward -388 -374 3.8339 0.217
NP_001035871.2_7 Forward -252 -242 14.7297 0.176
NP_440437.1_1 Forward -275 -256 -5.11376 0.274
NP_442012.1_1 Reverse -109 -128 -0.39387 0.259
NP_442049.1_4 Forward -175 -156 -3.54046 0.276
NP_441860.1_1 Reverse -44 -58 18.1672 0.276
NP_440498.1_1 Forward -328 -310 -0.964162 0.222
NP_443049.1_6 Forward -177 -167 13.788 0.149
NP_442215.1_2 Forward -169 -153 -0.236458 0.164
NP_442215.1_2 Forward -398 -382 -6.13632 0.264
NP_442029.1_1 Forward -172 -153 -19.9617 0.297
NP_442029.1_6 Forward -49 -30 8.35759 0.207
NP_442029.1_6 Forward -231 -212 6.39097 0.238
NP_442029.1_6 Reverse -214 -233 6.19431 0.242
NP_442029.1_6 Reverse -235 -254 3.24438 0.282
NP_440780.1_1 Reverse -42 -61 8.35512 0.274
NP_441751.2_8 Forward -395 -381 -1.8687 0.132
NP_441751.2_8 Reverse -168 -182 -4.13031 0.163
NP_442554.1_8 Reverse -111 -121 9.7148 0.0562
NP_442554.1_8 Reverse -168 -178 6.07655 0.126
NP_442167.1_6 Reverse -172 -188 10.0876 0.292
NP_441762.1_7 Forward -177 -165 -5.95921 0.258
NP_441762.1_7 Forward -223 -211 -7.53251 0.293
NP_442142.1_4 Reverse -378 -391 2.28034 0.295
NP_440895.1_6 Forward -166 -153 8.9674 0.234
NP_440279.1_2 Reverse -376 -395 11.0125 0.145
NP_441198.1_8 Forward -178 -168 13.1737 0.108
NP_440379.1_5 Forward -185 -166 -8.55534 0.253
NP_441468.1_1 Reverse -36 -43 10.2655 0.0906
NP_441468.1_1 Forward -175 -168 10.2655 0.0906
NP_441468.1_1 Reverse -183 -190 3.67736 0.282
NP_441020.2_6 Forward -178 -161 10.6586 0.139
NP_441020.2_6 Reverse -180 -197 9.38028 0.173
NP_441015.1_1 Reverse -144 -162 9.0656 0.277
NP_441015.1_10 Forward -181 -162 -11.4069 0.296
NP_441673.1_1 Reverse -41 -50 -8.06341 0.254
NP_441826.1_2 Reverse -381 -395 10.1277 0.051
NP_441826.1_2 Forward -182 -168 2.35953 0.129
NP_441826.1_2 Reverse -161 -175 -3.34366 0.284
NP_442811.1_2 Forward -392 -373 -2.45882 0.281
NP_441764.1_8 Forward -35 -25 13.4162 0.284
NP_442227.1_2 Reverse -160 -179 11.2092 0.166
NP_442808.1_1 Reverse -166 -176 13.7459 0.047
NP_441176.1_1 Reverse -249 -268 7.37428 0.273
NP_440145.1_4 Reverse -168 -178 14.9258 0.231
NP_441906.1_5 Reverse -338 -357 12.1917 0.173
NP_442820.1_2 Reverse -30 -49 15.8035 0.269
NP_442718.1_2 Forward -306 -287 18.6823 0.0259
NP_442542.1_9 Forward -276 -262 7.27547 0.202
NP_442113.1_5 Reverse -165 -184 10.9134 0.288
NP_442113.1_10 Reverse -160 -179 -8.94866 0.289
NP_441114.1_3 Reverse -153 -162 7.37455 0.239
NP_440558.1_2 Reverse -142 -161 -6.39206 0.274
NP_440558.1_2 Forward -54 -35 -6.68705 0.279
NP_440111.2_2 Reverse -171 -190 8.94757 0.167
NP_441878.1_6 Forward -177 -167 1.74999 0.0642
NP_441878.1_6 Forward -51 -41 -6.21482 0.191
NP_441878.1_10 Reverse -272 -286 11.5043 0.289
NP_441036.1_8 Reverse -114 -124 8.92815 0.174
NP_441557.1_5 Reverse -387 -396 -0.885252 0.26
NP_441557.1_8 Forward -259 -249 16.5975 0.167
NP_441557.1_8 Forward -318 -308 12.5659 0.236
NP_441557.1_8 Reverse -168 -178 11.1893 0.26
NP_441445.1_1 Forward -59 -40 9.93088 0.0994
NP_441445.1_8 Reverse -247 -266 -11.9969 0.277
NP_441590.1_4 Forward -38 -19 6.98015 0.254
NP_441739.1_2 Reverse -276 -292 1.7295 0.3
NP_441458.1_10 Forward -399 -380 10.7175 0.123
NP_442830.1_5 Reverse -166 -180 0.195672 0.295
NP_442183.1_1 Reverse -110 -124 3.93283 0.289
NP_442397.1_9 Forward -396 -377 8.16093 0.246
NP_442397.1_9 Reverse -34 -53 1.57275 0.283
NP_440979.1_3 Forward -127 -109 11.8189 0.234
NP_441459.1_3 Forward -257 -238 16.7582 0.168
NP_441574.1_1 Reverse -179 -198 -6.39206 0.277
NP_441549.1_9 Forward -54 -36 -8.53565 0.232
NP_441238.1_10 Forward -233 -219 15.9292 0.219
NP_442347.1_2 Forward -123 -114 4.0313 0.284
NP_441037.1_4 Forward -178 -168 7.9999 0.237
NP_442594.1_9 Forward -290 -271 7.66846 0.242
NP_440136.1_2 Forward -175 -168 4.26735 0.218
NP_440136.1_2 Reverse -36 -43 4.26735 0.218
NP_440136.1_2 Reverse -116 -123 3.97235 0.288
NP_442590.1_10 Forward -173 -154 3.24438 0.294
NP_442998.1_5 Reverse -257 -267 14.0414 0.151
NP_442998.1_5 Forward -244 -234 9.81313 0.233
NP_440299.1_1 Reverse -383 -396 3.55864 0.241
NP_441799.1_1 Forward -400 -386 3.8339 0.279
NP_442961.1_4 Forward -356 -337 10.2259 0.118
NP_440087.1_1 Reverse -110 -129 -3.73712 0.237
NP_441090.1_5 Forward -302 -284 16.2438 0.258
NP_441090.1_6 Reverse -245 -259 10.9143 0.221
NP_441559.1_8 Reverse -187 -201 -5.31028 0.259
NP_441559.1_8 Reverse -293 -307 -5.50694 0.264
NP_440915.1_6 Forward -180 -166 10.226 0.0333
NP_442158.1_4 Reverse -28 -38 11.1898 0.28
NP_440717.1_3 Forward -266 -252 10.3237 0.231
NP_441866.1_6 Forward -398 -379 6.68515 0.285
NP_442866.1_1 Reverse -162 -181 -3.63879 0.221
NP_442031.1_3 Forward -193 -174 9.0459 0.2
NP_440026.1_6 Forward -128 -109 12.29 0.284
NP_441494.1_6 Forward -308 -295 15.0639 0.148
NP_442386.1_9 Reverse -166 -175 13.4706 0.0358
NP_442386.1_9 Forward -45 -36 8.35743 0.201
NP_440570.1_5 Forward -186 -167 4.42435 0.223
NP_440570.1_5 Reverse -241 -260 -2.26216 0.278
NP_441271.1_8 Reverse -247 -257 13.943 0.266
NP_441947.1_10 Forward -398 -380 -0.0791831 0.276
NP_441027.1_1 Forward -244 -230 10.717 0.277
NP_440586.1_8 Forward -389 -382 5.8403 0.283
NP_441262.1_3 Reverse -115 -122 5.15232 0.265
NP_439937.1_8 Reverse -174 -193 2.85105 0.209
NP_439937.1_8 Forward -193 -174 -5.60541 0.299
NP_439937.1_9 Reverse -212 -229 -11.3682 0.251
NP_439937.1_9 Forward -286 -269 -13.9248 0.287
NP_439937.1_9 Reverse -296 -313 -14.7114 0.287
NP_439937.1_9 Reverse -211 -228 -14.9081 0.287
NP_440819.1_5 Forward -140 -132 7.98423 0.228
NP_440316.1_10 Reverse -244 -254 7.25653 0.251
NP_440316.1_10 Forward -177 -167 7.25653 0.251
NP_439977.1_5 Reverse -161 -180 2.94938 0.164
NP_440139.1_1 Reverse -161 -180 1.47364 0.26
NP_442887.1_5 Forward -58 -39 -10.0303 0.264
NP_441018.1_7 Forward -400 -381 15.3391 0.113
NP_442790.1_4 Forward -185 -166 -15.5368 0.294
NP_440487.1_1 Reverse -167 -186 -4.32711 0.214
NP_440297.1_9 Forward -43 -33 0.373358 0.282
NP_440297.1_9 Reverse -168 -178 -0.0199663 0.282
NP_440297.1_9 Reverse -382 -392 -0.118297 0.282
NP_440298.1_10 Reverse -4 -22 10.9339 0.0886
NP_441103.1_9 Forward -264 -254 14.7357 0.203
NP_440990.1_10 Reverse -248 -267 20.649 0.163
NP_440999.1_9 Reverse -293 -307 -1.96703 0.254
NP_440999.1_9 Reverse -187 -201 -2.26202 0.264
NP_440888.1_2 Reverse -297 -311 10.717 0.0861
NP_440888.1_2 Forward -50 -36 5.40719 0.28
NP_440888.1_2 Forward -260 -246 5.1122 0.293
NP_442948.1_2 Reverse -175 -194 10.1275 0.159
NP_442277.1_6 Forward -39 -25 20.1574 0.144
NP_441123.1_6 Reverse -157 -175 9.16393 0.279
NP_440575.1_8 Reverse -349 -368 -6.68705 0.289
NP_442845.1_2 Forward -50 -36 5.40779 0.233
NP_442845.1_2 Reverse -104 -118 5.40779 0.233
NP_442845.1_2 Forward -182 -168 4.22782 0.264
NP_441178.1_6 Forward -192 -173 7.96345 0.26
NP_441918.1_7 Forward -177 -158 -1.86883 0.297
NP_440982.1_1 Reverse -167 -186 19.8614 0.057
NP_441469.1_8 Reverse -166 -175 13.9627 0.066
NP_441469.1_8 Forward -307 -298 7.27622 0.227
NP_441469.1_8 Forward -45 -36 5.40793 0.272
NP_442315.1_1 Forward -61 -43 10.3439 0.181
NP_440710.1_1 Reverse -159 -177 -2.73412 0.198
NP_441621.1_7 Reverse -165 -179 -4.91696 0.248
NP_442736.1_1 Forward -259 -240 8.75091 0.177
NP_443062.1_6 Forward -58 -39 1.96607 0.264
NP_440516.1_8 Forward -176 -167 -0.491928 0.262
NP_442428.1_5 Forward -175 -168 4.66067 0.244
NP_442428.1_5 Reverse -36 -43 4.66067 0.244
NP_442823.1_8 Reverse -110 -129 10.0292 0.299
NP_441867.1_2 Forward -177 -158 -17.8968 0.291
NP_440673.1_2 Forward -400 -381 9.31652 0.248
NP_440673.1_3 Reverse -153 -160 8.98723 0.203
NP_441052.1_2 Reverse -167 -177 6.07655 0.0943
NP_440436.1_4 Reverse -168 -177 10.029 0.0863
NP_440436.1_4 Reverse -152 -161 7.76745 0.124
NP_440436.1_4 Forward -395 -386 4.42421 0.265
NP_441884.1_9 Forward -194 -175 -1.7705 0.0505
NP_441884.1_9 Reverse -294 -313 -22.5183 0.281
NP_440689.1_1 Reverse -141 -159 7.98396 0.297
NP_441719.1_2 Forward -399 -385 16.2317 0.206
NP_441719.1_4 Reverse -116 -123 3.77569 0.285
NP_441733.1_10 Reverse -112 -125 13.884 0.0857
NP_441733.1_10 Forward -179 -166 8.47575 0.14
NP_441004.1_1 Forward -182 -163 -9.34199 0.206
NP_441004.1_5 Forward -180 -166 13.7659 0.223
NP_442366.1_3 Forward -397 -379 -2.93078 0.235
NP_442366.1_5 Forward -386 -376 12.9592 0.101
NP_440129.1_9 Reverse -248 -267 4.52268 0.299
NP_440296.1_10 Forward -179 -160 -5.80207 0.225
NP_442206.1_10 Reverse -110 -125 0.471552 0.259
NP_440328.1_4 Forward -389 -370 2.45773 0.201
NP_441851.1_9 Forward -185 -166 14.6508 0.166
NP_441851.1_10 Reverse -34 -44 12.9597 0.0391
NP_441851.1_10 Forward -177 -167 7.25653 0.144
NP_441851.1_10 Reverse -386 -396 5.5849 0.207
NP_442622.1_8 Reverse -167 -185 -18.8604 0.285
NP_442515.1_1 Reverse -40 -54 8.45605 0.0773
NP_441046.1_2 Forward -233 -214 -0.295539 0.278
NP_441349.1_10 Reverse -31 -50 -0.983855 0.0981
NP_442314.1_3 Reverse -383 -397 11.111 0.285
NP_442843.1_1 Forward -240 -221 -11.8986 0.295
NP_440474.1_8 Forward -123 -109 7.66879 0.202
NP_442450.1_5 Forward -130 -120 12.0747 0.115
NP_442450.1_5 Forward -385 -375 10.3048 0.115
NP_442450.1_5 Forward -126 -116 4.99491 0.271
NP_442450.1_5 Reverse -165 -175 4.89658 0.278
NP_440588.1_2 Reverse -32 -51 -3.44213 0.186
NP_442006.1_2 Reverse -244 -261 -15.8908 0.23
NP_442006.1_2 Reverse -245 -262 -16.4808 0.254
NP_442006.1_2 Reverse -251 -268 -17.9557 0.285
NP_441570.1_1 Forward -176 -158 -4.99573 0.075
NP_441570.1_1 Forward -191 -173 -8.83064 0.122
NP_441078.1_4 Forward -50 -41 -0.786921 0.207
NP_441078.1_4 Reverse -41 -50 -1.57357 0.266
NP_441078.1_4 Reverse -167 -176 -2.06522 0.295
NP_441078.1_4 Forward -176 -167 -2.06522 0.295
NP_440526.1_3 Reverse -168 -179 18.0527 0.0393
NP_440526.1_3 Forward -43 -32 6.74468 0.184
NP_440526.1_3 Forward -323 -312 2.22148 0.267
NP_441432.1_8 Reverse -386 -395 8.1612 0.0815
NP_441432.1_8 Forward -161 -152 5.40793 0.158
NP_441432.1_9 Reverse -123 -136 13.1553 0.185
NP_443024.1_3 Forward -243 -233 16.2046 0.255
NP_442344.1_7 Reverse -36 -55 -6.49039 0.171
NP_441732.1_2 Forward -273 -257 -17.7394 0.292
NP_442343.1_10 Reverse -39 -58 10.9142 0.289
NP_440313.1_5 Reverse -378 -396 10.6381 0.294
NP_442797.1_7 Reverse -34 -52 1.19912 0.262
NP_441805.1_1 Forward -254 -235 3.83436 0.124
NP_439900.1_9 Forward -93 -74 17.1082 0.171
NP_442489.1_7 Forward -176 -167 -1.57357 0.213
NP_442489.1_7 Forward -50 -41 -1.77023 0.247
NP_442489.1_7 Forward -396 -387 -1.86856 0.259
NP_442489.1_7 Reverse -387 -396 -1.96689 0.28
NP_442489.1_7 Reverse -374 -383 -2.16355 0.295
NP_440559.1_1 Reverse -116 -125 4.62128 0.24
NP_440559.1_1 Reverse -388 -397 4.42462 0.277
NP_440559.1_1 Forward -395 -386 4.32629 0.288
NP_441022.1_1 Forward -63 -54 10.9707 0.284
NP_442913.1_9 Forward -50 -31 8.45592 0.257
NP_442913.1_10 Reverse -142 -161 10.7175 0.0421
NP_441040.1_1 Forward -74 -55 29.6954 0.000528
NP_441040.1_3 Forward -181 -162 19.5673 0.11
NP_441040.1_5 Reverse -30 -49 5.211 0.237
NP_442346.1_5 Forward -161 -151 10.5014 0.0934
NP_442346.1_5 Reverse -386 -396 4.3066 0.291
NP_440545.1_3 Reverse -256 -273 -5.1727 0.242
NP_440545.1_3 Reverse -37 -54 -6.64766 0.285
NP_441786.1_10 Reverse -32 -51 8.25926 0.244
NP_440250.1_4 Forward -73 -54 3.63691 0.265
NP_440459.1_2 Reverse -372 -389 7.80699 0.278
NP_440459.1_2 Reverse -32 -49 7.41366 0.291
NP_441653.1_1 Forward -69 -55 17.5025 0.171
NP_441653.1_2 Forward -187 -168 4.88249 0.252
NP_440010.1_10 Reverse -248 -267 1.57275 0.297
NP_440847.1_3 Reverse -169 -183 16.2235 0.139
NP_442603.1_7 Forward -191 -177 9.34041 0.149
NP_442603.1_7 Reverse -167 -181 8.84875 0.162
NP_441888.1_7 Reverse -382 -396 3.24451 0.225
NP_441888.1_8 Forward -288 -269 10.9142 0.28
NP_442060.1_10 Forward -168 -149 12.8808 0.244
NP_443015.1_1 Reverse -9 -28 19.6937 0.165
NP_440671.1_4 Reverse -381 -395 12.1926 0.114
NP_442404.1_9 Reverse -194 -208 10.5204 0.263
NP_440772.1_6 Forward -302 -283 7.86593 0.292
NP_440204.1_4 Reverse -19 -38 2.85105 0.238
NP_442140.1_3 Forward -389 -379 9.91146 0.0958
NP_441609.1_1 Forward -294 -275 -2.36049 0.289
NP_440875.1_9 Forward -122 -112 11.4868 0.169
NP_440875.1_9 Forward -252 -242 7.30133 0.269
NP_440594.1_6 Reverse -327 -346 5.50519 0.285
NP_440590.1_4 Reverse -36 -49 -3.12731 0.254
NP_440567.1_1 Forward -123 -109 1.17956 0.214
NP_440567.1_1 Forward -190 -176 -0.393733 0.281
NP_440567.1_6 Forward -395 -376 5.40766 0.265
NP_442497.1_10 Reverse -168 -177 0.196389 0.208
NP_440821.1_4 Forward -178 -168 6.66654 0.0837
NP_441239.1_9 Reverse -165 -177 7.31547 0.165
NP_441239.1_9 Forward -121 -109 4.36554 0.253
NP_441239.1_9 Forward -178 -166 3.18557 0.292
NP_441892.1_1 Forward -185 -168 0.628827 0.165
NP_440665.1_1 Reverse -167 -186 -9.83364 0.244
NP_441508.1_4 Reverse -40 -54 14.0489 0.287
NP_441017.1_6 Forward -394 -380 14.1586 0.157
NP_441874.1_1 Reverse -81 -95 10.3243 0.261
NP_441617.1_8 Reverse -1 -20 10.7167 0.261
NP_442138.1_1 Reverse -159 -178 -0.39464 0.3
NP_440546.1_4 Forward -176 -166 9.17338 0.151
NP_440675.1_1 Forward -399 -380 14.0608 0.177
NP_440462.1_6 Reverse -113 -123 5.78156 0.138
NP_440462.1_6 Reverse -372 -382 4.10993 0.216
NP_440868.1_4 Forward -189 -177 -1.14099 0.296
NP_442499.1_1 Reverse -36 -55 4.03102 0.247
NP_441474.1_1 Reverse -166 -185 4.71854 0.221
NP_442402.1_2 Reverse -128 -142 11.7003 0.272
NP_440653.1_10 Reverse -36 -55 2.26107 0.289
NP_440696.1_3 Forward -176 -158 -3.32411 0.285
NP_440696.1_9 Reverse -243 -262 13.5683 0.296
NP_442039.1_7 Forward -229 -219 7.25653 0.277
NP_441811.1_8 Forward -130 -116 12.1926 0.209
NP_442273.1_10 Reverse -66 -84 4.9357 0.288
NP_441180.1_2 Forward -287 -268 10.7762 0.287
NP_442837.1_3 Forward -123 -116 8.79057 0.165
NP_442053.1_1 Forward -176 -167 4.52295 0.242
NP_440505.1_3 Reverse -385 -395 11.5831 0.0735
NP_440505.1_3 Forward -172 -162 7.15819 0.163
NP_442659.1_3 Reverse -169 -188 13.6675 0.212
NP_441203.1_1 Forward -395 -376 -11.0136 0.137
NP_442255.1_3 Reverse -62 -81 8.45592 0.279
NP_442533.1_6 Reverse -167 -176 6.98123 0.0992
NP_442541.1_10 Reverse -157 -171 0.687325 0.3
NP_442322.1_2 Forward -32 -13 16.4199 0.229
NP_442322.1_4 Forward -269 -252 -1.04349 0.226
NP_441482.1_7 Forward -182 -168 -10.8168 0.216
NP_441482.1_7 Forward -130 -116 -11.0135 0.229
NP_441482.1_7 Reverse -381 -395 -11.3085 0.254
NP_442269.1_10 Reverse -317 -336 1.86774 0.282
NP_442202.1_6 Reverse -267 -286 10.1275 0.178
NP_442716.1_4 Forward -365 -346 18.3873 0.261
NP_441286.1_1 Reverse -40 -52 -4.9759 0.183
NP_442674.1_3 Forward -184 -165 4.22689 0.294
NP_442674.1_10 Reverse -113 -132 11.5042 0.215
NP_440886.1_7 Reverse -166 -176 14.8275 0.0394
NP_440886.1_7 Forward -192 -182 4.7978 0.218
NP_442963.1_3 Reverse -240 -258 14.9655 0.273
NP_440907.2_8 Reverse -168 -178 8.82935 0.117
NP_440907.2_8 Reverse -116 -126 7.15773 0.127
NP_440907.2_8 Forward -123 -113 6.86274 0.144
NP_442264.1_2 Forward -400 -383 15.2801 0.127
NP_442264.1_2 Forward -54 -37 8.88863 0.206
NP_441021.1_1 Reverse -168 -187 -9.93197 0.224
NP_441463.1_3 Reverse -157 -176 -3.83545 0.188
NP_441463.1_6 Forward -398 -384 7.7688 0.252
NP_442362.1_5 Forward -192 -173 16.6165 0.15
NP_441460.1_2 Forward -263 -250 13.3917 0.289
NP_442794.1_1 Reverse -383 -395 7.51213 0.137
NP_441962.1_4 Reverse -177 -196 -6.78538 0.181
NP_441962.1_5 Forward -266 -247 5.11266 0.291
NP_441431.1_3 Reverse -22 -41 4.42435 0.263
NP_442647.1_7 Forward -258 -245 5.91914 0.257
NP_440634.1_6 Reverse -40 -54 22.4191 0.00341
NP_441993.1_1 Forward -160 -141 2.62889 0.256
NP_442357.1_8 Reverse -40 -59 6.58763 0.241
NP_441272.1_7 Forward -348 -338 14.828 0.2
NP_440293.1_3 Forward -184 -165 -2.16383 0.239
NP_440766.1_4 Forward -189 -175 9.5377 0.0871
NP_440766.1_4 Forward -180 -166 0.294584 0.291
NP_441237.1_9 Reverse -375 -385 11.6814 0.164
NP_441979.1_9 Reverse -291 -310 3.04771 0.297
NP_440457.1_1 Forward -180 -168 11.347 0.092
NP_440457.1_1 Reverse -31 -43 3.97222 0.177
NP_440457.1_1 Reverse -111 -123 2.30059 0.214
NP_441332.1_6 Reverse -166 -176 14.7447 0.141
NP_441436.1_9 Forward -263 -253 16.2041 0.27
NP_442514.1_5 Forward -262 -243 -2.8529 0.222
NP_442514.1_5 Forward -268 -249 -5.70449 0.261
NP_440554.1_4 Reverse -183 -193 3.22496 0.239
NP_441885.1_5 Reverse -387 -397 0.668351 0.133
NP_441885.1_5 Forward -50 -40 0.275027 0.174
NP_442395.2_4 Reverse -166 -185 4.12856 0.188
NP_441842.1_10 Reverse -103 -117 6.09611 0.299
NP_440679.1_10 Forward -183 -164 -6.49039 0.161
NP_440679.1_10 Reverse -184 -203 -20.5517 0.286
NP_440127.1_5 Forward -295 -277 10.3439 0.288
NP_441122.1_1 Forward -394 -379 3.51981 0.281
NP_441207.1_4 Reverse -317 -336 5.30933 0.227
NP_439962.1_4 Forward -261 -242 -8.85033 0.298
NP_442495.1_4 Reverse -244 -254 17.2863 0.0771
NP_440149.1_8 Forward -396 -377 3.04771 0.102
NP_441105.1_3 Forward -135 -116 -5.70374 0.223
NP_441105.1_3 Reverse -36 -55 -7.67036 0.258
NP_441105.1_3 Forward -55 -36 -8.26035 0.269
NP_440216.1_1 Forward -383 -369 -4.4253 0.111
NP_440216.1_6 Forward -390 -374 4.68009 0.189
NP_440216.1_9 Reverse -383 -392 7.76787 0.286
NP_440216.1_9 Reverse -153 -162 5.50626 0.292
NP_440172.1_1 Reverse -387 -397 10.9931 0.0445
NP_442371.1_1 Forward -245 -235 14.3359 0.191
NP_441226.1_7 Reverse -168 -175 11.2485 0.0971
NP_441226.1_7 Forward -43 -36 11.2485 0.0971
NP_442834.1_9 Forward -392 -373 3.34271 0.298
NP_440244.1_1 Reverse -250 -269 -9.53865 0.287
NP_440416.1_9 Forward -51 -32 -19.1751 0.27
NP_443052.1_9 Forward -264 -245 -5.99873 0.276
NP_442154.1_1 Reverse -22 -40 -13.6489 0.217
NP_442154.1_1 Forward -184 -166 -15.1238 0.218
NP_442154.1_1 Forward -178 -160 -15.9105 0.228
NP_440261.1_1 Reverse -210 -223 16.3422 0.235
NP_440261.1_5 Reverse -168 -181 -10.9938 0.23
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTTAGCAATTGCCATGGTCGATCCACTGATGTACCAAGAAGAAATGTTTGTGTTCTTGGCGGACCAGGAACCAGAAACATTCCTAACTCCGGCGGAAATGACTGCTAAGTTGACGGAGATTTTGGCCGAATACGATCTTCCCCTGCCCCAGGGACTGGATAAATTGCCCACTTTGGCGGCAAAAGCGGAACATTTACGGGACAATTACTGCGACCTCGACCGGGGGGATGGCGGTACTTGGCAATGGTATGTGGTACGTCTGGAAAAATAGCTTGATCGATCCCATCTCCAAATCAGTTCTCAGTCCCCGATATTAAAGCCTTTAACCCTTTTGTGCTAAGATTTTGAGGGCTTTTGCCATCCCACAGCAAAGATGCCTAAGCTCAGCCTGATTTTGGA

CDS

GTGACCATGACGACCACGAACTACGGTGCCGATCAAATTCAAGTCTTGGAAGGGTTGGAACCAGTCCGTAAGCGCCCAGGGATGTATATTGGCTCCACGGGGCCCAAGGGTCTGCATCACCTAGTGTATGAAGTGGTTGACAATGCCATTGATGAGGCTTTGGCCGGCTATTGTACCCATATTGAAATTGACATTAATGCCGACGGTTCCGTCACCGTAGTGGACAATGGCCGGGGGATTCCCACCGATATTCACCCCACCACCGGGCGATCGGCCTTGGAAACAGTGTTGACGGTACTCCATGCCGGGGGCAAGTTTGGGGGCGGTGGCTATAAGGTATCCGGTGGTTTGCACGGGGTAGGGGTTTCCGTTGTTAACGCCCTGTCCGAATGGGTGGAAGTGAAGGTTTGGCGCCAGGGGAAGGAACACTTCCAGCGGTTTGAGCGGGGCAATCCCATTGGCACGCTAGAAGCTACCCCAAACGAAGGGCACTCCACAGGAACCCAGGTTTCTTTTTTGCCAGACACCCAGATTTTTAAGGATGGCATCGAGTTTGATTACCATACCCTGGCCAGTCGTCTCAAGGAGTTGGCCTACCTCAACGCTGGGGTTCGCATTACCTTTGGCGATCGCCGGGCGGATTCCCTCAAAGAAGAGCAGTTTTATTATGAAGGGGGCATTAGGGAATATGTCACCTATATGACCACGGACAAAACCCCGCTCCACGAGGAAATTATTTACACTTCCGGGGAAAAAAATGACGTCCAGGTGGAGGTGGCCCTCCAGTGGTGTGTGGATGCGTATAGTGATACTCTCTTGGGATTTGCCAACAATATCCGCACTATTGATGGTGGCACCCATTTAGAAGGTCTAAAAGCGGTTTTAACCCGTACTCTCAACTCCGTTGCCCGTAAGCGCAATAAGTTAAAGGATGGCGATAGTAATTTAGGGGGAGAAAATATTCGTGAGGGCCTAACCGGCGTTATTTCCGTTAAAGTACCGGACCCAGAATTTGAAGGACAAACCAAAACTAAATTGGGCAACACGGAAGTCCGGGGCATTGTGGATACCTTGGTGGGGGAAGCTCTAACGGAATTTTTAGAATTTAATCCTGGGGTTGCCGATGCCATCATTGAAAAAGCAGTGCAGGCTTTTAAAGCAGCGGAAGCAGCCCGTCGAGCCAGGGAATTAGTACGCCGTAAATCAGTTTTAGAGTCTTCAACTTTACCGGGTAAATTGGCAGACTGTAGCTCCAAAGATCCCTCGGAATCGGAAATTTTCATCGTGGAAGGAGACTCTGCCGGCGGCTGTTTTTCTGGAGATACATTAGTCGCTTTAACTGATGGTCGTAGCGTTAGCTTTGAGCAATTGGTTGAAGAAGAAAAACAAGGAAAACAAAACTTTTGTTATACCATCCGCCATGATGGTTCTATAGGGGTTGAAAAAATCATCAATGCCCGCAAAACAAAAACTAATGCGAAGGTAATCAAGGTTACGTTGGACAATGGTGAGTCTATTATTTGCACCCCGGATCATAAATTCATGTTGCGGGATGGGAGCTACAAATGTGCGATGGATTTAACTCTCGATGATTCGTTAATGCCGTTACACCGAAAAATTTCGACTACGGAAGATTCTGGTATTACAATTGATGGCTATGAAATGGTTTGGAGTCCCCGTTCCGATAGCTGGCTATTTACCCATTTAGTTGCAGACTGGTATAATCGTTGGCAGGGAATTTATATTGCAGAAGAAAAACAACATTGCCATCACAAAGACTTTAATAAGCGGAATAATAATCCCGATAATTTAATTCGCTTATCCCCTGAAAAACATTTAGCGCTTCACCGTAAGCACATTAGTAAAACATTACATCGCCCTGATGTGGTAGAGAAATGTCGTCGAATTCACCAAAGTCCTGAGTTTCGACGGAAAATGAGCGCAAGGATGCAATCACCGGAAACACGGGCAATTTTGTCCAAACAGGCCCAGGCCCAATGGCAAAATGAAACCTATAAATTAACAATGATGGAAAGTTGGCGTAGTTTCTACGACAGTAATGAGGATTATCGTCAGCAAAATGCAGAACAGCTAAATCGTGCTCAACAGGAATATTGGGCGCAGGCGGAGAATCGTACTGCTCAAGCAGAAAGGGTACGTCAACATTTCGCACAAAATCCTGGATTACGACAACAATATTCAGAGAATGCGGTTAAACAATGGAATAATCCCGAATTGTTGAAATGGCGACAGAAAAAAACAAAGGAACAATGGACTCCTGAATTTCGAGAAAAACGTCGAGAAGCTCTGGCCCAAACCTATTACCGCAAAACTCTAGCGGCACTAAAACAAGTTGAGATCGAAAATGGTTATTTAGACATATCTGCTTACGATAGCTATCGAATTTCGACTAAAGATAAATCCTTGTTACGTTTTGATCGATTCTGTGAACGGTATTTCGAGAATGATGAGAACCTCGCAAGGGAAGCAGTATTAAATTACAATCACAGAATTGTAAATATTGAAGCTGTGTCAGAAACAATCGATGTTTATGATATTGAGGTTCCCCACACCCACAATTTTGCTTTGGCAAGCGGAGTGTTTGTCCATAACAGCGCAAAACAAGGTCGAGACCGTCGTTTCCAAGCAATTTTGCCTTTACGGGGCAAGATTTTAAATATTGAAAAAACTGACGATGCCAAGATTTATAAAAATACTGAAATTCAAGCCTTAATTACAGCATTAGGTCTGGGCATTAAAGGTGATGATTTTGACATATCTTCCCTCCGCTATCACAGAGTAGTAATTATGACCGATGCTGATGTAGATGGAGCGCACATACGCACTCTTTTGTTGACTTTCTTCTACCGTTATCAGCGGGATTTGGTGGACCAAGGCTACATTTACATTGCCTGTCCGCCGTTGTACAAACTGGAGCGGGGTAAAAACCATTTCTATTGTTATTCCGACCGGGAATTGCAGGAGCAAATCAGTCAGTTTCCCCCCAATGCTAATTACACCATCCAGCGTTTTAAAGGTTTAGGGGAAATGATGCCCCAACAACTCTGGGATACCACGATGAATCCTGAAAGCCGCACCATGAAACGTGTCCACATTGAAGATGCCGCTGAAGCCGATCGCATTTTTACGGTGTTGATGGGCGATCGGGTAGCTCCCCGCCGGGAATTCATCGAAACCTATGGCACCAAGTTGGATCTAACTGACTTGGATATCTAG

Protein

MTMTTTNYGADQIQVLEGLEPVRKRPGMYIGSTGPKGLHHLVYEVVDNAIDEALAGYCTHIEIDINADGSVTVVDNGRGIPTDIHPTTGRSALETVLTVLHAGGKFGGGGYKVSGGLHGVGVSVVNALSEWVEVKVWRQGKEHFQRFERGNPIGTLEATPNEGHSTGTQVSFLPDTQIFKDGIEFDYHTLASRLKELAYLNAGVRITFGDRRADSLKEEQFYYEGGIREYVTYMTTDKTPLHEEIIYTSGEKNDVQVEVALQWCVDAYSDTLLGFANNIRTIDGGTHLEGLKAVLTRTLNSVARKRNKLKDGDSNLGGENIREGLTGVISVKVPDPEFEGQTKTKLGNTEVRGIVDTLVGEALTEFLEFNPGVADAIIEKAVQAFKAAEAARRARELVRRKSVLESSTLPGKLADCSSKDPSESEIFIVEGDSAGGCFSGDTLVALTDGRSVSFEQLVEEEKQGKQNFCYTIRHDGSIGVEKIINARKTKTNAKVIKVTLDNGESIICTPDHKFMLRDGSYKCAMDLTLDDSLMPLHRKISTTEDSGITIDGYEMVWSPRSDSWLFTHLVADWYNRWQGIYIAEEKQHCHHKDFNKRNNNPDNLIRLSPEKHLALHRKHISKTLHRPDVVEKCRRIHQSPEFRRKMSARMQSPETRAILSKQAQAQWQNETYKLTMMESWRSFYDSNEDYRQQNAEQLNRAQQEYWAQAENRTAQAERVRQHFAQNPGLRQQYSENAVKQWNNPELLKWRQKKTKEQWTPEFREKRREALAQTYYRKTLAALKQVEIENGYLDISAYDSYRISTKDKSLLRFDRFCERYFENDENLAREAVLNYNHRIVNIEAVSETIDVYDIEVPHTHNFALASGVFVHNSAKQGRDRRFQAILPLRGKILNIEKTDDAKIYKNTEIQALITALGLGIKGDDFDISSLRYHRVVIMTDADVDGAHIRTLLLTFFYRYQRDLVDQGYIYIACPPLYKLERGKNHFYCYSDRELQEQISQFPPNANYTIQRFKGLGEMMPQQLWDTTMNPESRTMKRVHIEDAAEADRIFTVLMGDRVAPRREFIETYGTKLDLTDLDI