Your browser is old and dusty. Try Google Chrome!

Details for sll1854

ORF sll1854
Accession NP_441916.1
Symbol
Category exodeoxyribonuclease III
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Forward -163 -149 15.4376 0.104
NP_441061.1_2 Forward -330 -316 22.3207 0.00505
NP_441061.1_2 Reverse -3 -17 5.99778 0.126
NP_441061.1_2 Reverse -155 -169 2.35953 0.177
NP_441061.1_2 Reverse -268 -282 0.491246 0.207
NP_440557.1_1 Forward -162 -143 0.884433 0.265
NP_440795.1_7 Forward -330 -323 14.6904 0.0123
NP_440795.1_7 Reverse -323 -330 14.6904 0.0123
NP_440795.1_7 Forward -162 -155 14.6904 0.0123
NP_440795.1_7 Reverse -155 -162 14.6904 0.0123
NP_441418.1_6 Forward -331 -312 -9.83364 0.0294
NP_441418.1_6 Reverse -154 -173 -18.4868 0.0832
NP_441418.1_6 Forward -163 -144 -28.2215 0.203
NP_441418.1_6 Reverse -322 -341 -30.1882 0.262
NP_443032.1_3 Reverse -229 -248 21.5339 0.157
NP_441480.1_5 Reverse -120 -139 11.1109 0.231
NP_442291.1_5 Forward -332 -316 8.41667 0.0558
NP_442291.1_5 Reverse -321 -337 1.14018 0.152
NP_440897.1_6 Forward -163 -144 0.588665 0.179
NP_441453.1_4 Reverse -322 -330 16.539 0.00633
NP_441453.1_4 Reverse -154 -162 16.539 0.00633
NP_441453.1_4 Forward -331 -323 16.539 0.00633
NP_441453.1_4 Forward -163 -155 16.539 0.00633
NP_441453.1_4 Reverse -97 -105 5.23096 0.157
NP_442151.1_6 Reverse -154 -168 20.4524 0.0045
NP_442151.1_6 Forward -163 -149 10.4227 0.123
NP_442151.1_6 Forward -331 -317 10.226 0.127
NP_442151.1_6 Forward -250 -236 6.98109 0.214
NP_441818.1_1 Forward -330 -319 10.1862 0.232
NP_441818.1_1 Reverse -155 -166 10.1862 0.232
NP_441818.1_9 Reverse -71 -90 8.16093 0.116
NP_441818.1_9 Reverse -65 -84 -7.27704 0.271
NP_441465.1_8 Forward -174 -156 6.01734 0.279
NP_440150.1_6 Reverse -319 -338 4.32602 0.245
NP_442744.1_8 Reverse -90 -109 -6.58872 0.297
NP_442655.1_1 Forward -168 -149 9.14423 0.0965
NP_442655.1_1 Reverse -149 -168 1.0811 0.238
NP_442173.1_1 Forward -330 -322 15.4574 0.00633
NP_442173.1_1 Forward -162 -154 15.4574 0.00633
NP_442173.1_1 Reverse -323 -331 15.4574 0.00633
NP_442173.1_1 Reverse -155 -163 15.4574 0.00633
NP_442752.1_4 Forward -331 -324 13.8055 0.0199
NP_442752.1_4 Reverse -322 -329 13.8055 0.0199
NP_442752.1_4 Forward -163 -156 13.8055 0.0199
NP_442752.1_4 Reverse -154 -161 13.8055 0.0199
NP_442752.1_4 Reverse -115 -122 5.54565 0.194
NP_443027.1_4 Reverse -320 -330 14.0414 0.0452
NP_443027.1_4 Reverse -152 -162 13.2547 0.0521
NP_443027.1_4 Forward -333 -323 5.87989 0.294
NP_441812.1_3 Forward -45 -31 6.88276 0.287
NP_442975.1_10 Forward -167 -153 11.2087 0.0508
NP_442975.1_10 Forward -335 -321 10.9137 0.0516
NP_442975.1_10 Reverse -150 -164 4.22722 0.245
NP_441225.1_4 Reverse -201 -220 -11.7019 0.284
NP_440784.1_7 Forward -330 -323 15.9687 0.0123
NP_440784.1_7 Reverse -323 -330 15.9687 0.0123
NP_440784.1_7 Forward -162 -155 15.9687 0.0123
NP_440784.1_7 Reverse -155 -162 15.9687 0.0123
NP_442909.1_7 Forward -330 -316 10.8154 0.131
NP_440061.1_9 Forward -165 -151 11.5037 0.109
NP_440061.1_9 Forward -333 -319 9.83206 0.137
NP_440110.1_8 Reverse -167 -186 -0.590531 0.225
NP_441054.1_2 Reverse -221 -240 10.6192 0.284
NP_441476.1_5 Forward -90 -71 -4.13045 0.246
NP_440878.1_4 Reverse -226 -244 9.95058 0.29
NP_440878.1_9 Reverse -263 -282 5.211 0.174
NP_441499.1_5 Reverse -196 -210 13.0776 0.284
NP_442062.1_8 Reverse -322 -332 19.4496 0.000558
NP_442062.1_8 Forward -331 -321 17.3846 0.00193
NP_442062.1_8 Reverse -154 -164 17.3846 0.00193
NP_442062.1_8 Forward -163 -153 10.3048 0.0493
NP_442062.1_8 Reverse -174 -184 4.40493 0.217
NP_440761.1_4 Forward -168 -149 -13.7669 0.257
NP_441859.1_4 Reverse -160 -179 14.7491 0.185
NP_440304.1_4 Reverse -320 -330 10.8948 0.051
NP_440304.1_4 Reverse -152 -162 10.8948 0.051
NP_440304.1_4 Forward -284 -274 3.02829 0.299
NP_440304.1_4 Forward -333 -323 1.84832 0.299
NP_440304.1_4 Forward -165 -155 1.84832 0.299
NP_442242.1_4 Forward -330 -323 14.3954 0.0124
NP_442242.1_4 Reverse -323 -330 14.3954 0.0124
NP_442242.1_4 Forward -162 -155 14.3954 0.0124
NP_442242.1_4 Reverse -155 -162 14.3954 0.0124
NP_440044.1_8 Reverse -155 -174 19.0757 0.0159
NP_440044.1_8 Forward -330 -311 5.01433 0.106
NP_441581.1_5 Forward -382 -363 15.2212 0.288
NP_440011.1_1 Forward -165 -146 14.7491 0.193
NP_440916.1_1 Reverse -141 -155 13.1759 0.206
NP_442602.1_3 Reverse -289 -308 -0.983855 0.226
NP_439918.1_2 Reverse -65 -84 -2.95047 0.251
NP_439918.1_3 Forward -334 -315 7.57094 0.252
NP_439923.1_5 Reverse -63 -82 13.7658 0.0934
NP_441208.1_9 Forward -166 -152 13.6676 0.103
NP_441594.1_6 Reverse -313 -332 13.0775 0.109
NP_442196.1_10 Reverse -152 -171 18.4857 0.126
NP_442110.1_7 Forward -163 -149 12.3893 0.0586
NP_442110.1_7 Forward -331 -317 10.7177 0.0644
NP_442110.1_7 Reverse -154 -168 9.93102 0.0684
NP_441082.1_10 Reverse -78 -91 9.95071 0.237
NP_441082.1_10 Reverse -59 -72 7.78743 0.296
NP_442726.1_4 Forward -156 -137 3.6377 0.285
NP_441925.1_4 Reverse -274 -293 -13.5709 0.257
NP_441925.1_4 Forward -93 -74 -17.6025 0.297
NP_440856.1_4 Reverse -147 -166 9.0459 0.0576
NP_441083.1_5 Forward -331 -321 20.3345 0.00053
NP_441083.1_5 Reverse -154 -164 20.3345 0.00053
NP_441083.1_5 Reverse -322 -332 11.3864 0.0159
NP_441083.1_5 Forward -163 -153 11.2881 0.0159
NP_441083.1_5 Reverse -241 -251 4.20827 0.153
NP_442115.2_4 Reverse -1 -20 7.76679 0.279
NP_441434.1_6 Reverse -369 -379 15.3197 0.277
NP_441738.1_2 Forward -329 -322 15.28 0.0102
NP_441738.1_2 Reverse -324 -331 15.28 0.0102
NP_441738.1_2 Forward -161 -154 15.28 0.0102
NP_441738.1_2 Reverse -156 -163 15.28 0.0102
NP_441558.1_5 Reverse -320 -339 14.5524 0.0485
NP_441558.1_5 Reverse -152 -171 12.4875 0.0677
NP_440209.1_1 Reverse -322 -330 18.1123 0.00295
NP_440209.1_1 Reverse -154 -162 18.1123 0.00295
NP_440209.1_1 Forward -331 -323 18.1123 0.00295
NP_440209.1_1 Forward -163 -155 18.1123 0.00295
NP_442889.1_8 Forward -334 -320 11.4053 0.0733
NP_442889.1_8 Reverse -151 -165 11.307 0.0733
NP_440056.1_1 Forward -281 -262 7.86593 0.297
NP_441713.1_1 Reverse -316 -335 -5.9004 0.114
NP_441770.1_10 Reverse -152 -171 8.16093 0.284
NP_440178.1_7 Reverse -199 -218 -22.9117 0.282
NP_441792.1_5 Forward -79 -63 8.41667 0.274
NP_441716.1_1 Forward -331 -317 19.4691 0.00947
NP_441716.1_1 Reverse -322 -336 7.07942 0.181
NP_442111.1_4 Forward -164 -150 22.6157 0.000842
NP_442111.1_4 Reverse -321 -335 15.6342 0.0204
NP_442111.1_4 Forward -332 -318 2.94952 0.259
NP_441163.1_1 Forward -388 -371 11.1495 0.194
NP_441163.1_1 Forward -339 -322 8.39624 0.232
NP_440906.1_5 Forward -330 -323 15.8704 0.0124
NP_440906.1_5 Reverse -323 -330 15.8704 0.0124
NP_440906.1_5 Forward -162 -155 15.8704 0.0124
NP_440906.1_5 Reverse -155 -162 15.8704 0.0124
NP_440906.1_5 Reverse -98 -105 8.20058 0.19
NP_440747.1_10 Reverse -319 -331 17.2469 0.000522
NP_440747.1_10 Reverse -151 -163 17.1486 0.000663
NP_440747.1_10 Forward -166 -154 14.9853 0.00221
NP_440747.1_10 Forward -334 -322 5.44718 0.0137
NP_441130.1_10 Reverse -320 -334 9.34103 0.126
NP_442973.1_5 Reverse -145 -164 16.1257 0.105
NP_441486.1_1 Forward -334 -320 20.2558 0.00309
NP_441486.1_1 Reverse -319 -333 13.4709 0.00839
NP_441486.1_1 Forward -166 -152 6.29277 0.0344
NP_441486.1_1 Reverse -151 -165 -2.55701 0.175
NP_442634.1_4 Forward -165 -151 -1.27871 0.149
NP_442634.1_4 Forward -333 -319 -1.67204 0.149
NP_442634.1_4 Reverse -152 -166 -1.96703 0.149
NP_441265.1_3 Reverse -148 -162 2.94952 0.181
NP_440403.1_10 Forward -172 -153 11.7992 0.177
NP_440403.1_10 Reverse -313 -332 0.884433 0.293
NP_440842.1_10 Reverse -20 -34 2.5562 0.274
NP_441014.1_5 Forward -168 -150 9.65558 0.275
NP_441014.1_8 Reverse -9 -28 11.9958 0.0935
NP_441014.1_8 Reverse -274 -293 -4.42544 0.25
NP_441014.1_10 Forward -353 -334 -3.34455 0.298
NP_442848.1_1 Reverse -316 -330 8.06273 0.0791
NP_442848.1_1 Forward -169 -155 -1.96703 0.263
NP_442848.1_1 Reverse -109 -123 -4.22864 0.282
NP_441012.1_4 Reverse -318 -331 7.49244 0.272
NP_441012.1_4 Forward -323 -310 6.4108 0.279
NP_443018.1_3 Forward -330 -323 14.8871 0.0123
NP_443018.1_3 Reverse -323 -330 14.8871 0.0123
NP_443018.1_3 Forward -162 -155 14.8871 0.0123
NP_443018.1_3 Reverse -155 -162 14.8871 0.0123
NP_441634.1_8 Reverse -320 -334 12.6843 0.0486
NP_441634.1_8 Reverse -152 -166 -4.32697 0.295
NP_441634.1_9 Forward -188 -169 15.7316 0.165
NP_440376.1_1 Forward -331 -322 19.4693 0.000692
NP_440376.1_1 Reverse -322 -331 19.4693 0.000692
NP_440376.1_1 Forward -163 -154 19.4693 0.000692
NP_440376.1_1 Reverse -154 -163 19.4693 0.000692
NP_440376.1_1 Reverse -347 -356 2.94966 0.213
NP_440376.1_1 Forward -24 -15 0.196389 0.283
NP_441857.1_5 Forward -170 -152 3.55906 0.243
NP_441588.1_4 Reverse -156 -166 18.1713 0.0143
NP_441588.1_4 Reverse -324 -334 7.25653 0.178
NP_442687.1_7 Forward -332 -322 15.8113 0.0125
NP_442687.1_7 Reverse -153 -163 9.02648 0.0994
NP_442687.1_7 Reverse -321 -331 8.92815 0.0994
NP_442687.1_7 Forward -164 -154 8.92815 0.0994
NP_442687.1_7 Forward -251 -241 6.17489 0.178
NP_442687.1_7 Forward -209 -199 5.87989 0.183
NP_442191.1_4 Forward -162 -148 18.2649 0.00956
NP_442485.1_3 Forward -174 -155 -4.03212 0.277
NP_442485.1_3 Reverse -311 -330 -5.21209 0.287
NP_442530.1_2 Reverse -27 -37 11.9764 0.282
NP_440642.1_10 Reverse -145 -159 3.04726 0.277
NP_440642.1_10 Forward -376 -362 2.75226 0.277
NP_441013.1_2 Reverse -305 -323 -4.8974 0.299
NP_441422.1_7 Reverse -271 -288 -1.82945 0.194
NP_441422.1_7 Forward -333 -316 -2.81276 0.223
NP_440533.1_6 Reverse -181 -200 6.88262 0.297
NP_441950.1_7 Forward -294 -275 -0.590531 0.191
NP_442296.1_9 Reverse -323 -342 -3.63879 0.256
NP_442658.1_1 Forward -333 -323 15.9091 0.00966
NP_442658.1_1 Reverse -152 -162 14.2375 0.0237
NP_442658.1_1 Reverse -320 -330 6.76441 0.214
NP_442658.1_1 Forward -165 -155 6.76441 0.214
NP_442782.1_2 Forward -163 -149 8.16106 0.198
NP_442782.1_2 Reverse -115 -129 3.93283 0.257
NP_442782.1_2 Forward -183 -169 1.08123 0.282
NP_442782.1_7 Reverse -314 -333 2.94938 0.193
NP_442205.1_9 Forward -337 -321 -2.98973 0.277
NP_441414.1_9 Reverse -322 -341 -1.67217 0.103
NP_441414.1_9 Reverse -154 -173 -9.047 0.252
NP_440720.1_1 Forward -35 -16 3.04771 0.263
NP_442300.1_5 Forward -333 -314 10.6192 0.293
NP_442937.1_5 Reverse -311 -330 9.73422 0.183
NP_441958.1_5 Reverse -153 -163 21.2195 0.000805
NP_441958.1_5 Forward -332 -322 12.2714 0.00183
NP_441958.1_5 Reverse -321 -331 12.2714 0.00183
NP_441958.1_5 Forward -164 -154 12.2714 0.00183
NP_441127.1_1 Forward -217 -203 10.3243 0.251
NP_441127.1_1 Forward -282 -268 9.73436 0.268
NP_441127.1_1 Reverse -161 -175 7.66941 0.3
NP_442836.1_5 Reverse -2 -21 7.57094 0.158
NP_442836.1_5 Reverse -316 -335 0.687771 0.299
NP_440203.1_5 Forward -328 -318 15.7125 0.0611
NP_439905.1_1 Reverse -161 -174 7.39411 0.262
NP_439905.1_2 Reverse -268 -282 7.66941 0.296
NP_440984.1_7 Reverse -149 -163 10.0294 0.126
NP_440984.1_7 Forward -168 -154 9.04604 0.131
NP_440984.1_7 Reverse -195 -209 6.29277 0.219
NP_441097.1_2 Reverse -111 -128 8.29864 0.236
NP_439990.1_5 Reverse -317 -330 11.3273 0.128
NP_439990.1_5 Reverse -149 -162 10.639 0.128
NP_439990.1_5 Forward -168 -155 9.95071 0.128
NP_442911.1_2 Forward -341 -322 7.96426 0.0225
NP_442911.1_2 Reverse -312 -331 -2.55715 0.0995
NP_442911.1_2 Reverse -144 -163 -2.75381 0.102
NP_441580.1_6 Forward -117 -98 -1.08219 0.183
NP_441580.1_6 Forward -174 -155 -6.68705 0.235
NP_440153.1_5 Forward -330 -316 5.80112 0.191
NP_440153.1_5 Forward -162 -148 5.30946 0.191
NP_440153.1_5 Reverse -323 -337 4.22782 0.199
NP_442064.1_4 Reverse -306 -325 11.7 0.174
NP_442064.1_4 Reverse -312 -331 7.57013 0.242
NP_442051.1_5 Forward -20 -1 11.1109 0.29
NP_443055.1_6 Reverse -140 -158 7.68819 0.156
NP_440993.1_2 Reverse -149 -165 3.69678 0.256
NP_440993.1_3 Reverse -144 -163 16.4199 0.0527
NP_440138.1_1 Forward -137 -119 5.42659 0.292
NP_440138.1_6 Forward -330 -311 11.6017 0.13
NP_441099.1_5 Reverse -312 -331 7.17762 0.0429
NP_442002.1_9 Forward -332 -325 10.7572 0.185
NP_440809.1_9 Reverse -232 -250 0.510803 0.179
NP_440809.1_9 Forward -340 -322 -6.66736 0.225
NP_441294.1_7 Forward -335 -321 22.3051 0.000537
NP_441294.1_7 Forward -167 -153 13.7621 0.0568
NP_441294.1_7 Reverse -325 -339 10.4025 0.191
NP_441646.1_1 Forward -338 -319 5.89931 0.175
NP_441646.1_1 Reverse -309 -328 -1.37718 0.284
NP_442438.1_10 Reverse -317 -331 8.84938 0.0718
NP_442438.1_10 Forward -168 -154 6.48943 0.114
NP_442438.1_10 Forward -336 -322 5.1128 0.139
NP_442438.1_10 Reverse -149 -163 1.76955 0.188
NP_441000.1_6 Reverse -321 -335 4.71948 0.0933
NP_440147.1_4 Forward -165 -152 18.4072 0.00407
NP_440147.1_4 Forward -333 -320 12.6056 0.0326
NP_440147.1_4 Reverse -152 -165 10.344 0.0355
NP_440147.1_4 Reverse -320 -333 0.904263 0.244
NP_441550.1_8 Reverse -152 -162 15.8108 0.0132
NP_441550.1_8 Forward -165 -155 14.6309 0.0132
NP_441550.1_8 Reverse -320 -330 12.3692 0.0336
NP_441550.1_8 Forward -333 -323 8.3377 0.124
NP_441916.1_5 Forward -40 -21 21.5339 0.105
NP_441916.1_6 Forward -355 -336 18.4857 0.228
NP_441916.1_7 Forward -163 -153 18.9579 0.00144
NP_441916.1_7 Reverse -322 -332 18.4663 0.00144
NP_441916.1_7 Forward -331 -321 10.3048 0.0261
NP_441916.1_7 Reverse -154 -164 10.3048 0.0261
NP_441916.1_7 Reverse -97 -107 4.50326 0.174
NP_441041.1_4 Reverse -154 -173 2.94938 0.0684
NP_441041.1_4 Forward -331 -312 -10.4236 0.232
NP_441041.1_4 Reverse -310 -329 -13.2752 0.285
NP_441041.1_7 Reverse -151 -163 13.3454 0.0485
NP_441041.1_7 Forward -166 -154 11.8878 0.0689
NP_441041.1_7 Forward -334 -322 9.65268 0.108
NP_442396.1_5 Forward -335 -322 8.47575 0.153
NP_441547.1_2 Reverse -311 -329 13.7855 0.0948
NP_442004.1_6 Forward -331 -317 8.45605 0.14
NP_441725.1_4 Reverse -149 -163 13.7653 0.0693
NP_441725.1_4 Reverse -317 -331 3.63724 0.278
NP_441725.1_5 Forward -330 -320 11.2881 0.0247
NP_441725.1_5 Reverse -323 -333 2.04498 0.115
NP_441725.1_5 Reverse -155 -165 2.04498 0.115
NP_441725.1_5 Forward -162 -152 1.94665 0.115
NP_439966.1_7 Reverse -320 -330 15.8108 0.0124
NP_439966.1_7 Reverse -152 -162 14.3359 0.0203
NP_439966.1_7 Forward -333 -323 9.91099 0.0968
NP_439966.1_7 Forward -165 -155 7.25606 0.15
NP_439966.1_9 Forward -333 -324 0.884706 0.253
NP_442941.1_3 Forward -330 -320 19.9412 0.00262
NP_442941.1_3 Forward -162 -152 19.2529 0.00262
NP_442941.1_3 Reverse -155 -165 11.0914 0.0116
NP_442941.1_3 Reverse -323 -333 2.63497 0.14
NP_440289.1_2 Forward -334 -321 3.16588 0.0811
NP_440289.1_2 Reverse -151 -164 3.16588 0.0811
NP_440289.1_2 Forward -166 -153 -2.24233 0.253
NP_440289.1_2 Reverse -319 -332 -2.93064 0.262
NP_440983.1_5 Forward -91 -72 -5.70374 0.27
NP_440260.1_8 Forward -172 -154 6.214 0.154
NP_440260.1_8 Reverse -41 -59 -5.19239 0.273
NP_440260.1_8 Forward -187 -169 -6.37237 0.29
NP_442281.1_1 Reverse -317 -331 17.6002 0.00542
NP_442281.1_1 Forward -168 -154 17.5018 0.00555
NP_442281.1_1 Reverse -149 -163 16.5185 0.00772
NP_442281.1_1 Forward -78 -64 1.5723 0.296
NP_441334.1_7 Reverse -152 -171 -11.8003 0.126
NP_441334.1_7 Forward -165 -146 -19.9617 0.275
NP_442575.1_8 Forward -23 -4 -6.78538 0.286
NP_440177.1_9 Forward -290 -271 11.9958 0.239
NP_442256.1_2 Forward -165 -147 -0.374176 0.14
NP_442256.1_2 Reverse -152 -170 -5.68405 0.214
NP_440437.1_1 Reverse -148 -167 3.44104 0.121
NP_440437.1_1 Reverse -29 -48 0.196116 0.172
NP_440437.1_1 Forward -130 -111 -2.75381 0.224
NP_441087.1_6 Reverse -8 -26 -3.12816 0.296
NP_441457.1_7 Reverse -33 -52 1.57275 0.276
NP_441556.1_10 Forward -337 -323 10.3192 0.27
NP_440498.1_1 Forward -340 -322 -3.22577 0.259
NP_442982.1_5 Reverse -144 -163 6.88262 0.139
NP_442982.1_5 Forward -90 -71 -1.08219 0.263
NP_440375.1_8 Reverse -155 -174 6.98095 0.166
NP_441644.1_6 Forward -163 -153 19.0557 0.000803
NP_441644.1_6 Forward -331 -321 17.3841 0.00127
NP_441644.1_6 Reverse -154 -164 17.3841 0.00127
NP_441644.1_6 Reverse -322 -332 10.1076 0.0628
NP_441644.1_6 Forward -325 -315 6.96107 0.141
NP_441644.1_6 Reverse -273 -283 6.37109 0.161
NP_441644.1_6 Reverse -199 -209 4.10949 0.249
NP_441644.1_6 Reverse -329 -339 3.51951 0.277
NP_440867.1_10 Forward -32 -13 2.65439 0.283
NP_442215.1_2 Forward -333 -317 14.0215 0.021
NP_442215.1_2 Forward -165 -149 9.10498 0.0601
NP_442215.1_2 Reverse -152 -168 8.61333 0.0631
NP_442215.1_2 Reverse -313 -329 -4.36636 0.232
NP_442215.1_2 Forward -192 -176 -6.82463 0.28
NP_442029.1_1 Forward -327 -308 -16.1268 0.272
NP_442029.1_1 Forward -284 -265 -20.4534 0.298
NP_442029.1_6 Forward -168 -149 13.6675 0.137
NP_442029.1_6 Forward -22 -3 3.04771 0.286
NP_440253.1_2 Reverse -154 -172 -0.964162 0.227
NP_440253.1_2 Forward -331 -313 -2.24246 0.262
NP_440929.1_8 Forward -331 -322 19.2726 0.000701
NP_440929.1_8 Reverse -322 -331 19.2726 0.000701
NP_440929.1_8 Forward -163 -154 19.2726 0.000701
NP_440929.1_8 Reverse -154 -163 19.2726 0.000701
NP_442933.1_10 Forward -331 -322 17.601 0.00325
NP_442933.1_10 Reverse -322 -331 17.601 0.00325
NP_442933.1_10 Forward -163 -154 17.601 0.00325
NP_442933.1_10 Reverse -154 -163 17.601 0.00325
NP_442933.1_10 Forward -106 -97 4.12963 0.28
NP_441751.2_8 Forward -330 -316 17.6992 0.00776
NP_441751.2_8 Reverse -323 -337 -0.885388 0.129
NP_441751.2_8 Forward -162 -148 -2.16369 0.132
NP_441751.2_8 Forward -182 -168 -4.91696 0.187
NP_442554.1_8 Forward -162 -152 17.2863 0.00543
NP_442554.1_8 Forward -330 -320 15.9097 0.00747
NP_442554.1_8 Reverse -155 -165 15.3197 0.00882
NP_442554.1_8 Reverse -323 -333 13.2547 0.0187
NP_442554.1_8 Forward -324 -314 4.50326 0.184
NP_442554.1_8 Reverse -242 -252 3.51995 0.222
NP_441762.1_7 Reverse -321 -333 10.1671 0.0142
NP_441762.1_7 Forward -332 -320 2.30059 0.0676
NP_441762.1_7 Reverse -153 -165 0.530633 0.0747
NP_441762.1_7 Forward -164 -152 -6.84419 0.284
NP_442142.1_4 Reverse -319 -332 18.0132 0.0255
NP_442142.1_4 Reverse -151 -164 12.9 0.0406
NP_442142.1_4 Forward -166 -153 11.5234 0.0552
NP_442142.1_4 Reverse -171 -184 10.4418 0.0724
NP_442142.1_4 Forward -334 -321 4.73861 0.212
NP_442142.1_4 Reverse -87 -100 2.772 0.278
NP_442292.1_1 Forward -330 -321 18.486 0.00229
NP_442292.1_1 Reverse -155 -164 18.486 0.00229
NP_442292.1_1 Forward -162 -153 17.5026 0.00435
NP_442292.1_1 Reverse -323 -332 9.63616 0.0183
NP_442292.1_2 Forward -145 -131 16.2281 0.269
NP_443009.1_5 Reverse -321 -332 18.3477 0.00265
NP_443009.1_5 Forward -164 -153 14.5128 0.02
NP_443009.1_5 Reverse -153 -164 10.1862 0.0792
NP_443009.1_5 Reverse -173 -184 9.59626 0.0939
NP_441715.1_4 Forward -162 -152 16.7946 0.0106
NP_441715.1_4 Forward -330 -320 14.828 0.0268
NP_441715.1_4 Reverse -323 -333 9.41981 0.097
NP_441715.1_4 Reverse -155 -165 7.94484 0.107
NP_440357.1_3 Forward -333 -314 -0.000545616 0.285
NP_440279.1_2 Reverse -311 -330 9.43923 0.179
NP_440279.1_2 Reverse -65 -84 8.94757 0.189
NP_441198.1_5 Reverse -156 -169 13.9817 0.206
NP_440379.1_5 Forward -367 -348 -11.4069 0.296
NP_440379.1_6 Forward -163 -144 11.7008 0.191
NP_440464.1_10 Reverse -155 -165 13.0082 0.169
NP_441468.1_1 Forward -330 -323 15.8704 0.0124
NP_441468.1_1 Reverse -323 -330 15.8704 0.0124
NP_441468.1_1 Forward -162 -155 15.8704 0.0124
NP_441468.1_1 Reverse -155 -162 15.8704 0.0124
NP_442099.1_1 Reverse -229 -247 14.0805 0.274
NP_441020.2_6 Forward -165 -148 10.8552 0.133
NP_441015.1_8 Reverse -16 -35 5.99764 0.258
NP_441015.1_10 Reverse -149 -168 -7.17871 0.264
NP_441015.1_10 Reverse -317 -336 -8.06369 0.272
NP_441015.1_10 Forward -168 -149 -10.7186 0.287
NP_441015.1_10 Forward -330 -311 -10.817 0.288
NP_441015.1_10 Reverse -311 -330 -11.4069 0.296
NP_441673.1_1 Forward -331 -322 20.8459 0.000698
NP_441673.1_1 Reverse -322 -331 20.8459 0.000698
NP_441673.1_1 Forward -163 -154 20.8459 0.000698
NP_441673.1_1 Reverse -154 -163 20.8459 0.000698
NP_442253.1_5 Reverse -196 -213 -6.84433 0.298
NP_441956.1_1 Reverse -369 -388 17.5506 0.225
NP_440265.1_7 Forward -276 -262 14.5519 0.282
NP_441826.1_2 Reverse -316 -330 21.9274 0.00378
NP_441826.1_2 Forward -169 -155 7.07942 0.0899
NP_441826.1_2 Forward -337 -323 1.67122 0.144
NP_441826.1_2 Reverse -148 -162 -1.77037 0.254
NP_441826.1_2 Reverse -91 -105 -3.24533 0.284
NP_441826.1_5 Forward -29 -10 0.982764 0.298
NP_441330.1_1 Reverse -149 -168 -2.75381 0.0791
NP_442490.1_9 Reverse -310 -329 -7.76869 0.278
NP_442868.1_6 Reverse -152 -162 10.4031 0.038
NP_442868.1_6 Reverse -320 -330 9.91146 0.038
NP_442868.1_6 Forward -165 -155 9.81313 0.038
NP_442868.1_6 Forward -284 -274 5.09324 0.158
NP_442868.1_6 Forward -333 -323 0.865012 0.205
NP_442719.1_2 Forward -389 -371 -1.25988 0.175
NP_441056.1_1 Forward -331 -312 4.71934 0.117
NP_441056.1_1 Reverse -154 -173 -8.85033 0.285
NP_441612.1_2 Reverse -154 -164 8.54929 0.21
NP_441612.1_2 Forward -331 -321 8.54929 0.21
NP_442227.1_2 Reverse -4 -23 0.392778 0.252
NP_442361.1_3 Forward -169 -156 18.2105 0.0481
NP_442361.1_3 Reverse -148 -161 10.049 0.272
NP_442361.1_3 Reverse -316 -329 7.59077 0.3
NP_442808.1_1 Forward -332 -322 18.4657 0.00201
NP_442808.1_1 Reverse -153 -163 8.73102 0.0481
NP_442808.1_1 Reverse -321 -331 8.63269 0.0481
NP_442808.1_1 Forward -164 -154 8.63269 0.0481
NP_441101.1_10 Reverse -318 -337 11.3075 0.119
NP_442775.1_6 Reverse -98 -117 9.73422 0.292
NP_440031.1_10 Reverse -305 -324 1.96607 0.264
NP_440145.1_3 Forward -219 -200 1.0811 0.131
NP_440145.1_3 Forward -173 -154 -0.197208 0.14
NP_440145.1_3 Reverse -144 -163 -6.1954 0.292
NP_442542.1_2 Forward -333 -320 11.3273 0.114
NP_442542.1_2 Reverse -89 -102 5.52582 0.262
NP_442542.1_2 Forward -26 -13 5.32916 0.272
NP_442542.1_9 Forward -170 -156 4.52221 0.294
NP_442505.1_3 Reverse -365 -382 18.1317 0.22
NP_442050.1_5 Reverse -320 -330 16.4991 0.00812
NP_442050.1_5 Reverse -152 -162 15.9091 0.0091
NP_442050.1_5 Forward -165 -155 7.64939 0.243
NP_441114.1_3 Forward -72 -63 7.86621 0.231
NP_440558.1_2 Reverse -313 -332 5.60432 0.142
NP_440558.1_2 Reverse -145 -164 -3.3438 0.234
NP_441518.1_3 Forward -173 -154 -12.7836 0.263
NP_441518.1_10 Forward -185 -167 14.8663 0.217
NP_441878.1_6 Reverse -153 -163 10.5014 0.0176
NP_441878.1_6 Forward -332 -322 10.4031 0.0176
NP_441878.1_6 Reverse -321 -331 10.4031 0.0176
NP_441878.1_6 Forward -164 -154 10.4031 0.0176
NP_441878.1_6 Forward -364 -354 0.963343 0.128
NP_441878.1_6 Reverse -83 -93 0.373358 0.144
NP_441878.1_6 Forward -251 -241 -0.41329 0.177
NP_441878.1_6 Forward -209 -199 -7.29646 0.217
NP_441878.1_6 Reverse -198 -208 -7.59145 0.245
NP_441036.1_8 Forward -332 -322 17.7779 0.000554
NP_441036.1_8 Reverse -153 -163 15.713 0.00724
NP_441036.1_8 Reverse -321 -331 8.33817 0.174
NP_441036.1_8 Forward -164 -154 8.33817 0.174
NP_442650.1_2 Forward -331 -317 6.58777 0.13
NP_441557.1_5 Forward -331 -322 19.9609 0.000699
NP_441557.1_5 Reverse -322 -331 19.9609 0.000699
NP_441557.1_5 Forward -163 -154 19.9609 0.000699
NP_441557.1_5 Reverse -154 -163 19.9609 0.000699
NP_441445.1_1 Forward -340 -321 10.5209 0.0945
NP_441445.1_1 Reverse -232 -251 2.55606 0.233
NP_441445.1_5 Reverse -5 -24 17.8948 0.189
NP_442066.2_4 Forward -331 -312 -0.4922 0.173
NP_442066.2_4 Forward -163 -144 -8.85033 0.296
NP_441433.1_8 Forward -163 -144 5.70265 0.178
NP_442419.1_2 Reverse -311 -330 -4.32711 0.285
NP_440101.1_3 Reverse -149 -168 6.78429 0.181
NP_440101.1_3 Forward -336 -317 5.80098 0.19
NP_441458.1_10 Reverse -145 -164 7.7676 0.192
NP_441458.1_10 Reverse -313 -332 5.70265 0.212
NP_442183.1_1 Forward -331 -317 16.3225 0.0151
NP_442166.1_7 Forward -162 -148 13.3726 0.175
NP_440595.1_8 Forward -331 -312 16.3224 0.156
NP_441574.1_1 Reverse -115 -134 -4.81876 0.254
NP_442347.1_2 Forward -330 -321 12.4878 0.056
NP_442347.1_2 Reverse -155 -164 12.4878 0.056
NP_442347.1_2 Reverse -323 -332 11.1111 0.056
NP_442347.1_2 Forward -123 -114 5.70292 0.226
NP_442347.1_2 Forward -162 -153 3.34298 0.284
NP_442645.1_2 Reverse -314 -333 -7.76869 0.114
NP_442645.1_2 Reverse -166 -185 -20.5517 0.288
NP_442645.1_2 Forward -171 -152 -22.125 0.29
NP_441037.1_4 Forward -333 -323 14.7245 0.028
NP_441037.1_4 Forward -165 -155 7.9999 0.237
NP_441037.1_4 Reverse -152 -162 7.22024 0.237
NP_442317.1_6 Forward -388 -369 6.39097 0.238
NP_442317.1_6 Reverse -194 -213 2.75272 0.27
NP_441633.1_3 Forward -333 -320 3.36254 0.0699
NP_441633.1_3 Reverse -320 -333 1.39592 0.109
NP_441633.1_3 Forward -165 -152 1.10092 0.109
NP_441633.1_3 Reverse -152 -165 -3.71729 0.177
NP_441633.1_3 Reverse -13 -26 -7.25721 0.3
NP_442764.1_6 Reverse -156 -174 13.0972 0.0942
NP_440136.1_2 Forward -330 -323 15.9687 0.0123
NP_440136.1_2 Reverse -323 -330 15.9687 0.0123
NP_440136.1_2 Forward -162 -155 15.9687 0.0123
NP_440136.1_2 Reverse -155 -162 15.9687 0.0123
NP_442590.1_10 Forward -338 -319 9.24257 0.2
NP_442998.1_5 Forward -384 -374 10.9931 0.199
NP_442998.1_5 Reverse -116 -126 9.12481 0.252
NP_442998.1_5 Reverse -28 -38 8.53483 0.261
NP_442998.1_10 Forward -329 -322 15.5754 0.0102
NP_442998.1_10 Reverse -324 -331 15.5754 0.0102
NP_442998.1_10 Forward -161 -154 15.5754 0.0102
NP_442998.1_10 Reverse -156 -163 15.5754 0.0102
NP_442998.1_10 Reverse -269 -276 3.97235 0.297
NP_440899.1_2 Reverse -143 -162 6.58682 0.263
NP_440299.1_1 Reverse -318 -331 22.3398 0.000547
NP_440299.1_1 Forward -335 -322 14.08 0.0259
NP_440299.1_1 Forward -167 -154 14.08 0.0259
NP_440299.1_1 Reverse -150 -163 11.1301 0.0518
NP_440299.1_1 Reverse -93 -106 4.54195 0.207
NP_440299.1_1 Reverse -275 -288 3.26365 0.251
NP_441799.1_1 Forward -335 -321 17.3052 0.011
NP_441799.1_1 Forward -167 -153 7.96378 0.128
NP_441799.1_1 Reverse -318 -332 7.86545 0.13
NP_441799.1_1 Reverse -150 -164 7.76712 0.133
NP_440640.1_6 Reverse -29 -48 -0.787193 0.292
NP_441007.1_10 Reverse -149 -162 1.29759 0.203
NP_441007.1_10 Forward -168 -155 0.60927 0.221
NP_441007.1_10 Reverse -317 -330 -0.865694 0.295
NP_442201.1_10 Forward -342 -323 3.6377 0.0961
NP_442201.1_10 Reverse -143 -162 -9.53865 0.246
NP_442201.1_10 Reverse -311 -330 -13.5702 0.274
NP_442333.2_5 Reverse -311 -330 -10.227 0.246
NP_440256.1_1 Forward -166 -147 14.3558 0.0087
NP_440256.1_1 Reverse -151 -170 12.6841 0.0114
NP_440256.1_1 Reverse -171 -190 1.17943 0.0775
NP_440256.1_1 Reverse -319 -338 -0.688862 0.0954
NP_440256.1_1 Reverse -61 -80 -2.0655 0.112
NP_441512.1_4 Reverse -150 -169 9.93088 0.237
NP_441559.1_8 Reverse -149 -163 10.9143 0.0574
NP_441559.1_8 Forward -336 -322 9.63603 0.0625
NP_441559.1_8 Reverse -317 -331 -6.68692 0.279
NP_442860.1_3 Forward -333 -314 8.75091 0.258
NP_440915.1_6 Forward -167 -153 13.4709 0.0187
NP_440915.1_6 Reverse -150 -164 10.6193 0.0301
NP_440915.1_6 Reverse -318 -332 3.8345 0.1
NP_440915.1_6 Forward -15 -1 0.491246 0.162
NP_440915.1_6 Forward -187 -173 -2.36035 0.268
NP_440915.1_6 Forward -213 -199 -2.95034 0.287
NP_442158.1_4 Forward -34 -24 11.3864 0.278
NP_441296.1_8 Reverse -77 -96 14.5524 0.258
NP_442785.1_7 Reverse -152 -166 10.6193 0.228
NP_442785.1_7 Reverse -320 -334 10.0294 0.231
NP_442452.1_8 Reverse -148 -162 11.897 0.273
NP_442866.1_1 Forward -336 -317 0.294447 0.183
NP_441464.1_8 Reverse -199 -213 8.75105 0.194
NP_441464.1_8 Reverse -322 -336 5.50613 0.253
NP_441464.1_10 Forward -365 -351 9.73436 0.262
NP_441939.1_3 Forward -162 -143 22.8122 0.00342
NP_441494.1_6 Reverse -149 -162 6.01747 0.289
NP_442993.1_1 Reverse -322 -338 -7.51295 0.146
NP_440677.1_1 Forward -340 -321 12.9791 0.136
NP_440677.1_6 Reverse -145 -164 7.86593 0.284
NP_442386.1_9 Forward -332 -323 15.7322 0.0144
NP_442386.1_9 Reverse -321 -330 13.8639 0.0289
NP_442386.1_9 Forward -164 -155 13.8639 0.0289
NP_442386.1_9 Reverse -153 -162 6.39082 0.219
NP_440570.1_5 Reverse -306 -325 4.03102 0.231
NP_441340.1_5 Forward -330 -323 15.6737 0.0124
NP_441340.1_5 Reverse -323 -330 15.6737 0.0124
NP_441340.1_5 Forward -162 -155 15.6737 0.0124
NP_441340.1_5 Reverse -155 -162 15.6737 0.0124
NP_441947.1_4 Forward -174 -155 11.7992 0.246
NP_442484.1_2 Forward -174 -155 15.4374 0.0373
NP_442484.1_2 Reverse -4 -23 3.73603 0.197
NP_440327.1_6 Reverse -65 -84 6.39097 0.239
NP_442240.1_1 Reverse -7 -26 7.4718 0.253
NP_442240.1_2 Forward -162 -143 -0.983855 0.0609
NP_442240.1_2 Forward -330 -311 -12.2919 0.163
NP_440161.1_3 Reverse -172 -191 16.2241 0.084
NP_442714.1_5 Forward -281 -262 14.3558 0.0828
NP_440586.1_1 Forward -292 -273 -2.16383 0.25
NP_440586.1_1 Forward -338 -319 -4.13045 0.278
NP_440586.1_8 Forward -330 -323 13.2151 0.026
NP_440586.1_8 Forward -162 -155 13.2151 0.026
NP_440586.1_8 Reverse -323 -330 13.2151 0.026
NP_440586.1_8 Reverse -155 -162 13.2151 0.026
NP_440586.1_8 Forward -43 -36 10.7568 0.128
NP_440586.1_8 Forward -324 -317 5.8403 0.283
NP_442251.1_6 Forward -330 -323 15.2804 0.0124
NP_442251.1_6 Reverse -323 -330 15.2804 0.0124
NP_442251.1_6 Forward -162 -155 15.2804 0.0124
NP_442251.1_6 Reverse -155 -162 15.2804 0.0124
NP_440684.1_9 Reverse -316 -330 15.2409 0.0988
NP_440684.1_9 Forward -337 -323 8.94771 0.221
NP_441262.1_3 Reverse -322 -329 14.7888 0.0223
NP_441262.1_3 Reverse -154 -161 14.7888 0.0223
NP_441262.1_3 Forward -331 -324 14.7888 0.0223
NP_441262.1_3 Forward -163 -156 14.7888 0.0223
NP_440027.1_3 Reverse -154 -172 4.34495 0.262
NP_440027.1_3 Reverse -316 -334 3.8533 0.263
NP_440027.1_8 Forward -166 -147 9.43841 0.243
NP_440027.1_8 Forward -334 -315 6.68515 0.27
NP_443051.1_1 Reverse -153 -162 19.5676 0.00335
NP_443051.1_1 Reverse -321 -330 10.4228 0.00754
NP_443051.1_1 Forward -332 -323 10.4228 0.00754
NP_443051.1_1 Forward -164 -155 10.4228 0.00754
NP_439937.1_8 Forward -333 -314 -1.37718 0.249
NP_439937.1_9 Reverse -321 -338 2.69307 0.0798
NP_439937.1_9 Forward -251 -234 -8.41828 0.176
NP_442294.1_3 Forward -199 -185 12.5853 0.282
NP_442294.1_3 Reverse -369 -383 12.487 0.283
NP_440408.1_7 Forward -331 -312 8.45592 0.281
NP_440439.1_1 Reverse -151 -164 10.934 0.0339
NP_440439.1_1 Reverse -319 -332 7.29578 0.0664
NP_440439.1_1 Forward -334 -321 3.65753 0.11
NP_439943.1_4 Forward -24 -5 8.06259 0.256
NP_439943.1_4 Forward -73 -54 6.39097 0.27
NP_439943.1_7 Forward -168 -149 3.34271 0.29
NP_440372.1_2 Forward -330 -323 16.3621 0.0124
NP_440372.1_2 Reverse -323 -330 16.3621 0.0124
NP_440372.1_2 Forward -162 -155 16.3621 0.0124
NP_440372.1_2 Reverse -155 -162 16.3621 0.0124
NP_441803.1_2 Reverse -149 -168 14.7491 0.0425
NP_441803.1_2 Reverse -317 -336 13.6675 0.0481
NP_439977.1_5 Reverse -148 -167 1.37609 0.194
NP_440139.1_1 Forward -337 -318 6.1935 0.143
NP_441572.1_7 Reverse -316 -335 9.53756 0.0697
NP_441572.1_7 Reverse -148 -167 -3.14714 0.207
NP_440267.1_2 Reverse -149 -163 11.5037 0.125
NP_442384.1_10 Forward -163 -150 18.8988 0.00338
NP_442384.1_10 Forward -331 -318 17.4239 0.00585
NP_442384.1_10 Reverse -322 -335 16.3422 0.00854
NP_442384.1_10 Reverse -154 -167 10.049 0.047
NP_440364.1_6 Forward -332 -319 14.375 0.275
NP_441018.1_7 Reverse -60 -79 9.0459 0.236
NP_441018.1_7 Forward -167 -148 8.45592 0.246
NP_441018.1_7 Reverse -306 -325 7.17762 0.276
NP_441018.1_7 Reverse -312 -331 7.07928 0.277
NP_442790.1_4 Reverse -313 -332 -10.0303 0.2
NP_442262.1_10 Forward -330 -323 14.1988 0.0123
NP_442262.1_10 Reverse -323 -330 14.1988 0.0123
NP_442262.1_10 Forward -162 -155 14.1988 0.0123
NP_442262.1_10 Reverse -155 -162 14.1988 0.0123
NP_441689.1_5 Reverse -320 -330 15.3192 0.0403
NP_441689.1_5 Reverse -152 -162 8.3377 0.132
NP_441689.1_5 Forward -165 -155 5.78111 0.197
NP_441689.1_5 Forward -126 -116 5.38779 0.265
NP_440163.1_10 Reverse -319 -329 12.4681 0.159
NP_440344.1_10 Forward -338 -321 1.31714 0.0311
NP_440344.1_10 Reverse -315 -332 0.235503 0.0365
NP_440344.1_10 Forward -170 -153 -0.944468 0.048
NP_440344.1_10 Reverse -147 -164 -6.64766 0.114
NP_440531.1_6 Reverse -314 -333 3.14605 0.148
NP_440531.1_6 Reverse -146 -165 -4.03212 0.273
NP_440531.1_6 Forward -171 -152 -4.22878 0.278
NP_440531.1_6 Forward -101 -82 -4.72043 0.286
NP_442910.1_1 Reverse -315 -334 2.26107 0.118
NP_442910.1_1 Forward -170 -151 -7.08038 0.254
NP_440189.1_10 Reverse -73 -92 10.6192 0.207
NP_441965.1_3 Reverse -312 -331 1.67108 0.22
NP_441965.1_3 Forward -341 -322 0.982764 0.225
NP_441965.1_10 Forward -253 -237 3.59845 0.259
NP_441965.1_10 Forward -334 -318 2.8118 0.282
NP_440297.1_9 Forward -330 -320 9.32148 0.0917
NP_440297.1_9 Reverse -323 -333 -0.118297 0.282
NP_440297.1_9 Reverse -155 -165 -0.118297 0.282
NP_440297.1_9 Forward -162 -152 -0.216628 0.282
NP_442280.1_10 Reverse -306 -324 7.49983 0.268
NP_442280.1_10 Forward -173 -155 5.64923 0.283
NP_441592.1_10 Forward -130 -116 13.9619 0.28
NP_440700.1_8 Forward -319 -305 10.521 0.292
NP_440894.1_10 Forward -336 -317 5.40766 0.233
NP_440894.1_10 Reverse -195 -214 4.81767 0.243
NP_440894.1_10 Reverse -149 -168 3.53937 0.271
NP_440999.1_9 Reverse -150 -164 10.226 0.0548
NP_440999.1_9 Forward -335 -321 2.5562 0.148
NP_440999.1_9 Forward -167 -153 1.67122 0.16
NP_440999.1_9 Forward -254 -240 -1.96703 0.254
NP_440888.1_2 Forward -163 -149 15.9285 0.00837
NP_440888.1_2 Forward -331 -317 15.8302 0.00862
NP_440888.1_2 Reverse -154 -168 12.9786 0.0354
NP_440888.1_2 Forward -250 -236 9.34041 0.13
NP_440888.1_2 Reverse -322 -336 9.34041 0.13
NP_440888.1_2 Reverse -273 -287 5.99717 0.254
NP_440888.1_2 Reverse -208 -222 5.89884 0.258
NP_440888.1_2 Reverse -200 -214 5.01387 0.298
NP_440600.1_4 Reverse -146 -164 -0.964162 0.16
NP_440600.1_4 Forward -171 -153 -2.0458 0.183
NP_440491.1_1 Forward -166 -147 10.1331 0.198
NP_440491.1_1 Reverse -151 -170 8.47633 0.241
NP_440052.1_5 Forward -174 -155 -1.18052 0.195
NP_440052.1_5 Reverse -143 -162 -4.6221 0.262
NP_439969.1_1 Reverse -7 -26 -6.49039 0.288
NP_439969.1_3 Forward -168 -149 -0.295539 0.271
NP_442948.1_2 Forward -332 -313 5.211 0.256
NP_442277.1_4 Reverse -145 -164 13.3716 0.0532
NP_442277.1_4 Forward -340 -321 5.11187 0.178
NP_442033.1_10 Reverse -271 -290 -12.0953 0.261
NP_441543.1_2 Reverse -323 -332 18.486 0.00236
NP_441543.1_2 Forward -330 -321 16.9127 0.00359
NP_441543.1_2 Reverse -155 -164 16.9127 0.00359
NP_441543.1_2 Forward -162 -153 15.9293 0.00518
NP_441543.1_2 Forward -43 -34 5.70292 0.181
NP_442845.1_2 Reverse -316 -330 14.7492 0.0774
NP_442845.1_2 Forward -331 -317 7.76774 0.195
NP_442845.1_2 Forward -337 -323 5.80112 0.224
NP_442845.1_2 Forward -169 -155 4.91614 0.249
NP_441551.1_5 Forward -335 -319 6.35103 0.273
NP_441469.1_8 Forward -332 -323 16.126 0.00797
NP_441469.1_8 Reverse -153 -162 6.5879 0.227
NP_441469.1_8 Reverse -321 -330 6.48957 0.227
NP_441469.1_8 Forward -164 -155 6.48957 0.227
NP_442315.1_1 Reverse -230 -248 3.75572 0.287
NP_443064.1_6 Forward -331 -321 12.5669 0.0796
NP_443064.1_6 Reverse -154 -164 12.5669 0.0796
NP_443064.1_6 Forward -163 -153 10.8217 0.13
NP_442578.1_7 Forward -330 -323 14.5921 0.026
NP_442578.1_7 Forward -162 -155 14.5921 0.026
NP_442578.1_7 Reverse -323 -330 14.5921 0.026
NP_442578.1_7 Reverse -155 -162 14.5921 0.026
NP_440710.1_1 Reverse -146 -164 -8.43732 0.264
NP_441462.1_2 Forward -163 -153 20.2362 0.000805
NP_441462.1_2 Forward -331 -321 11.5831 0.00406
NP_441462.1_2 Reverse -322 -332 11.5831 0.00406
NP_441462.1_2 Reverse -154 -164 11.5831 0.00406
NP_441621.1_7 Forward -333 -319 -3.34366 0.188
NP_441621.1_7 Forward -165 -151 -5.21195 0.248
NP_441621.1_7 Forward -287 -273 -5.80194 0.263
NP_443062.1_1 Forward -331 -313 9.22847 0.138
NP_443062.1_1 Forward -163 -145 6.98581 0.188
NP_443062.1_1 Reverse -154 -172 5.91323 0.215
NP_443062.1_1 Forward -325 -307 3.37804 0.3
NP_443062.1_6 Forward -339 -320 11.4058 0.105
NP_443062.1_6 Reverse -233 -252 3.44104 0.237
NP_440519.1_8 Reverse -115 -131 2.02515 0.269
NP_442204.1_1 Reverse -150 -161 21.1015 0.0035
NP_442204.1_1 Reverse -318 -329 9.69511 0.0736
NP_442204.1_2 Reverse -144 -163 7.27595 0.287
NP_440516.1_2 Reverse -316 -334 4.54237 0.138
NP_440516.1_2 Forward -337 -319 -1.06249 0.274
NP_440516.1_8 Forward -331 -322 16.9127 0.00442
NP_440516.1_8 Reverse -322 -331 16.9127 0.00442
NP_440516.1_8 Forward -163 -154 16.9127 0.00442
NP_440516.1_8 Reverse -154 -163 16.9127 0.00442
NP_442428.1_5 Forward -330 -323 15.8704 0.0124
NP_442428.1_5 Reverse -323 -330 15.8704 0.0124
NP_442428.1_5 Forward -162 -155 15.8704 0.0124
NP_442428.1_5 Reverse -155 -162 15.8704 0.0124
NP_440818.1_6 Forward -174 -155 5.50599 0.289
NP_440618.1_1 Reverse -180 -199 -9.24366 0.29
NP_442120.1_10 Forward -337 -318 -15.6352 0.294
NP_440673.1_2 Forward -173 -154 18.6815 0.0423
NP_440673.1_2 Forward -335 -316 9.31652 0.248
NP_440673.1_3 Forward -329 -322 12.4288 0.0426
NP_440673.1_3 Forward -161 -154 12.4288 0.0426
NP_440673.1_3 Reverse -324 -331 12.4288 0.0426
NP_440673.1_3 Reverse -156 -163 12.4288 0.0426
NP_440673.1_3 Reverse -176 -183 10.5605 0.123
NP_440673.1_3 Forward -365 -358 8.98723 0.203
NP_440673.1_3 Reverse -275 -282 6.23397 0.283
NP_440673.1_7 Reverse -156 -175 9.53756 0.115
NP_440673.1_7 Reverse -86 -105 7.17762 0.147
NP_441052.1_2 Forward -331 -321 19.9412 0.00106
NP_441052.1_2 Reverse -154 -164 19.9412 0.00106
NP_441052.1_2 Reverse -322 -332 10.5014 0.0285
NP_441052.1_2 Forward -163 -153 10.4031 0.0285
NP_441052.1_2 Forward -250 -240 5.28991 0.124
NP_441052.1_2 Forward -325 -315 4.69992 0.149
NP_442219.1_8 Forward -173 -154 12.419 0.158
NP_442219.1_8 Forward -329 -310 12.0324 0.168
NP_442219.1_9 Forward -330 -321 17.7976 0.00718
NP_442219.1_9 Reverse -155 -164 17.7976 0.00718
NP_442219.1_9 Reverse -323 -332 8.35786 0.0681
NP_442219.1_9 Forward -162 -153 8.25953 0.0681
NP_440436.1_2 Reverse -308 -327 18.949 0.0932
NP_440436.1_4 Reverse -323 -332 18.1905 0.00233
NP_440436.1_4 Forward -330 -321 17.2072 0.00233
NP_440436.1_4 Reverse -155 -164 17.2072 0.00233
NP_440436.1_4 Forward -162 -153 9.24241 0.0871
NP_440436.1_4 Reverse -175 -184 7.47246 0.129
NP_440436.1_4 Reverse -98 -107 4.12922 0.288
NP_441884.1_9 Reverse -151 -170 -12.8819 0.138
NP_441884.1_9 Forward -166 -147 -22.6167 0.281
NP_441884.1_9 Forward -334 -315 -24.485 0.288
NP_442864.1_3 Forward -169 -150 11.5042 0.181
NP_440314.1_9 Reverse -155 -174 -10.0303 0.282
NP_441719.1_4 Forward -330 -323 16.3621 0.0124
NP_441719.1_4 Reverse -323 -330 16.3621 0.0124
NP_441719.1_4 Forward -162 -155 16.3621 0.0124
NP_441719.1_4 Reverse -155 -162 16.3621 0.0124
NP_441719.1_6 Reverse -204 -223 4.71854 0.297
NP_441733.1_5 Forward -91 -72 15.3391 0.294
NP_441733.1_10 Reverse -319 -332 7.49244 0.153
NP_441004.1_1 Forward -288 -269 -8.85033 0.204
NP_441004.1_1 Forward -214 -195 -9.44032 0.207
NP_441004.1_1 Forward -169 -150 -15.9302 0.279
NP_441004.1_2 Forward -293 -274 5.211 0.195
NP_441004.1_2 Forward -219 -200 -2.65548 0.264
NP_441004.1_4 Forward -285 -275 9.12481 0.259
NP_442813.1_4 Forward -375 -356 -2.26216 0.264
NP_442366.1_3 Forward -332 -314 16.4404 0.0198
NP_442366.1_3 Forward -164 -146 4.9357 0.0899
NP_442366.1_3 Reverse -153 -171 -4.11075 0.264
NP_442366.1_5 Forward -334 -324 15.2208 0.0375
NP_442366.1_5 Forward -166 -156 14.8275 0.0375
NP_440129.1_10 Reverse -315 -329 6.98109 0.177
NP_440129.1_10 Reverse -147 -161 5.30946 0.185
NP_440296.1_10 Reverse -151 -170 -13.6686 0.269
NP_441115.1_4 Forward -164 -146 10.2448 0.183
NP_441115.1_4 Reverse -321 -339 8.47483 0.247
NP_442206.1_10 Forward -331 -316 6.27308 0.178
NP_442206.1_10 Forward -163 -148 4.40479 0.178
NP_442854.1_4 Reverse -149 -168 10.815 0.278
NP_442854.1_6 Forward -331 -312 1.67108 0.279
NP_440328.1_4 Forward -169 -150 13.8641 0.0413
NP_440328.1_4 Reverse -341 -360 -0.787193 0.289
NP_440094.1_2 Forward -330 -311 -1.57384 0.281
NP_443054.1_2 Reverse -320 -334 10.9143 0.0761
NP_443054.1_2 Reverse -152 -166 9.04604 0.102
NP_442430.1_10 Reverse -144 -163 9.43841 0.29
NP_442308.1_4 Reverse -316 -335 2.16274 0.267
NP_441851.1_10 Forward -332 -322 16.008 0.00552
NP_441851.1_10 Reverse -321 -331 15.8113 0.00552
NP_441851.1_10 Forward -164 -154 15.8113 0.00552
NP_441851.1_10 Reverse -153 -163 8.53483 0.114
NP_442208.1_5 Forward -165 -146 0.294447 0.248
NP_442011.1_1 Reverse -321 -340 -1.37718 0.268
NP_442856.1_7 Forward -172 -153 1.86774 0.166
NP_442856.1_7 Reverse -145 -164 -3.14714 0.241
NP_442856.1_7 Forward -334 -315 -4.42544 0.26
NP_441668.1_4 Forward -20 -1 -0.885524 0.263
NP_441668.1_5 Forward -210 -191 6.58763 0.284
NP_442515.1_1 Reverse -240 -254 6.09611 0.101
NP_442515.1_1 Reverse -321 -335 -4.62196 0.298
NP_442515.1_1 Forward -164 -150 -4.62196 0.298
NP_441396.1_5 Reverse -36 -45 8.35786 0.224
NP_440593.1_3 Forward -168 -149 1.17943 0.19
NP_440593.1_3 Reverse -341 -360 -4.6221 0.251
NP_440593.1_3 Reverse -10 -29 -6.29373 0.272
NP_440593.1_3 Forward -330 -311 -6.78538 0.28
NP_440165.1_5 Forward -332 -313 0.392778 0.149
NP_440165.1_5 Reverse -153 -172 -5.31042 0.22
NP_440165.1_5 Forward -164 -145 -6.29373 0.231
NP_441349.1_10 Reverse -312 -331 12.0942 0.0216
NP_441349.1_10 Forward -341 -322 11.5042 0.0231
NP_441349.1_10 Reverse -144 -163 -0.590531 0.0947
NP_440432.1_9 Reverse -155 -170 -0.413427 0.164
NP_440432.1_9 Forward -162 -147 -2.97003 0.177
NP_442843.1_1 Forward -281 -262 -3.24547 0.222
NP_439960.1_4 Forward -332 -313 12.1917 0.291
NP_439960.1_10 Reverse -315 -333 -4.79907 0.297
NP_440474.1_8 Reverse -323 -337 8.16044 0.189
NP_441124.1_5 Forward -310 -300 12.0532 0.239
NP_442450.1_5 Reverse -320 -330 9.32148 0.115
NP_442450.1_5 Forward -333 -323 7.55152 0.13
NP_442450.1_5 Forward -165 -155 7.55152 0.13
NP_440588.1_2 Reverse -313 -332 14.0608 0.0175
NP_440588.1_2 Forward -340 -321 8.84924 0.0446
NP_440588.1_2 Reverse -145 -164 6.98095 0.0532
NP_440588.1_2 Reverse -81 -100 -5.40875 0.25
NP_442006.1_2 Reverse -22 -39 -8.31929 0.194
NP_442006.1_2 Forward -282 -265 -16.3824 0.25
NP_441003.1_9 Forward -41 -22 3.34271 0.294
NP_442243.1_1 Reverse -148 -166 11.4247 0.114
NP_441570.1_1 Reverse -154 -172 6.80398 0.0183
NP_441570.1_1 Forward -331 -313 1.69077 0.029
NP_441570.1_1 Forward -163 -145 -10.3056 0.166
NP_441570.1_1 Reverse -169 -187 -11.0923 0.187
NP_440078.1_4 Forward -378 -359 12.3892 0.206
NP_440078.1_10 Reverse -349 -368 2.0644 0.281
NP_441078.1_4 Forward -331 -322 19.6659 0.0007
NP_441078.1_4 Reverse -322 -331 19.6659 0.0007
NP_441078.1_4 Forward -163 -154 19.6659 0.0007
NP_441078.1_4 Reverse -154 -163 19.6659 0.0007
NP_441078.1_4 Reverse -241 -250 -1.86856 0.272
NP_442729.1_8 Reverse -318 -331 8.37742 0.125
NP_441663.1_8 Reverse -148 -167 2.65439 0.2
NP_440707.1_6 Reverse -146 -165 14.6499 0.172
NP_440526.1_3 Reverse -155 -166 10.2846 0.0646
NP_440526.1_3 Forward -330 -319 7.92465 0.126
NP_440526.1_3 Forward -123 -112 1.3365 0.267
NP_440526.1_3 Forward -105 -94 0.451529 0.281
NP_441432.1_8 Reverse -321 -330 16.8143 0.00595
NP_441432.1_8 Reverse -153 -162 16.8143 0.00595
NP_441432.1_8 Forward -164 -155 16.8143 0.00595
NP_441432.1_8 Forward -332 -323 8.25953 0.0755
NP_441432.1_8 Forward -283 -274 5.50626 0.151
NP_441432.1_8 Forward -18 -9 3.04799 0.268
NP_442320.1_8 Forward -169 -155 4.22782 0.0522
NP_442320.1_8 Reverse -316 -330 3.44117 0.0617
NP_442320.1_8 Forward -112 -98 -3.83532 0.134
NP_442320.1_8 Reverse -91 -105 -6.19526 0.269
NP_442344.1_7 Reverse -155 -174 3.83436 0.0638
NP_441732.1_2 Reverse -150 -166 2.91013 0.0145
NP_441732.1_2 Reverse -318 -334 2.32015 0.0253
NP_441732.1_2 Forward -335 -319 -7.80794 0.0935
NP_441732.1_2 Forward -167 -151 -16.2644 0.165
NP_440497.1_2 Forward -330 -311 6.39097 0.26
NP_440497.1_2 Forward -281 -262 3.34271 0.3
NP_442003.1_4 Reverse -155 -174 10.3242 0.288
NP_440760.1_1 Reverse -154 -173 -14.9469 0.138
NP_440760.1_1 Reverse -241 -260 -21.3384 0.234
NP_440760.1_1 Forward -163 -144 -21.9284 0.246
NP_440760.1_1 Forward -325 -306 -23.4033 0.297
NP_442797.1_7 Forward -171 -153 7.68896 0.198
NP_440199.1_10 Reverse -238 -248 10.2065 0.185
NP_440199.1_10 Reverse -319 -329 7.64985 0.231
NP_440199.1_10 Forward -166 -156 7.25653 0.231
NP_441805.1_2 Reverse -143 -162 3.14605 0.164
NP_442298.1_10 Reverse -323 -342 13.3725 0.224
NP_442353.1_4 Forward -337 -318 6.1935 0.18
NP_442353.1_4 Forward -169 -150 1.6703 0.242
NP_440913.1_1 Reverse -152 -170 12.4089 0.16
NP_440913.1_1 Forward -284 -266 5.62401 0.237
NP_441072.1_2 Forward -342 -323 8.35759 0.24
NP_440713.1_4 Reverse -312 -331 7.96426 0.174
NP_442489.1_7 Forward -331 -322 20.1576 0.000695
NP_442489.1_7 Reverse -322 -331 20.1576 0.000695
NP_442489.1_7 Forward -163 -154 20.1576 0.000695
NP_442489.1_7 Reverse -154 -163 20.1576 0.000695
NP_442489.1_7 Reverse -241 -250 -1.57357 0.213
NP_442079.1_7 Forward -330 -311 7.17762 0.144
NP_440559.1_1 Forward -330 -321 17.4043 0.00658
NP_440559.1_1 Reverse -155 -164 17.4043 0.00658
NP_440559.1_1 Reverse -323 -332 8.75118 0.0586
NP_440559.1_1 Forward -162 -153 8.65285 0.0586
NP_441659.2_8 Forward -163 -153 20.9245 0.000805
NP_441659.2_8 Forward -331 -321 18.1713 0.00133
NP_441659.2_8 Reverse -154 -164 18.1713 0.00133
NP_441659.2_8 Reverse -322 -332 11.9764 0.0147
NP_441659.2_8 Reverse -329 -339 1.74999 0.227
NP_440426.1_7 Reverse -144 -163 2.45773 0.207
NP_442913.1_9 Forward -169 -150 7.47261 0.284
NP_442913.1_10 Forward -172 -153 15.7324 0.0155
NP_442913.1_10 Reverse -145 -164 7.07928 0.0563
NP_441040.1_2 Reverse -265 -284 -7.4737 0.213
NP_441040.1_2 Reverse -7 -26 -9.73531 0.238
NP_441040.1_5 Forward -336 -317 8.25926 0.226
NP_439956.1_7 Forward -189 -170 9.73422 0.257
NP_439956.1_7 Reverse -109 -128 1.76941 0.28
NP_442008.1_2 Forward -166 -147 7.47261 0.209
NP_442008.1_2 Forward -334 -315 4.12936 0.245
NP_440779.1_5 Reverse -154 -171 -15.0058 0.3
NP_441185.1_2 Forward -185 -166 6.09597 0.26
NP_442346.1_1 Reverse -65 -84 17.404 0.181
NP_442346.1_5 Reverse -321 -331 16.6963 0.00248
NP_442346.1_5 Forward -164 -154 16.6963 0.00248
NP_442346.1_5 Reverse -153 -163 16.303 0.00248
NP_442346.1_5 Forward -326 -316 9.51814 0.118
NP_442346.1_5 Forward -332 -322 9.02648 0.118
NP_442346.1_5 Forward -209 -199 6.17489 0.212
NP_440352.1_5 Forward -161 -142 14.8945 0.136
NP_440545.1_3 Forward -167 -150 12.3302 0.0212
NP_440545.1_3 Forward -335 -318 6.92201 0.0532
NP_440545.1_3 Reverse -318 -335 4.3654 0.0717
NP_440545.1_3 Reverse -275 -292 -3.69774 0.21
NP_441856.1_3 Forward -166 -147 -2.85214 0.272
NP_441629.1_1 Forward -339 -320 5.50599 0.298
NP_440486.1_6 Forward -332 -313 14.8474 0.207
NP_440459.1_2 Reverse -13 -30 12.6252 0.142
NP_440459.1_2 Forward -172 -155 10.5603 0.196
NP_440459.1_2 Forward -19 -2 10.5603 0.196
NP_440459.1_2 Reverse -152 -169 9.38028 0.229
NP_440459.1_2 Reverse -56 -73 8.69197 0.253
NP_440010.1_1 Reverse -113 -132 8.45592 0.213
NP_440010.1_3 Reverse -10 -29 -8.45701 0.297
NP_440010.1_4 Reverse -312 -331 4.12856 0.22
NP_440010.1_10 Forward -175 -156 2.75272 0.272
NP_442551.1_4 Reverse -197 -212 14.2379 0.0946
NP_440847.1_3 Reverse -207 -221 12.8803 0.232
NP_442603.1_7 Forward -331 -317 17.5018 0.0211
NP_442603.1_7 Forward -250 -236 11.602 0.114
NP_442603.1_7 Forward -163 -149 10.5204 0.125
NP_441585.1_5 Reverse -364 -383 5.89851 0.211
NP_441888.1_7 Reverse -149 -163 3.8345 0.225
NP_441888.1_7 Reverse -317 -331 3.53951 0.225
NP_441050.1_5 Reverse -112 -130 -2.3408 0.283
NP_441948.1_4 Forward -338 -320 1.39578 0.133
NP_441948.1_4 Forward -170 -152 -2.53746 0.169
NP_440170.1_5 Reverse -312 -331 5.89931 0.193
NP_440170.1_6 Reverse -149 -168 19.3707 0.0959
NP_441779.1_6 Reverse -135 -154 18.3873 0.178
NP_441833.1_4 Forward -330 -323 15.9687 0.0124
NP_441833.1_4 Reverse -323 -330 15.9687 0.0124
NP_441833.1_4 Forward -162 -155 15.9687 0.0124
NP_441833.1_4 Reverse -155 -162 15.9687 0.0124
NP_442162.1_9 Forward -330 -323 16.2637 0.0124
NP_442162.1_9 Reverse -323 -330 16.2637 0.0124
NP_442162.1_9 Forward -162 -155 16.2637 0.0124
NP_442162.1_9 Reverse -155 -162 16.2637 0.0124
NP_440671.1_4 Reverse -316 -330 21.5341 0.00306
NP_440224.1_1 Reverse -311 -330 2.0644 0.132
NP_441973.1_1 Forward -376 -361 0.176559 0.236
NP_440772.1_8 Reverse -316 -335 12.3892 0.253
NP_442045.1_5 Forward -285 -266 -1.7705 0.29
NP_442199.1_5 Reverse -146 -165 -0.885524 0.177
NP_442140.1_3 Reverse -323 -333 16.2046 0.0255
NP_442140.1_3 Reverse -155 -165 12.2714 0.0632
NP_442140.1_3 Forward -162 -152 4.69992 0.238
NP_442140.1_3 Forward -330 -320 4.40493 0.243
NP_442140.1_3 Forward -324 -314 4.0116 0.265
NP_440875.1_9 Forward -161 -151 16.5483 0.0145
NP_441813.1_5 Reverse -152 -162 18.1713 0.00743
NP_441813.1_5 Reverse -320 -330 15.9097 0.01
NP_441813.1_5 Forward -333 -323 9.91146 0.021
NP_441813.1_5 Forward -165 -155 8.63316 0.0367
NP_440590.1_4 Reverse -155 -168 19.1938 0.00669
NP_440590.1_4 Reverse -323 -336 12.3107 0.0148
NP_440590.1_4 Forward -162 -149 4.44418 0.0601
NP_440590.1_4 Forward -330 -317 -2.93064 0.251
NP_440567.1_1 Reverse -155 -169 12.7826 0.0216
NP_440567.1_1 Forward -330 -316 10.226 0.0385
NP_440567.1_1 Reverse -323 -337 9.73436 0.0422
NP_440567.1_1 Forward -162 -148 6.78443 0.0803
NP_442497.1_10 Forward -162 -153 17.601 0.00813
NP_442497.1_10 Forward -330 -321 10.4228 0.0087
NP_442497.1_10 Reverse -323 -332 10.4228 0.0087
NP_442497.1_10 Reverse -155 -164 10.4228 0.0087
NP_440821.1_4 Reverse -320 -330 18.2696 0.00448
NP_440821.1_4 Forward -333 -323 10.2065 0.0163
NP_440821.1_4 Forward -165 -155 9.41981 0.0286
NP_440821.1_4 Reverse -152 -162 2.24165 0.131
NP_440821.1_7 Reverse -53 -72 8.16093 0.288
NP_441239.1_9 Reverse -152 -164 13.0187 0.0389
NP_441239.1_9 Forward -333 -321 12.3303 0.0477
NP_441239.1_9 Reverse -320 -332 6.92215 0.173
NP_441239.1_9 Forward -25 -13 4.16888 0.26
NP_441239.1_9 Forward -165 -153 3.38223 0.285
NP_441951.1_4 Reverse -58 -77 6.58763 0.273
NP_441951.1_4 Reverse -91 -110 4.12936 0.273
NP_441951.1_9 Forward -366 -347 -1.08219 0.283
NP_441892.1_1 Forward -172 -155 5.74204 0.0999
NP_441892.1_1 Reverse -313 -330 0.628827 0.165
NP_440604.1_6 Forward -163 -144 3.73603 0.131
NP_440604.1_6 Forward -331 -312 -3.44213 0.225
NP_442270.1_9 Forward -174 -155 -0.688862 0.146
NP_442629.1_3 Reverse -72 -91 0.392778 0.294
NP_440833.1_6 Forward -382 -368 14.9452 0.143
NP_441526.1_6 Reverse -68 -87 2.0644 0.295
NP_440354.1_5 Forward -334 -315 5.70265 0.192
NP_442138.1_10 Forward -331 -312 -5.21209 0.268
NP_442138.1_10 Reverse -154 -173 -7.57203 0.29
NP_440546.1_4 Forward -163 -153 13.5365 0.0459
NP_440546.1_4 Reverse -322 -332 11.8882 0.0679
NP_440546.1_4 Forward -331 -321 10.046 0.109
NP_440546.1_4 Reverse -154 -164 10.046 0.109
NP_440546.1_4 Forward -106 -96 7.23423 0.252
NP_440546.1_4 Reverse -64 -74 6.74945 0.282
NP_440462.1_4 Forward -185 -171 13.4709 0.169
NP_440462.1_6 Reverse -152 -162 18.7612 0.00454
NP_440462.1_6 Forward -333 -323 9.02648 0.0498
NP_440462.1_6 Reverse -320 -330 7.74818 0.0699
NP_440462.1_6 Forward -165 -155 1.35667 0.294
NP_442611.1_1 Forward -163 -144 5.70265 0.179
NP_440868.1_4 Forward -335 -323 18.3285 0.0124
NP_440868.1_4 Reverse -150 -162 8.00379 0.0602
NP_440868.1_4 Reverse -318 -330 6.1355 0.0878
NP_440868.1_4 Forward -167 -155 -0.846001 0.282
NP_442499.1_3 Forward -101 -83 4.05072 0.289
NP_442479.1_9 Reverse -229 -248 -7.96535 0.266
NP_442479.1_9 Forward -308 -289 -13.8652 0.293
NP_442402.1_4 Reverse -146 -165 1.37531 0.173
NP_442402.1_4 Forward -132 -113 -8.16275 0.278
NP_442402.1_10 Reverse -144 -154 13.5492 0.2
NP_442402.1_10 Reverse -143 -153 12.3692 0.212
NP_441848.1_7 Forward -239 -220 0.588665 0.228
NP_441084.1_6 Reverse -152 -166 15.0646 0.0931
NP_440696.1_3 Forward -335 -317 4.44404 0.198
NP_440696.1_3 Forward -27 -9 -0.0791831 0.238
NP_440843.1_8 Forward -214 -195 13.9625 0.297
NP_442039.1_4 Forward -330 -323 15.1821 0.0124
NP_442039.1_4 Reverse -323 -330 15.1821 0.0124
NP_442039.1_4 Forward -162 -155 15.1821 0.0124
NP_442039.1_4 Reverse -155 -162 15.1821 0.0124
NP_442039.1_10 Forward -134 -116 13.0964 0.227
NP_441811.1_8 Forward -337 -323 7.07942 0.259
NP_441180.1_2 Reverse -368 -387 10.3897 0.287
NP_442679.1_1 Reverse -356 -375 -5.70374 0.296
NP_440825.1_7 Reverse -155 -165 12.9096 0.152
NP_440825.1_7 Reverse -323 -333 12.4217 0.155
NP_442837.1_3 Forward -330 -323 15.7721 0.0124
NP_442837.1_3 Reverse -323 -330 15.7721 0.0124
NP_442837.1_3 Forward -162 -155 15.7721 0.0124
NP_442837.1_3 Reverse -155 -162 15.7721 0.0124
NP_440160.1_2 Reverse -84 -103 -7.96535 0.286
NP_442053.1_1 Forward -331 -322 18.3876 0.0007
NP_442053.1_1 Reverse -322 -331 18.3876 0.0007
NP_442053.1_1 Forward -163 -154 18.3876 0.0007
NP_442053.1_1 Reverse -154 -163 18.3876 0.0007
NP_440505.1_3 Reverse -152 -162 17.188 0.00332
NP_440505.1_3 Reverse -320 -330 16.303 0.00696
NP_440505.1_3 Forward -165 -155 9.22315 0.122
NP_440505.1_3 Forward -333 -323 6.76487 0.169
NP_440505.1_3 Reverse -113 -123 5.48657 0.227
NP_440505.1_7 Forward -374 -355 6.68596 0.162
NP_440505.1_7 Forward -170 -151 1.76941 0.244
NP_441701.1_3 Forward -21 -4 9.67528 0.245
NP_441203.1_1 Forward -162 -143 -12.6852 0.144
NP_441203.1_1 Forward -330 -311 -19.7651 0.297
NP_441408.2_7 Reverse -152 -171 4.916 0.186
NP_440914.1_1 Forward -331 -321 17.5935 0.000537
NP_440914.1_1 Reverse -154 -164 17.5935 0.000537
NP_440914.1_1 Forward -163 -153 16.3248 0.00196
NP_440914.1_1 Reverse -322 -332 8.6151 0.186
NP_441011.1_8 Reverse -323 -332 16.9127 0.00602
NP_441011.1_8 Forward -162 -153 16.6177 0.00602
NP_441011.1_8 Forward -330 -321 8.25953 0.144
NP_441011.1_8 Reverse -155 -164 8.25953 0.144
NP_442533.1_6 Forward -331 -322 17.2076 0.00137
NP_442533.1_6 Reverse -322 -331 17.2076 0.00137
NP_442533.1_6 Forward -163 -154 17.2076 0.00137
NP_442533.1_6 Reverse -154 -163 17.2076 0.00137
NP_442533.1_6 Forward -92 -83 8.55452 0.0747
NP_442533.1_6 Reverse -241 -250 3.93297 0.197
NP_442533.1_6 Forward -93 -84 3.83464 0.202
NP_442533.1_6 Reverse -199 -208 3.04799 0.228
NP_442533.1_6 Reverse -354 -363 2.16301 0.27
NP_442541.1_10 Reverse -8 -22 2.35894 0.262
NP_442232.1_3 Reverse -314 -333 -14.1602 0.288
NP_441482.1_7 Reverse -316 -330 8.25939 0.0181
NP_441482.1_7 Reverse -148 -162 6.88276 0.0257
NP_439944.1_9 Forward -330 -320 19.0562 0.00329
NP_439944.1_9 Forward -105 -95 12.7631 0.0838
NP_439944.1_9 Reverse -155 -165 10.5014 0.0887
NP_439944.1_9 Forward -162 -152 9.12481 0.1
NP_441028.1_6 Reverse -144 -154 8.04271 0.217
NP_441028.1_6 Reverse -145 -155 4.10949 0.278
NP_440116.1_5 Forward -334 -317 11.9369 0.105
NP_440116.1_5 Forward -166 -149 6.13536 0.17
NP_440116.1_8 Reverse -155 -174 11.2092 0.0278
NP_440116.1_8 Forward -105 -86 -5.60541 0.194
NP_440115.1_6 Reverse -151 -161 14.0414 0.0615
NP_440115.1_6 Reverse -319 -329 9.41981 0.115
NP_440007.1_9 Reverse -150 -164 10.226 0.163
NP_440007.1_9 Reverse -318 -332 1.86788 0.282
NP_440007.1_9 Forward -167 -153 1.67122 0.285
NP_440007.1_9 Reverse -67 -81 0.491246 0.297
NP_442728.1_1 Reverse -319 -338 8.75091 0.239
NP_441961.1_4 Forward -290 -271 2.55606 0.291
NP_441602.1_3 Reverse -71 -90 5.70265 0.141
NP_441972.1_5 Reverse -311 -330 4.42435 0.103
NP_441972.1_5 Reverse -155 -174 -2.36049 0.182
NP_441972.1_5 Reverse -242 -261 -9.83364 0.293
NP_441106.1_1 Reverse -153 -162 18.486 0.0028
NP_441106.1_1 Forward -332 -323 18.191 0.0028
NP_441106.1_1 Reverse -321 -330 9.63616 0.0311
NP_441106.1_1 Forward -164 -155 9.63616 0.0311
NP_440429.1_2 Reverse -155 -174 8.16093 0.274
NP_439903.1_6 Reverse -151 -170 9.24175 0.124
NP_442306.1_10 Reverse -236 -255 -12.2919 0.166
NP_441186.1_4 Forward -302 -292 15.0242 0.274
NP_441286.1_1 Forward -332 -320 11.8387 0.0114
NP_441286.1_1 Reverse -321 -333 6.03717 0.0258
NP_441286.1_1 Forward -164 -152 5.93884 0.0258
NP_441286.1_1 Reverse -153 -165 3.48056 0.0467
NP_441286.1_1 Reverse -240 -252 -4.9759 0.183
NP_442674.1_3 Reverse -314 -333 15.3382 0.174
NP_442674.1_3 Reverse -341 -360 4.03023 0.294
NP_442674.1_3 Forward -258 -239 2.85027 0.297
NP_440670.1_8 Forward -331 -322 18.3876 0.000699
NP_440670.1_8 Reverse -322 -331 18.3876 0.000699
NP_440670.1_8 Forward -163 -154 18.3876 0.000699
NP_440670.1_8 Reverse -154 -163 18.3876 0.000699
NP_441479.1_1 Forward -166 -147 16.3224 0.0989
NP_442477.1_2 Reverse -235 -254 5.80098 0.124
NP_440886.1_7 Forward -332 -322 17.7774 0.0011
NP_440886.1_7 Reverse -153 -163 8.04271 0.0805
NP_440886.1_7 Reverse -321 -331 7.94438 0.0805
NP_440886.1_7 Forward -164 -154 7.94438 0.0805
NP_440886.1_7 Reverse -328 -338 5.68278 0.168
NP_442072.1_9 Reverse -321 -339 -12.9605 0.095
NP_442072.1_9 Reverse -153 -171 -21.417 0.208
NP_442072.1_9 Forward -164 -146 -22.007 0.216
NP_441651.1_4 Reverse -45 -64 17.8957 0.214
NP_440907.2_8 Reverse -323 -333 14.2375 0.0312
NP_440907.2_8 Forward -162 -152 9.616 0.103
NP_440907.2_8 Reverse -155 -165 7.64939 0.117
NP_442264.1_2 Reverse -312 -329 5.74204 0.272
NP_441021.1_1 Forward -330 -311 -4.32711 0.168
NP_441021.1_1 Forward -105 -86 -8.752 0.2
NP_440176.1_3 Reverse -8 -22 12.6836 0.266
NP_441463.1_3 Reverse -312 -331 -1.86883 0.147
NP_441463.1_3 Forward -329 -310 -7.67036 0.259
NP_441463.1_6 Reverse -239 -253 8.15534 0.25
NP_441463.1_6 Reverse -320 -334 6.02939 0.283
NP_441626.1_2 Forward -330 -323 15.7721 0.0124
NP_441626.1_2 Reverse -323 -330 15.7721 0.0124
NP_441626.1_2 Forward -162 -155 15.7721 0.0124
NP_441626.1_2 Reverse -155 -162 15.7721 0.0124
NP_442365.1_5 Reverse -323 -342 13.6675 0.121
NP_442365.1_7 Reverse -318 -337 6.98095 0.104
NP_442365.1_7 Forward -89 -70 0.0977854 0.177
NP_442365.1_7 Reverse -269 -288 -6.68705 0.299
NP_442794.1_1 Reverse -318 -330 19.7052 0.00523
NP_442794.1_1 Forward -167 -155 12.4287 0.0721
NP_442794.1_1 Reverse -150 -162 10.5604 0.0721
NP_442794.1_1 Reverse -312 -324 3.97222 0.279
NP_442615.1_1 Forward -340 -322 15.3588 0.00922
NP_442615.1_1 Reverse -145 -163 8.7706 0.0275
NP_442615.1_1 Forward -172 -154 -0.570838 0.118
NP_441962.1_4 Forward -287 -268 2.0644 0.103
NP_441962.1_4 Forward -213 -194 -13.0786 0.268
NP_441962.1_4 Forward -330 -311 -14.3569 0.286
NP_441962.1_4 Forward -336 -317 -15.1435 0.299
NP_440387.1_1 Forward -331 -315 14.3165 0.00649
NP_440387.1_1 Reverse -322 -338 7.63002 0.0282
NP_440387.1_1 Forward -163 -147 -1.3181 0.142
NP_440387.1_1 Reverse -154 -170 -2.69473 0.148
NP_441431.1_2 Reverse -151 -165 16.0269 0.04
NP_441431.1_2 Forward -334 -320 7.17714 0.247
NP_441488.1_8 Forward -168 -154 11.897 0.146
NP_441488.1_8 Reverse -149 -163 9.73373 0.146
NP_442647.1_7 Forward -90 -77 6.31247 0.257
NP_441836.1_2 Forward -337 -318 7.07928 0.11
NP_440634.1_4 Reverse -89 -108 9.0459 0.257
NP_441993.1_1 Forward -169 -150 12.0823 0.106
NP_441993.1_1 Forward -331 -312 3.11618 0.241
NP_441174.1_2 Reverse -319 -333 14.7492 0.155
NP_440814.1_4 Forward -340 -321 -12.4886 0.23
NP_440114.1_10 Reverse -322 -336 10.4227 0.148
NP_442323.1_7 Reverse -149 -168 9.04509 0.163
NP_442323.1_7 Forward -85 -66 2.16195 0.271
NP_441510.2_7 Reverse -316 -330 10.9137 0.28
NP_441510.2_7 Forward -85 -71 10.6187 0.28
NP_441510.2_9 Forward -27 -8 6.58763 0.23
NP_440287.1_6 Forward -172 -153 12.2908 0.127
NP_442087.1_5 Forward -322 -303 23.6972 0.0127
NP_440766.1_4 Reverse -318 -332 17.5025 0.0255
NP_439988.1_7 Forward -332 -318 11.5037 0.292
NP_441237.1_9 Reverse -155 -165 14.828 0.0242
NP_442743.1_4 Forward -162 -143 7.27595 0.0851
NP_441311.1_2 Reverse -148 -162 14.7486 0.229
NP_442930.1_1 Forward -147 -137 14.4342 0.239
NP_439910.1_2 Forward -339 -322 -21.2006 0.183
NP_442867.1_8 Reverse -207 -226 4.12936 0.291
NP_440457.1_1 Reverse -318 -330 8.29878 0.101
NP_440457.1_1 Reverse -150 -162 7.70879 0.101
NP_440457.1_1 Forward -16 -4 5.54551 0.141
NP_440457.1_1 Forward -335 -323 2.69391 0.205
NP_440213.1_5 Reverse -65 -84 11.7992 0.214
NP_440798.1_6 Reverse -323 -336 14.3756 0.0423
NP_440798.1_6 Forward -162 -149 2.08423 0.186
NP_441984.1_3 Reverse -150 -168 5.72234 0.278
NP_441984.1_6 Reverse -17 -29 15.7719 0.219
NP_441332.1_6 Reverse -2 -12 12.9053 0.201
NP_441436.1_6 Reverse -28 -47 7.37428 0.26
NP_441436.1_8 Forward -164 -145 8.45592 0.283
NP_442509.1_9 Reverse -322 -332 16.2041 0.00739
NP_442509.1_9 Forward -331 -321 8.14104 0.192
NP_442509.1_9 Reverse -154 -164 8.14104 0.192
NP_442509.1_9 Forward -163 -153 8.04271 0.192
NP_441489.1_3 Reverse -182 -196 9.46532 0.232
NP_441253.1_1 Reverse -25 -44 4.42435 0.28
NP_442514.1_5 Reverse -15 -34 3.04693 0.159
NP_440554.1_4 Forward -162 -152 17.9746 0.0131
NP_440554.1_4 Reverse -323 -333 7.35486 0.103
NP_440554.1_4 Forward -330 -320 7.05986 0.106
NP_441885.1_5 Forward -331 -321 20.9245 0.000538
NP_441885.1_5 Reverse -154 -164 20.9245 0.000538
NP_441885.1_5 Reverse -322 -332 11.4848 0.00668
NP_441885.1_5 Forward -163 -153 11.3864 0.00668
NP_441885.1_5 Forward -106 -96 -0.904945 0.241
NP_440478.1_10 Forward -333 -319 7.9644 0.257
NP_442341.1_7 Forward -332 -318 16.1259 0.0186
NP_442341.1_7 Reverse -321 -335 9.63603 0.0726
NP_442341.1_7 Reverse -153 -167 9.63603 0.0726
NP_442341.1_7 Reverse -14 -28 3.93283 0.208
NP_442341.1_7 Forward -164 -150 1.67122 0.282
NP_442341.1_9 Reverse -152 -166 20.0584 0.00907
NP_442341.1_9 Forward -333 -319 17.6985 0.0235
NP_441756.1_5 Reverse -150 -169 2.75272 0.206
NP_441756.1_5 Forward -167 -148 -3.44213 0.29
NP_441173.1_9 Reverse -145 -153 11.3271 0.226
NP_441173.1_9 Forward -191 -183 10.9338 0.242
NP_442395.2_4 Forward -332 -313 11.5033 0.0907
NP_443000.1_7 Reverse -152 -162 20.3345 0.00223
NP_443000.1_7 Reverse -320 -330 17.0896 0.00865
NP_443000.1_7 Forward -165 -155 10.3048 0.0345
NP_443000.1_7 Forward -333 -323 1.94665 0.226
NP_440507.2_3 Reverse -313 -332 19.1731 0.0344
NP_442513.1_5 Forward -171 -152 8.75009 0.266
NP_441842.1_1 Reverse -324 -337 18.4065 0.0169
NP_441842.1_10 Forward -170 -156 15.0442 0.0474
NP_440275.1_3 Reverse -152 -162 16.1063 0.0155
NP_440275.1_3 Forward -333 -323 8.33817 0.0602
NP_440275.1_3 Reverse -320 -330 8.1415 0.0602
NP_440275.1_3 Forward -165 -155 8.04317 0.0602
NP_440091.1_1 Forward -335 -323 10.1671 0.0498
NP_440091.1_1 Reverse -93 -105 1.41561 0.197
NP_440091.1_1 Forward -167 -155 1.31728 0.198
NP_440091.1_1 Reverse -318 -330 -0.452677 0.273
NP_443060.1_1 Reverse -318 -337 7.37347 0.3
NP_443060.1_5 Forward -171 -152 10.3234 0.182
NP_442451.1_2 Forward -171 -152 -8.94866 0.258
NP_442686.1_3 Forward -38 -19 16.0265 0.204
NP_439962.1_4 Forward -93 -74 4.71934 0.178
NP_439962.1_6 Forward -21 -3 7.29564 0.287
NP_442495.1_4 Forward -159 -149 16.303 0.0771
NP_440149.1_8 Forward -331 -312 -2.45882 0.171
NP_441105.1_3 Reverse -143 -162 5.60432 0.0669
NP_441105.1_3 Reverse -163 -182 -0.885524 0.143
NP_441105.1_3 Reverse -311 -330 -3.44213 0.179
NP_441105.1_3 Reverse -305 -324 -5.50708 0.22
NP_441105.1_3 Forward -342 -323 -6.1954 0.23
NP_440216.1_1 Forward -163 -149 17.1092 0.00188
NP_440216.1_1 Reverse -322 -336 8.06273 0.0068
NP_440216.1_1 Reverse -154 -168 0.196253 0.0284
NP_440216.1_1 Forward -331 -317 -10.4235 0.145
NP_440172.1_1 Forward -163 -153 17.5813 0.00421
NP_440172.1_1 Forward -331 -321 15.0247 0.00945
NP_440172.1_1 Reverse -154 -164 15.0247 0.00945
NP_440172.1_1 Reverse -322 -332 8.73149 0.0586
NP_442371.1_1 Forward -154 -144 14.8275 0.183
NP_440167.1_3 Forward -173 -154 8.94757 0.269
NP_442015.1_10 Reverse -318 -331 18.8988 0.00492
NP_442015.1_10 Reverse -150 -163 13.4906 0.0354
NP_442015.1_10 Forward -167 -154 11.3273 0.0372
NP_442015.1_10 Forward -335 -322 10.8357 0.0391
NP_441226.1_7 Forward -330 -323 14.4934 0.0123
NP_441226.1_7 Reverse -323 -330 14.4934 0.0123
NP_441226.1_7 Forward -162 -155 14.4934 0.0123
NP_441226.1_7 Reverse -155 -162 14.4934 0.0123
NP_441111.1_7 Forward -330 -322 18.7023 0.00294
NP_441111.1_7 Forward -162 -154 18.7023 0.00294
NP_441111.1_7 Reverse -323 -331 18.7023 0.00294
NP_441111.1_7 Reverse -155 -163 18.7023 0.00294
NP_442379.1_10 Reverse -315 -332 -1.63279 0.223
NP_442379.1_10 Forward -170 -153 -3.79607 0.268
NP_441766.1_2 Forward -331 -322 17.5026 0.00297
NP_441766.1_2 Reverse -322 -331 17.5026 0.00297
NP_441766.1_2 Forward -163 -154 17.5026 0.00297
NP_441766.1_2 Reverse -154 -163 17.5026 0.00297
NP_442417.1_5 Forward -163 -149 14.3559 0.0633
NP_442417.1_5 Forward -331 -317 11.8976 0.0981
NP_440416.1_9 Reverse -315 -334 2.94938 0.0381
NP_440416.1_9 Forward -170 -151 0.491109 0.052
NP_440416.1_9 Reverse -147 -166 -4.91709 0.0783
NP_440416.1_9 Reverse -272 -291 -7.96535 0.109
NP_440416.1_9 Forward -326 -307 -10.1286 0.139
NP_440416.1_9 Forward -374 -355 -13.1769 0.163
NP_440416.1_9 Forward -338 -319 -17.0118 0.229
NP_440416.1_9 Reverse -7 -26 -18.0934 0.251
NP_440416.1_9 Reverse -167 -186 -21.7317 0.296
NP_443052.1_8 Forward -173 -154 -5.60541 0.131
NP_443052.1_9 Reverse -4 -23 -6.29373 0.281
NP_440591.1_9 Reverse -315 -333 10.4422 0.124
NP_440261.1_5 Forward -162 -149 6.70579 0.0318
NP_440261.1_5 Reverse -323 -336 -4.50394 0.151
NP_440261.1_5 Reverse -155 -168 -10.4038 0.201
NP_440261.1_5 Forward -330 -317 -10.5021 0.201
NP_440261.1_5 Reverse -242 -255 -12.2721 0.277
NP_440988.1_10 Reverse -320 -334 8.19046 0.205
NP_440988.1_10 Forward -19 -5 4.02751 0.275
NP_440988.1_10 Forward -284 -270 3.9307 0.276
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GAAGTGCAACTATTGTGGGCCAAAATTCCCTTTGTTGGTCGCTGGGCTGTCCACTACTGGTATGTGGTCGGCGATCGCCATGGTCAGAGCTTGGAGAATTTACAAAGATGGGAGGTGTGGCAACGGCGAGAGTTGAAGCTCCCTAGTTGGGGTCATCTCCATCAAAATCTGCTGACTCCCTATGGAGGAGTGGGTAACGGCCCCAGTTTTTTAGCCCAGCAATGGTCTGGCCCCATTGGCGATCGCCTGGGGGAAATTATTCTCAACAGTCCCCAAATCTATCCCCACTGTTACAGCTATCGTTACTGGCCCGGCCCCAATAGCAACACCTATGCCCAATGGGTACTAGAACAGGCCGCCATCAATTTTGACCTGGGCCGACTGGCAGTGGGAAGGGGCT

CDS

ATGGCCAATCTATTTTTTCTCGGTTTTCCCATGGACATCGCCAGTTGGAACGTTAATTCCGTCCGCAGTCGTCAGCAACATATCCTCGATTGGTTGGGCACAAACCCTGTTGATGTACTTTGTTTGCAAGAAACTAAGGTGGTGGATGAAGATTTTCCCCGGCAACCGTTTGAAGAGGCGGGCTACCATTGCCATATTTCTGGGCAAAAGTCCTATAACGGCGTGGCCATTTTCAGTCGGGAACCATTGCAAGACGTGAAAATCGGTTTTGCGGCCCTAGTGGAGCCAGCCTTGACGGGGGATTTGGATGAACAAAAACGAGTGATCAGTGGCGTTTATGACGGTGTGCGGATCGTTAATCTCTACGTTCCCAATGGATCTGCCCTCGACAGTGAAAAGTATTTGTATAAATTGCGGTGGTTAAACTTACTGCAGACCTATCTGGAGCAACTGCGCCGTAGTGACACCCCAGAATTTTTGGTCTGTGGAGATTTCAACATTGCCCCAGAAGACCGGGATATCCATGACCCAGTGGGCCGGGAGAATCATATTATGGCCACTGCCATGGAACGGGAAGCTTTAACGGAAGTGTTGGCGATCGCCAATTTGCAGGATGCTTTCCGTAAATTTACCGAAGAAACGGGCCATTACAGTTGGTGGGATTATCGCACTAGGGGCTTTAGTCGCAACCGGGGGTGGCGCATTGACCACCATTATCTAACTCCCCAACTCTACGACCAGGCCCAAAAATGTTGGATAGATAGGGAACCCAGGGGTTGGGAAAAACCCAGTGACCATGCTCCGGTGGTGGTAACTATCAACAATTAA

Protein

MANLFFLGFPMDIASWNVNSVRSRQQHILDWLGTNPVDVLCLQETKVVDEDFPRQPFEEAGYHCHISGQKSYNGVAIFSREPLQDVKIGFAALVEPALTGDLDEQKRVISGVYDGVRIVNLYVPNGSALDSEKYLYKLRWLNLLQTYLEQLRRSDTPEFLVCGDFNIAPEDRDIHDPVGRENHIMATAMEREALTEVLAIANLQDAFRKFTEETGHYSWWDYRTRGFSRNRGWRIDHHYLTPQLYDQAQKCWIDREPRGWEKPSDHAPVVVTINN