Your browser is old and dusty. Try Google Chrome!

Details for sll1789

ORF sll1789
Accession NP_440684.1
Symbol rpoC2
Category RNA synthesis, modification, and DNA transcription
Definition RNA polymerase beta prime subunit
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -157 -171 13.0776 0.193
NP_441061.1_2 Reverse -63 -77 12.291 0.048
NP_440557.1_1 Forward -70 -51 14.4541 0.0645
NP_440795.1_7 Forward -70 -63 14.6904 0.0123
NP_440795.1_7 Reverse -63 -70 14.6904 0.0123
NP_441418.1_6 Reverse -62 -81 -21.0434 0.136
NP_441418.1_6 Forward -71 -52 -28.6149 0.206
NP_440815.1_5 Reverse -23 -42 4.03102 0.286
NP_442291.1_5 Reverse -61 -77 18.2498 0.0165
NP_442291.1_5 Forward -196 -180 -4.95634 0.292
NP_441453.1_4 Reverse -62 -70 16.539 0.00633
NP_441453.1_4 Forward -71 -63 16.539 0.00633
NP_441623.1_1 Forward -64 -46 -1.25915 0.24
NP_442151.1_6 Forward -71 -57 18.1908 0.00782
NP_441818.1_1 Reverse -63 -74 18.446 0.0046
NP_441818.1_9 Forward -300 -281 -10.1286 0.292
NP_441465.1_8 Forward -82 -64 5.32902 0.29
NP_442173.1_1 Forward -70 -62 15.4574 0.00633
NP_442173.1_1 Reverse -63 -71 15.4574 0.00633
NP_442752.1_4 Forward -71 -64 13.8055 0.0199
NP_442752.1_4 Reverse -62 -69 13.8055 0.0199
NP_443027.1_4 Forward -73 -63 14.0414 0.0452
NP_443027.1_4 Reverse -60 -70 7.25653 0.24
NP_439997.1_4 Reverse -88 -107 5.99764 0.27
NP_442975.1_10 Reverse -58 -72 10.8154 0.0516
NP_442975.1_10 Forward -75 -61 4.03056 0.249
NP_440784.1_7 Forward -70 -63 15.9687 0.0123
NP_440784.1_7 Reverse -63 -70 15.9687 0.0123
NP_442909.1_7 Reverse -63 -77 18.9768 0.0437
NP_440061.1_9 Reverse -60 -74 11.7987 0.105
NP_440061.1_9 Forward -36 -22 8.25877 0.177
NP_440061.1_9 Forward -327 -313 6.98048 0.223
NP_440110.1_4 Forward -82 -63 6.58763 0.15
NP_442062.1_8 Reverse -62 -72 17.3846 0.00193
NP_442062.1_8 Forward -71 -61 10.3048 0.0493
NP_442062.1_8 Forward -261 -251 4.79825 0.198
NP_440304.1_4 Forward -73 -63 10.8948 0.051
NP_440304.1_4 Reverse -60 -70 10.8948 0.051
NP_440304.1_4 Reverse -250 -260 3.71661 0.293
NP_442242.1_4 Forward -70 -63 14.3954 0.0124
NP_442242.1_4 Reverse -63 -70 14.3954 0.0124
NP_441781.1_7 Reverse -62 -81 12.0942 0.136
NP_441781.1_7 Forward -284 -265 3.24438 0.194
NP_441781.1_7 Forward -77 -58 -3.14714 0.295
NP_441208.1_9 Reverse -59 -73 7.47274 0.221
NP_441594.1_6 Reverse -21 -40 1.67108 0.264
NP_440370.1_10 Reverse -53 -72 7.7676 0.25
NP_442742.1_9 Forward -33 -14 -13.9635 0.289
NP_442110.1_7 Forward -71 -57 12.3893 0.0586
NP_442110.1_7 Reverse -62 -76 -0.0987402 0.274
NP_441925.1_4 Reverse -275 -294 -6.88445 0.185
NP_441925.1_4 Forward -178 -159 -15.6359 0.269
NP_441083.1_5 Reverse -62 -72 20.3345 0.00053
NP_441083.1_5 Forward -71 -61 11.2881 0.0159
NP_442841.1_10 Reverse -61 -80 17.109 0.0811
NP_441738.1_2 Forward -69 -62 15.28 0.0102
NP_441738.1_2 Reverse -64 -71 15.28 0.0102
NP_441738.1_2 Forward -275 -268 6.52862 0.261
NP_441558.1_5 Forward -73 -54 22.3206 0.00215
NP_440209.1_1 Reverse -62 -70 18.1123 0.00295
NP_440209.1_1 Forward -71 -63 18.1123 0.00295
NP_442889.1_8 Reverse -59 -73 7.76712 0.141
NP_441713.1_1 Reverse -56 -75 -5.11376 0.113
NP_441713.1_1 Forward -83 -64 -15.5368 0.265
NP_440178.1_7 Reverse -104 -123 -22.125 0.255
NP_440178.1_7 Reverse -61 -80 -22.5183 0.267
NP_442570.1_3 Forward -269 -250 5.60432 0.159
NP_442570.1_3 Forward -270 -251 -6.68705 0.259
NP_441716.1_1 Reverse -62 -76 22.6157 0.00332
NP_441716.1_1 Forward -150 -136 3.73617 0.259
NP_442111.1_4 Forward -72 -58 20.3541 0.00311
NP_442111.1_4 Reverse -61 -75 5.30946 0.169
NP_441163.1_1 Reverse -244 -261 13.0178 0.183
NP_440906.1_5 Forward -70 -63 15.8704 0.0124
NP_440906.1_5 Reverse -63 -70 15.8704 0.0124
NP_440747.1_10 Reverse -59 -71 15.2803 0.0019
NP_440747.1_10 Forward -74 -62 7.51213 0.00286
NP_440747.1_10 Reverse -183 -195 -12.5474 0.297
NP_441486.1_1 Forward -74 -60 15.0442 0.00619
NP_441486.1_1 Reverse -59 -73 3.63784 0.0563
NP_442634.1_4 Forward -73 -59 -1.18038 0.149
NP_442634.1_4 Reverse -60 -74 -2.36035 0.149
NP_441265.1_5 Forward -101 -83 18.0129 0.257
NP_440842.1_10 Forward -225 -211 3.04785 0.268
NP_442848.1_1 Forward -77 -63 15.5359 0.015
NP_441012.1_4 Forward -183 -170 12.999 0.225
NP_443018.1_3 Forward -70 -63 14.8871 0.0123
NP_443018.1_3 Reverse -63 -70 14.8871 0.0123
NP_441316.1_7 Forward -73 -58 5.09311 0.121
NP_441634.1_8 Forward -35 -21 -2.16369 0.295
NP_441634.1_8 Forward -263 -249 -3.83532 0.295
NP_441634.1_9 Forward -190 -171 7.96345 0.294
NP_440376.1_1 Forward -71 -62 19.4693 0.000692
NP_440376.1_1 Reverse -62 -71 19.4693 0.000692
NP_441588.1_4 Forward -69 -59 7.05986 0.178
NP_442687.1_7 Reverse -61 -71 9.02648 0.0994
NP_442687.1_7 Forward -72 -62 8.92815 0.0994
NP_442958.1_3 Reverse -51 -70 -2.75381 0.299
NP_440642.1_10 Forward -35 -21 4.8172 0.25
NP_441013.1_3 Reverse -170 -189 10.6192 0.205
NP_440667.1_2 Reverse -213 -232 -7.96535 0.288
NP_442296.1_9 Reverse -63 -82 -0.000545616 0.197
NP_442658.1_1 Reverse -60 -70 13.0576 0.04
NP_442658.1_1 Reverse -174 -184 10.5993 0.114
NP_442658.1_1 Forward -73 -63 6.76441 0.214
NP_442658.1_1 Reverse -250 -260 6.56775 0.224
NP_442658.1_1 Forward -279 -269 4.89613 0.292
NP_440141.1_8 Reverse -152 -171 5.60432 0.273
NP_442782.1_2 Forward -335 -321 1.76955 0.281
NP_442782.1_4 Reverse -21 -35 18.4858 0.114
NP_442205.1_9 Forward -77 -61 7.33503 0.105
NP_441414.1_9 Reverse -62 -81 3.44104 0.0588
NP_441958.1_5 Reverse -61 -71 21.2195 0.000805
NP_441958.1_5 Forward -72 -62 12.2714 0.00183
NP_442836.1_5 Reverse -176 -195 2.55606 0.255
NP_440203.1_5 Forward -68 -58 13.4509 0.115
NP_440203.1_5 Forward -275 -265 11.4843 0.19
NP_440203.1_5 Reverse -65 -75 11.1893 0.202
NP_440203.1_5 Forward -36 -26 8.43603 0.299
NP_440984.1_7 Reverse -57 -71 9.73436 0.127
NP_439990.1_5 Reverse -57 -70 8.08242 0.181
NP_441338.2_4 Reverse -129 -148 10.7175 0.279
NP_442911.1_2 Forward -81 -62 5.211 0.0344
NP_440153.1_5 Reverse -63 -77 15.5359 0.0551
NP_440153.1_5 Forward -70 -56 5.40779 0.191
NP_440153.1_5 Reverse -216 -230 2.35953 0.225
NP_442536.1_7 Forward -77 -58 13.5691 0.273
NP_443055.1_6 Forward -362 -344 -1.25988 0.276
NP_440993.1_2 Reverse -57 -73 3.59845 0.256
NP_440827.1_8 Forward -358 -340 15.2604 0.178
NP_440388.1_7 Reverse -37 -56 4.62101 0.201
NP_442002.1_1 Reverse -305 -323 -7.55234 0.251
NP_441294.1_7 Forward -75 -61 12.8022 0.0838
NP_441294.1_7 Reverse -58 -72 9.15464 0.256
NP_441646.1_1 Reverse -55 -74 5.70265 0.176
NP_442438.1_10 Forward -76 -62 11.111 0.0463
NP_442438.1_10 Reverse -57 -71 1.76955 0.188
NP_442438.1_10 Reverse -345 -359 -0.787057 0.279
NP_442431.1_10 Forward -297 -279 -0.472507 0.289
NP_441000.1_6 Reverse -61 -75 -5.01529 0.257
NP_442771.1_1 Forward -58 -40 -8.83064 0.208
NP_440147.1_4 Reverse -60 -73 12.9006 0.0326
NP_440147.1_4 Forward -73 -60 1.59258 0.224
NP_441175.1_7 Forward -71 -52 6.29264 0.262
NP_441550.1_8 Reverse -60 -70 15.3192 0.0132
NP_441550.1_8 Forward -73 -63 12.3692 0.0336
NP_441550.1_8 Reverse -372 -382 5.58445 0.242
NP_441916.1_7 Forward -71 -61 18.9579 0.00144
NP_441916.1_7 Reverse -62 -72 10.3048 0.0261
NP_441916.1_7 Forward -191 -181 3.22496 0.223
NP_441916.1_10 Forward -79 -60 5.50599 0.211
NP_441041.1_4 Forward -71 -52 -1.18052 0.1
NP_441041.1_4 Forward -77 -58 -9.047 0.211
NP_441041.1_4 Reverse -333 -352 -9.24366 0.214
NP_441041.1_7 Reverse -59 -71 14.4144 0.0348
NP_442396.1_5 Forward -75 -62 8.18076 0.16
NP_442004.1_6 Reverse -62 -76 11.0127 0.133
NP_442004.1_6 Forward -71 -57 3.8345 0.231
NP_441725.1_4 Reverse -57 -71 3.93223 0.278
NP_441725.1_5 Reverse -63 -73 11.2881 0.0247
NP_441725.1_5 Forward -70 -60 1.94665 0.115
NP_441725.1_5 Reverse -69 -79 -1.19994 0.294
NP_439966.1_7 Forward -73 -63 15.8108 0.0124
NP_439966.1_7 Reverse -60 -70 6.27276 0.185
NP_439966.1_7 Forward -172 -162 4.01116 0.295
NP_442941.1_3 Reverse -63 -73 19.9412 0.00262
NP_442941.1_3 Forward -70 -60 11.0914 0.0116
NP_440289.1_2 Forward -74 -61 -2.93064 0.262
NP_440289.1_2 Reverse -59 -72 -4.89726 0.294
NP_442281.1_1 Reverse -57 -71 17.6002 0.00542
NP_440437.1_1 Reverse -56 -75 5.30933 0.0881
NP_442012.1_2 Reverse -180 -199 5.211 0.211
NP_442012.1_9 Forward -243 -225 14.6819 0.276
NP_440498.1_1 Forward -80 -62 17.4237 0.0181
NP_440498.1_1 Reverse -53 -71 8.96727 0.0786
NP_442982.1_5 Reverse -52 -71 6.98095 0.135
NP_442982.1_5 Forward -81 -62 1.86774 0.226
NP_442068.1_4 Forward -260 -241 6.1935 0.237
NP_441644.1_6 Forward -71 -61 19.0557 0.000803
NP_441644.1_6 Reverse -62 -72 17.3841 0.00127
NP_442215.1_2 Forward -73 -57 8.90832 0.0605
NP_442215.1_2 Reverse -60 -76 -5.84132 0.26
NP_442029.1_6 Forward -266 -247 2.55606 0.294
NP_442247.1_7 Forward -74 -55 9.24257 0.21
NP_440929.1_8 Forward -71 -62 19.2726 0.000701
NP_440929.1_8 Reverse -62 -71 19.2726 0.000701
NP_442933.1_10 Forward -71 -62 17.601 0.00325
NP_442933.1_10 Reverse -62 -71 17.601 0.00325
NP_441751.2_8 Reverse -63 -77 17.6008 0.0079
NP_441751.2_8 Forward -38 -24 -5.90027 0.244
NP_442554.1_8 Forward -70 -60 16.4013 0.0065
NP_442554.1_8 Reverse -63 -73 15.9097 0.00747
NP_442554.1_8 Forward -260 -250 3.02829 0.245
NP_441586.1_1 Forward -302 -283 37.1686 0.00000415
NP_441586.1_2 Forward -386 -367 34.9069 0.0000287
NP_441586.1_3 Forward -206 -187 23.9922 0.00508
NP_441586.1_4 Forward -281 -262 19.469 0.0547
NP_441586.1_5 Forward -326 -307 28.5154 0.00105
NP_441586.1_6 Forward -350 -331 30.6787 0.000349
NP_441586.1_7 Forward -164 -145 33.3337 0.0000313
NP_441762.1_7 Forward -72 -60 0.333971 0.0747
NP_441762.1_7 Reverse -61 -73 -6.74586 0.284
NP_442142.1_4 Reverse -59 -72 11.6217 0.054
NP_442142.1_4 Forward -74 -61 6.90188 0.153
NP_442142.1_4 Reverse -173 -186 5.62358 0.187
NP_442292.1_1 Reverse -63 -72 18.486 0.00229
NP_442292.1_1 Forward -70 -61 17.5026 0.00435
NP_442476.1_6 Reverse -63 -77 0.589577 0.252
NP_442381.1_8 Forward -181 -162 -7.76869 0.202
NP_443009.1_5 Forward -72 -61 14.5128 0.02
NP_443009.1_5 Reverse -61 -72 10.1862 0.0792
NP_442301.1_2 Forward -186 -167 4.52188 0.275
NP_442741.1_7 Reverse -146 -165 11.2092 0.271
NP_441715.1_4 Reverse -63 -73 14.828 0.0268
NP_441715.1_4 Forward -70 -60 7.35486 0.108
NP_440015.1_9 Reverse -62 -80 7.29564 0.112
NP_441448.1_2 Forward -160 -141 -0.39464 0.256
NP_441198.1_8 Reverse -60 -70 12.783 0.116
NP_440464.1_3 Forward -148 -129 8.25926 0.222
NP_441468.1_1 Forward -70 -63 15.8704 0.0124
NP_441468.1_1 Reverse -63 -70 15.8704 0.0124
NP_441618.1_8 Reverse -298 -317 25.8605 0.00353
NP_441020.2_6 Forward -73 -56 10.5603 0.141
NP_441015.1_10 Forward -76 -57 -10.4236 0.284
NP_441673.1_1 Forward -71 -62 20.8459 0.000698
NP_441673.1_1 Reverse -62 -71 20.8459 0.000698
NP_441956.1_9 Reverse -61 -80 9.93088 0.228
NP_441826.1_2 Forward -77 -63 18.7808 0.0115
NP_441826.1_2 Reverse -56 -70 5.80112 0.096
NP_442868.1_6 Forward -73 -63 9.91146 0.038
NP_442868.1_6 Reverse -60 -70 0.963343 0.205
NP_441612.1_2 Reverse -62 -72 8.54929 0.21
NP_442361.1_3 Reverse -56 -69 14.0806 0.129
NP_442808.1_1 Reverse -61 -71 8.73102 0.0481
NP_442808.1_1 Forward -72 -62 8.63269 0.0481
NP_442808.1_1 Forward -317 -307 3.51951 0.238
NP_441101.1_10 Reverse -58 -77 3.14605 0.173
NP_441176.1_4 Reverse -295 -314 14.1591 0.29
NP_440145.1_3 Reverse -52 -71 9.83255 0.0433
NP_442542.1_2 Reverse -159 -172 4.73917 0.298
NP_442050.1_5 Forward -73 -63 16.4991 0.00812
NP_442050.1_5 Reverse -60 -70 9.22267 0.193
NP_441114.1_3 Reverse -253 -262 14.5527 0.193
NP_440558.1_2 Reverse -248 -267 -3.04881 0.232
NP_440558.1_2 Forward -264 -245 -4.6221 0.247
NP_440558.1_2 Reverse -249 -268 -6.09707 0.271
NP_442789.1_4 Reverse -23 -42 -7.76869 0.299
NP_442789.1_5 Forward -226 -207 5.40766 0.215
NP_441878.1_6 Reverse -61 -71 10.5014 0.0176
NP_441878.1_6 Forward -72 -62 10.4031 0.0176
NP_441878.1_6 Reverse -251 -261 -7.59145 0.245
NP_441878.1_6 Forward -78 -68 -7.98478 0.285
NP_441036.1_8 Reverse -61 -71 15.713 0.00724
NP_441036.1_8 Forward -72 -62 8.33817 0.174
NP_441557.1_5 Forward -71 -62 19.9609 0.000699
NP_441557.1_5 Reverse -62 -71 19.9609 0.000699
NP_442066.2_4 Forward -71 -52 -6.78538 0.254
NP_442183.1_1 Reverse -62 -76 8.75105 0.109
NP_442397.1_9 Reverse -62 -81 5.30933 0.246
NP_440979.1_3 Reverse -63 -81 13.3922 0.234
NP_441459.1_3 Reverse -206 -225 11.9103 0.283
NP_441574.1_1 Forward -207 -188 -3.3438 0.238
NP_441549.1_9 Forward -75 -57 3.46073 0.0925
NP_442347.1_2 Reverse -63 -72 12.4878 0.056
NP_442347.1_2 Forward -70 -61 3.34298 0.284
NP_442645.1_2 Forward -79 -60 -6.58872 0.0908
NP_442645.1_2 Forward -269 -250 -16.4218 0.233
NP_441037.1_4 Reverse -60 -70 15.0168 0.028
NP_441633.1_3 Forward -172 -159 -3.12731 0.177
NP_441633.1_3 Forward -73 -60 -6.07724 0.236
NP_441633.1_3 Reverse -60 -73 -6.07724 0.236
NP_440136.1_2 Forward -70 -63 15.9687 0.0123
NP_440136.1_2 Reverse -63 -70 15.9687 0.0123
NP_442590.1_10 Forward -77 -58 6.4893 0.244
NP_442998.1_5 Reverse -91 -101 10.6981 0.206
NP_442998.1_10 Forward -69 -62 15.5754 0.0102
NP_442998.1_10 Reverse -64 -71 15.5754 0.0102
NP_440299.1_1 Forward -75 -62 16.2433 0.0109
NP_440299.1_1 Reverse -58 -71 13.195 0.0319
NP_440299.1_1 Reverse -217 -230 2.67367 0.279
NP_441799.1_1 Forward -75 -61 16.0269 0.0153
NP_441799.1_1 Reverse -58 -72 10.0287 0.0797
NP_441799.1_1 Forward -265 -251 5.40719 0.21
NP_441007.1_10 Reverse -57 -70 1.29759 0.203
NP_441007.1_10 Forward -76 -63 -0.767364 0.293
NP_440256.1_1 Reverse -59 -78 -0.4922 0.0936
NP_440256.1_1 Forward -74 -55 -7.57203 0.24
NP_441559.1_8 Reverse -247 -261 1.57289 0.155
NP_441559.1_8 Reverse -57 -71 1.08123 0.156
NP_440915.1_6 Reverse -58 -72 3.73617 0.1
NP_440915.1_6 Forward -75 -61 2.35953 0.119
NP_440997.1_4 Forward -320 -301 15.0441 0.213
NP_442158.1_4 Forward -85 -75 10.7964 0.283
NP_441296.1_9 Forward -55 -42 8.67183 0.294
NP_442785.1_7 Reverse -60 -74 9.14437 0.273
NP_442866.1_1 Forward -76 -57 -7.4737 0.266
NP_441939.1_3 Forward -70 -51 12.3892 0.102
NP_441494.1_6 Reverse -57 -70 6.01747 0.289
NP_439985.1_7 Forward -77 -58 9.3409 0.18
NP_442993.1_1 Reverse -62 -78 -6.82463 0.146
NP_440677.1_6 Forward -80 -61 9.43923 0.27
NP_442386.1_9 Forward -72 -63 13.8639 0.0289
NP_442386.1_9 Reverse -61 -70 6.39082 0.219
NP_441340.1_5 Forward -70 -63 15.6737 0.0124
NP_441340.1_5 Reverse -63 -70 15.6737 0.0124
NP_441254.1_1 Reverse -122 -135 11.4251 0.295
NP_442240.1_2 Forward -70 -51 -10.4236 0.137
NP_440586.1_8 Forward -70 -63 13.2151 0.026
NP_440586.1_8 Reverse -63 -70 13.2151 0.026
NP_442251.1_6 Forward -70 -63 15.2804 0.0124
NP_442251.1_6 Reverse -63 -70 15.2804 0.0124
NP_440192.1_4 Forward -184 -165 9.39761 0.276
NP_440192.1_4 Reverse -159 -178 8.71846 0.29
NP_440684.1_2 Forward -359 -340 23.8939 0.0331
NP_440684.1_3 Forward -134 -115 22.2223 0.0326
NP_440684.1_7 Forward -212 -193 20.1573 0.277
NP_440684.1_9 Forward -77 -63 15.2409 0.0988
NP_440684.1_9 Forward -260 -246 13.5693 0.16
NP_441262.1_3 Reverse -62 -69 14.7888 0.0223
NP_441262.1_3 Forward -71 -64 14.7888 0.0223
NP_443051.1_1 Reverse -61 -70 19.5676 0.00335
NP_443051.1_1 Forward -72 -63 10.4228 0.00754
NP_441232.1_10 Forward -82 -63 3.53937 0.223
NP_439984.1_7 Forward -30 -12 -4.40575 0.292
NP_439937.1_9 Forward -262 -245 -0.355176 0.119
NP_439937.1_9 Forward -183 -166 -13.0398 0.279
NP_440408.1_7 Reverse -308 -327 7.86593 0.284
NP_440439.1_1 Forward -74 -61 9.2624 0.0465
NP_440439.1_1 Reverse -59 -72 2.08423 0.138
NP_439943.1_7 Forward -76 -57 5.70265 0.245
NP_440372.1_2 Forward -70 -63 16.3621 0.0124
NP_440372.1_2 Reverse -63 -70 16.3621 0.0124
NP_440574.1_3 Forward -353 -334 0.196116 0.262
NP_442511.1_2 Reverse -345 -364 15.0747 0.23
NP_440819.1_5 Reverse -90 -98 17.424 0.185
NP_440139.1_1 Forward -77 -58 2.9486 0.219
NP_441572.1_7 Reverse -56 -75 7.27595 0.0771
NP_442384.1_10 Reverse -62 -75 18.0139 0.00545
NP_442384.1_10 Forward -71 -58 15.4572 0.00986
NP_442384.1_10 Forward -195 -182 7.19745 0.0866
NP_442790.1_4 Forward -80 -61 -15.0452 0.284
NP_442262.1_10 Forward -70 -63 14.1988 0.0123
NP_442262.1_10 Reverse -63 -70 14.1988 0.0123
NP_441689.1_5 Forward -73 -63 15.3192 0.0403
NP_441689.1_5 Reverse -60 -70 8.3377 0.132
NP_440075.1_5 Reverse -60 -79 10.2251 0.288
NP_440562.1_3 Forward -70 -53 15.0835 0.0567
NP_441965.1_3 Forward -81 -62 5.80098 0.15
NP_441965.1_10 Forward -74 -58 10.0883 0.109
NP_440297.1_9 Reverse -63 -73 9.32148 0.0917
NP_440297.1_9 Forward -70 -60 -0.216628 0.282
NP_440297.1_9 Reverse -69 -79 -0.314959 0.282
NP_442280.1_10 Forward -42 -24 8.57124 0.258
NP_441592.1_4 Reverse -62 -81 15.1424 0.0641
NP_441592.1_4 Forward -185 -166 7.27595 0.124
NP_441896.1_5 Forward -267 -260 15.3787 0.268
NP_440999.1_9 Reverse -58 -72 3.34284 0.131
NP_440999.1_9 Reverse -248 -262 -2.16369 0.261
NP_440999.1_9 Forward -43 -29 -2.55701 0.27
NP_440888.1_2 Reverse -62 -76 17.0102 0.00497
NP_440888.1_2 Forward -261 -247 11.5037 0.0657
NP_440888.1_2 Forward -71 -57 8.84875 0.145
NP_442892.1_9 Forward -95 -81 20.7467 0.0264
NP_440600.1_4 Reverse -54 -72 -6.56903 0.285
NP_440179.1_6 Reverse -253 -272 4.52268 0.246
NP_440491.1_1 Forward -74 -55 8.18396 0.249
NP_440052.1_5 Reverse -202 -221 1.27776 0.165
NP_442948.1_2 Reverse -61 -80 5.11266 0.256
NP_442033.1_10 Forward -319 -300 -11.7019 0.257
NP_441949.1_2 Forward -81 -62 1.17943 0.284
NP_441543.1_2 Reverse -63 -72 16.9127 0.00359
NP_441543.1_2 Forward -70 -61 15.9293 0.00518
NP_442845.1_2 Forward -77 -63 16.2242 0.0636
NP_442845.1_2 Reverse -62 -76 5.21113 0.24
NP_442845.1_2 Reverse -56 -70 4.52282 0.258
NP_441551.1_5 Forward -75 -59 11.0709 0.183
NP_441469.1_8 Reverse -61 -70 6.5879 0.227
NP_441469.1_8 Forward -72 -63 6.48957 0.227
NP_443064.1_6 Reverse -62 -72 12.5669 0.0796
NP_443064.1_6 Forward -71 -61 10.8217 0.13
NP_442578.1_7 Forward -70 -63 14.5921 0.026
NP_442578.1_7 Reverse -63 -70 14.5921 0.026
NP_440071.1_6 Reverse -19 -33 13.9988 0.251
NP_441462.1_2 Forward -71 -61 20.2362 0.000805
NP_441462.1_2 Reverse -62 -72 11.5831 0.00406
NP_441621.1_7 Forward -73 -59 -5.11362 0.248
NP_441929.1_6 Reverse -80 -99 8.06259 0.271
NP_443062.1_1 Forward -353 -335 5.71821 0.22
NP_440519.1_8 Reverse -339 -355 1.23851 0.29
NP_442204.1_1 Reverse -58 -69 18.2499 0.0189
NP_442697.1_1 Forward -230 -211 12.5858 0.156
NP_440516.1_8 Forward -71 -62 16.9127 0.00442
NP_440516.1_8 Reverse -62 -71 16.9127 0.00442
NP_440516.1_8 Reverse -161 -170 -0.295266 0.232
NP_442080.1_7 Reverse -57 -76 -3.3438 0.29
NP_442428.1_5 Forward -70 -63 15.8704 0.0124
NP_442428.1_5 Reverse -63 -70 15.8704 0.0124
NP_441443.1_1 Reverse -39 -58 -0.885524 0.237
NP_440673.1_3 Forward -69 -62 12.4288 0.0426
NP_440673.1_3 Reverse -64 -71 12.4288 0.0426
NP_440865.1_9 Reverse -24 -43 -9.14533 0.277
NP_441052.1_2 Reverse -62 -72 19.9412 0.00106
NP_441052.1_2 Forward -71 -61 10.4031 0.0285
NP_441052.1_2 Reverse -215 -225 4.69992 0.149
NP_441052.1_2 Forward -195 -185 4.60159 0.154
NP_442219.1_9 Reverse -63 -72 17.7976 0.00718
NP_442219.1_9 Forward -70 -61 8.25953 0.0681
NP_440436.1_4 Reverse -63 -72 17.2072 0.00233
NP_440436.1_4 Forward -70 -61 9.24241 0.0871
NP_440436.1_4 Reverse -69 -78 6.78414 0.147
NP_440436.1_4 Forward -347 -338 6.48915 0.157
NP_441719.1_4 Forward -70 -63 16.3621 0.0124
NP_441719.1_4 Reverse -63 -70 16.3621 0.0124
NP_441004.1_1 Reverse -303 -322 -14.6519 0.269
NP_441004.1_1 Reverse -164 -183 -17.1101 0.289
NP_441004.1_4 Reverse -306 -316 8.1415 0.281
NP_442813.1_4 Forward -95 -76 -6.39206 0.299
NP_442366.1_3 Forward -349 -331 -0.669169 0.197
NP_442366.1_3 Forward -72 -54 -5.68405 0.292
NP_442366.1_5 Reverse -59 -69 14.0409 0.0497
NP_442873.1_3 Reverse -205 -224 3.9319 0.274
NP_441115.1_4 Forward -72 -54 11.7197 0.129
NP_441115.1_4 Forward -349 -331 7.68819 0.278
NP_442206.1_10 Forward -71 -56 1.55319 0.226
NP_442312.1_1 Reverse -240 -259 10.5209 0.275
NP_443054.1_2 Forward -73 -59 1.47456 0.245
NP_442430.1_10 Reverse -52 -71 9.24175 0.297
NP_441966.1_7 Reverse -119 -138 4.52188 0.192
NP_441851.1_10 Forward -72 -62 15.8113 0.00552
NP_441851.1_10 Reverse -61 -71 8.53483 0.114
NP_442208.1_5 Reverse -307 -326 -10.6203 0.299
NP_442622.1_8 Forward -191 -173 -18.4671 0.222
NP_442622.1_8 Reverse -215 -233 -18.8604 0.285
NP_442622.1_8 Reverse -62 -80 -18.9587 0.293
NP_442856.1_3 Reverse -181 -200 11.0125 0.194
NP_442515.1_1 Reverse -61 -75 0.0979218 0.203
NP_441396.1_5 Forward -290 -281 8.35786 0.224
NP_441982.1_6 Reverse -76 -85 12.7718 0.274
NP_441046.1_2 Forward -137 -118 0.884433 0.262
NP_441349.1_10 Forward -81 -62 10.6192 0.0232
NP_441349.1_10 Reverse -52 -71 -4.13045 0.161
NP_441349.1_10 Reverse -172 -191 -4.52377 0.173
NP_441349.1_10 Forward -265 -246 -9.53865 0.294
NP_442843.1_1 Reverse -154 -173 -8.65367 0.258
NP_440474.1_8 Reverse -63 -77 5.70218 0.244
NP_441477.1_10 Forward -78 -60 9.16393 0.181
NP_442450.1_5 Forward -73 -63 9.32148 0.115
NP_442450.1_5 Reverse -60 -70 7.64985 0.13
NP_440588.1_2 Forward -80 -61 9.3409 0.0446
NP_440588.1_2 Reverse -53 -72 -0.4922 0.15
NP_440588.1_2 Reverse -59 -78 -6.39206 0.28
NP_442006.1_2 Forward -216 -199 -7.82764 0.185
NP_442006.1_2 Forward -141 -124 -14.6125 0.205
NP_442006.1_2 Forward -224 -207 -17.3657 0.274
NP_441003.1_9 Reverse -53 -72 5.211 0.266
NP_443047.1_7 Reverse -269 -288 4.52268 0.266
NP_442243.1_1 Reverse -56 -74 0.215075 0.235
NP_441570.1_1 Reverse -62 -80 3.06741 0.0225
NP_441570.1_1 Forward -71 -53 -9.22396 0.132
NP_440078.1_10 Forward -71 -52 2.55606 0.269
NP_441078.1_4 Forward -71 -62 19.6659 0.0007
NP_441078.1_4 Reverse -62 -71 19.6659 0.0007
NP_441078.1_4 Reverse -252 -261 -1.47524 0.266
NP_440526.1_3 Reverse -69 -80 6.64635 0.189
NP_440526.1_3 Forward -32 -21 1.04151 0.267
NP_440526.1_3 Reverse -63 -74 0.844851 0.267
NP_441432.1_8 Reverse -61 -70 16.8143 0.00595
NP_441432.1_8 Forward -72 -63 16.8143 0.00595
NP_441432.1_8 Reverse -344 -353 6.48957 0.114
NP_442320.1_8 Forward -77 -63 -5.21195 0.209
NP_442344.1_7 Forward -70 -51 -7.76869 0.191
NP_441732.1_2 Reverse -58 -74 21.1997 0.00274
NP_441732.1_2 Forward -75 -59 -17.2477 0.247
NP_441732.1_5 Forward -63 -49 13.2743 0.192
NP_440760.1_1 Reverse -213 -232 -21.3384 0.234
NP_440760.1_1 Reverse -186 -205 -22.8133 0.271
NP_442797.1_7 Forward -183 -165 1.98577 0.245
NP_442797.1_7 Reverse -61 -79 -0.177514 0.282
NP_440199.1_10 Forward -74 -64 15.5163 0.0861
NP_442353.1_4 Reverse -56 -75 3.24359 0.22
NP_441072.1_2 Forward -82 -63 12.3892 0.173
NP_442400.1_10 Reverse -83 -96 7.9876 0.281
NP_440713.1_4 Forward -81 -62 8.06259 0.174
NP_442489.1_7 Forward -71 -62 20.1576 0.000695
NP_442489.1_7 Reverse -62 -71 20.1576 0.000695
NP_442489.1_7 Reverse -252 -261 -1.6719 0.235
NP_442489.1_7 Forward -261 -252 -1.96689 0.28
NP_440559.1_1 Reverse -63 -72 17.4043 0.00658
NP_440559.1_1 Forward -70 -61 8.65285 0.0586
NP_441659.2_8 Forward -71 -61 20.9245 0.000805
NP_441659.2_8 Reverse -62 -72 18.1713 0.00133
NP_442913.1_10 Reverse -53 -72 1.86774 0.133
NP_442008.1_2 Reverse -59 -78 5.89931 0.223
NP_442346.1_5 Forward -72 -62 16.6963 0.00248
NP_442346.1_5 Reverse -61 -71 16.303 0.00248
NP_440545.1_3 Reverse -58 -75 12.3302 0.0212
NP_440545.1_3 Forward -75 -58 8.59364 0.0438
NP_441856.1_3 Forward -74 -55 -0.295539 0.217
NP_440555.1_1 Reverse -51 -70 3.14605 0.294
NP_440010.1_10 Forward -83 -64 1.47442 0.299
NP_440847.1_3 Forward -101 -87 13.372 0.217
NP_440847.1_3 Forward -148 -134 10.6187 0.287
NP_442603.1_7 Reverse -62 -76 9.6354 0.144
NP_441050.1_5 Reverse -154 -172 -2.83245 0.284
NP_440449.1_6 Forward -325 -307 8.15857 0.206
NP_441833.1_4 Forward -70 -63 15.9687 0.0124
NP_441833.1_4 Reverse -63 -70 15.9687 0.0124
NP_442799.1_8 Forward -230 -211 7.11193 0.296
NP_441895.1_10 Reverse -87 -106 -18.1918 0.282
NP_442699.1_8 Reverse -98 -117 -12.7836 0.257
NP_442162.1_9 Forward -70 -63 16.2637 0.0124
NP_442162.1_9 Reverse -63 -70 16.2637 0.0124
NP_440671.1_4 Forward -77 -63 9.73436 0.172
NP_440671.1_4 Reverse -56 -70 8.16106 0.202
NP_440224.1_1 Reverse -51 -70 -3.04881 0.25
NP_440204.1_5 Forward -100 -81 13.9873 0.23
NP_442140.1_3 Forward -70 -60 6.66654 0.159
NP_442140.1_3 Reverse -63 -73 4.40493 0.243
NP_440875.1_9 Reverse -350 -360 8.37203 0.233
NP_440875.1_9 Forward -69 -59 8.37203 0.233
NP_441813.1_5 Forward -73 -63 15.9097 0.01
NP_441813.1_5 Reverse -60 -70 8.63316 0.0367
NP_440590.1_4 Forward -70 -57 2.57589 0.0845
NP_440590.1_4 Reverse -63 -76 -4.20895 0.258
NP_440567.1_1 Reverse -63 -77 14.6509 0.0187
NP_440567.1_1 Forward -70 -56 5.50613 0.102
NP_442497.1_10 Forward -70 -61 17.601 0.00813
NP_442497.1_10 Reverse -63 -72 10.4228 0.0087
NP_440821.1_4 Forward -73 -63 18.2696 0.00448
NP_440821.1_4 Reverse -60 -70 2.24165 0.131
NP_441239.1_9 Reverse -60 -72 11.1504 0.0648
NP_441239.1_9 Forward -172 -160 4.46387 0.253
NP_441239.1_9 Forward -73 -61 4.36554 0.253
NP_441239.1_9 Reverse -250 -262 3.87389 0.272
NP_440156.1_4 Forward -102 -92 14.8275 0.176
NP_442568.1_9 Forward -212 -193 17.5024 0.123
NP_441892.1_1 Reverse -53 -70 -5.46769 0.281
NP_440665.1_1 Forward -150 -131 -6.29373 0.202
NP_442044.1_1 Reverse -57 -76 -14.3569 0.289
NP_442643.1_1 Forward -77 -58 -2.16383 0.147
NP_442643.1_5 Forward -68 -49 2.16274 0.25
NP_441017.1_6 Forward -189 -175 11.4053 0.268
NP_442629.1_1 Forward -215 -201 19.4691 0.251
NP_442083.1_9 Reverse -306 -325 11.8975 0.177
NP_441617.1_6 Forward -100 -81 5.99764 0.138
NP_442052.1_7 Reverse -307 -321 15.0442 0.199
NP_440546.1_4 Forward -71 -61 13.5365 0.0459
NP_440546.1_4 Reverse -62 -72 10.046 0.109
NP_440546.1_6 Reverse -154 -173 7.7676 0.267
NP_441509.1_2 Forward -276 -258 13.8838 0.145
NP_440462.1_6 Reverse -60 -70 10.5014 0.0396
NP_440462.1_6 Forward -73 -63 7.74818 0.0699
NP_440868.1_4 Forward -75 -63 15.7719 0.0164
NP_440868.1_4 Reverse -58 -70 6.1355 0.0878
NP_442499.1_1 Reverse -63 -82 13.7658 0.201
NP_442499.1_1 Forward -223 -204 6.68596 0.203
NP_442499.1_3 Reverse -276 -294 4.54237 0.289
NP_440812.1_10 Forward -289 -276 13.7856 0.259
NP_441848.1_7 Reverse -109 -128 -3.73788 0.284
NP_441084.1_6 Forward -350 -336 11.4772 0.201
NP_441084.1_6 Reverse -82 -96 9.53803 0.278
NP_440653.1_10 Reverse -333 -352 11.8975 0.126
NP_442039.1_4 Forward -70 -63 15.1821 0.0124
NP_442039.1_4 Reverse -63 -70 15.1821 0.0124
NP_441811.1_8 Forward -77 -63 7.17775 0.257
NP_442625.1_3 Reverse -175 -194 12.0942 0.22
NP_442679.1_1 Reverse -78 -97 -0.295539 0.219
NP_441926.1_3 Reverse -62 -78 6.54838 0.17
NP_442837.1_3 Forward -70 -63 15.7721 0.0124
NP_442837.1_3 Reverse -63 -70 15.7721 0.0124
NP_442053.1_1 Forward -71 -62 18.3876 0.0007
NP_442053.1_1 Reverse -62 -71 18.3876 0.0007
NP_440505.1_3 Forward -73 -63 16.303 0.00696
NP_440505.1_3 Reverse -60 -70 8.04317 0.147
NP_441203.1_1 Forward -70 -51 -12.5869 0.143
NP_441408.2_7 Forward -350 -331 -5.60541 0.297
NP_440914.1_1 Reverse -62 -72 17.5935 0.000537
NP_440914.1_1 Forward -71 -61 16.3248 0.00196
NP_440914.1_1 Reverse -252 -262 12.0308 0.0684
NP_440914.1_1 Forward -77 -67 9.39583 0.186
NP_440914.1_1 Forward -362 -352 8.6151 0.186
NP_440914.1_1 Reverse -339 -349 8.12715 0.207
NP_441011.1_8 Forward -70 -61 16.6177 0.00602
NP_441011.1_8 Reverse -63 -72 8.25953 0.144
NP_442101.1_10 Reverse -54 -73 3.24438 0.0714
NP_442533.1_6 Forward -71 -62 17.2076 0.00137
NP_442533.1_6 Reverse -62 -71 17.2076 0.00137
NP_442533.1_6 Forward -178 -169 1.57302 0.294
NP_440263.1_5 Forward -97 -83 11.701 0.294
NP_442232.1_3 Reverse -153 -172 -5.40875 0.165
NP_442322.1_9 Forward -106 -88 11.1298 0.251
NP_441482.1_7 Reverse -56 -70 8.55439 0.0162
NP_441482.1_7 Forward -77 -63 -10.8168 0.216
NP_439944.1_9 Reverse -63 -73 19.0562 0.00329
NP_439944.1_9 Forward -70 -60 9.12481 0.1
NP_441028.1_6 Forward -29 -19 3.8145 0.281
NP_440116.1_5 Forward -74 -57 3.18543 0.242
NP_440116.1_8 Forward -70 -51 -2.16383 0.126
NP_441527.1_4 Forward -130 -111 -12.8441 0.294
NP_440115.1_6 Forward -74 -64 8.4365 0.13
NP_440115.1_6 Reverse -59 -69 7.35486 0.147
NP_440007.1_9 Reverse -58 -72 2.75286 0.277
NP_440007.1_9 Forward -387 -373 0.589577 0.294
NP_441170.1_4 Forward -270 -252 6.41066 0.205
NP_441972.1_5 Reverse -253 -272 -8.94866 0.276
NP_441106.1_1 Reverse -61 -70 18.486 0.0028
NP_441106.1_1 Forward -72 -63 9.63616 0.0311
NP_441106.1_1 Reverse -175 -184 2.16301 0.297
NP_439903.1_6 Reverse -59 -78 1.57197 0.243
NP_442306.1_10 Forward -175 -156 -14.2585 0.197
NP_442306.1_10 Reverse -181 -200 -20.0601 0.202
NP_440797.1_2 Forward -82 -63 12.6672 0.264
NP_441286.1_1 Reverse -61 -73 11.937 0.0108
NP_441286.1_1 Forward -72 -60 5.93884 0.0258
NP_441286.1_1 Forward -225 -213 -5.76255 0.223
NP_440670.1_8 Forward -71 -62 18.3876 0.000699
NP_440670.1_8 Reverse -62 -71 18.3876 0.000699
NP_440670.1_8 Reverse -161 -170 3.63797 0.239
NP_441479.1_9 Reverse -131 -149 13.9821 0.271
NP_441930.1_1 Reverse -58 -77 7.86593 0.235
NP_440886.1_7 Forward -171 -161 10.0093 0.0805
NP_440886.1_7 Reverse -61 -71 8.04271 0.0805
NP_440886.1_7 Forward -72 -62 7.94438 0.0805
NP_440886.1_7 Reverse -251 -261 3.61784 0.272
NP_442614.1_2 Reverse -24 -38 9.34103 0.242
NP_442614.1_2 Reverse -62 -76 6.09611 0.293
NP_441399.1_6 Reverse -354 -373 13.0766 0.186
NP_442072.1_9 Forward -72 -54 -4.79907 0.0516
NP_442072.1_9 Reverse -168 -186 -13.0589 0.098
NP_442072.1_9 Reverse -61 -79 -21.3187 0.207
NP_441808.1_8 Forward -224 -205 10.7175 0.231
NP_440907.2_8 Forward -70 -60 15.9091 0.0161
NP_441021.1_1 Reverse -63 -82 -9.44032 0.216
NP_441463.1_3 Forward -81 -62 8.16093 0.0487
NP_441463.1_3 Forward -271 -252 -0.885524 0.134
NP_441463.1_6 Forward -263 -249 6.99573 0.265
NP_441626.1_2 Forward -70 -63 15.7721 0.0124
NP_441626.1_2 Reverse -63 -70 15.7721 0.0124
NP_442365.1_7 Reverse -58 -77 7.07928 0.103
NP_442794.1_1 Reverse -58 -70 12.527 0.0721
NP_442794.1_1 Reverse -335 -347 4.75886 0.249
NP_442615.1_1 Reverse -53 -71 14.1788 0.0104
NP_442615.1_1 Forward -200 -182 0.0191479 0.109
NP_440387.1_1 Reverse -62 -78 24.248 0.00118
NP_440387.1_1 Forward -71 -55 14.0215 0.00739
NP_440855.1_3 Reverse -226 -245 8.4551 0.208
NP_441488.1_8 Reverse -57 -71 12.782 0.146
NP_441174.1_1 Reverse -32 -47 11.583 0.247
NP_440114.1_10 Reverse -62 -76 6.98109 0.25
NP_440114.1_10 Reverse -161 -175 6.29277 0.276
NP_440293.1_3 Forward -268 -249 -1.27885 0.239
NP_439988.1_7 Forward -381 -367 14.9452 0.292
NP_442743.1_5 Forward -76 -57 9.83255 0.148
NP_441311.1_2 Reverse -56 -70 14.3553 0.229
NP_440502.1_3 Reverse -217 -227 15.3483 0.196
NP_442867.1_8 Reverse -130 -149 7.47261 0.244
NP_440457.1_1 Forward -75 -63 11.4454 0.092
NP_440457.1_1 Reverse -157 -169 0.628964 0.25
NP_440457.1_1 Reverse -58 -70 -0.354346 0.262
NP_440798.1_6 Forward -70 -57 11.229 0.0624
NP_441889.1_4 Forward -80 -61 1.17943 0.289
NP_440473.1_1 Reverse -59 -78 18.6807 0.0627
NP_442509.1_6 Forward -140 -121 7.66927 0.294
NP_442509.1_9 Reverse -62 -72 8.14104 0.192
NP_442509.1_9 Forward -71 -61 8.04271 0.192
NP_440554.1_4 Forward -70 -60 8.82982 0.0646
NP_440554.1_4 Reverse -63 -73 7.05986 0.106
NP_441885.1_5 Reverse -62 -72 20.9245 0.000538
NP_441885.1_5 Forward -71 -61 11.3864 0.00668
NP_442341.1_7 Forward -72 -58 8.55439 0.0864
NP_442341.1_9 Reverse -60 -74 16.7152 0.0345
NP_442341.1_9 Forward -73 -59 6.88214 0.21
NP_441756.1_5 Forward -321 -302 -1.86883 0.267
NP_441756.1_6 Forward -155 -136 24.2863 0.0172
NP_442395.2_4 Reverse -251 -270 3.73524 0.197
NP_442395.2_4 Forward -171 -152 3.24359 0.207
NP_443000.1_7 Forward -73 -63 17.0896 0.00865
NP_443000.1_7 Reverse -60 -70 10.6981 0.0345
NP_443059.1_10 Forward -148 -129 2.45694 0.239
NP_440275.1_3 Reverse -60 -70 9.02648 0.0563
NP_440275.1_3 Forward -73 -63 8.1415 0.0602
NP_440275.1_3 Reverse -159 -169 4.3066 0.199
NP_440091.1_1 Forward -75 -63 15.8703 0.0161
NP_440679.1_10 Forward -231 -212 -3.24547 0.14
NP_440679.1_10 Reverse -341 -360 -12.5869 0.203
NP_443010.1_10 Reverse -59 -76 4.12367 0.24
NP_442495.1_4 Forward -67 -57 13.4514 0.187
NP_441105.1_3 Reverse -51 -70 -6.58872 0.236
NP_441105.1_3 Reverse -328 -347 -9.53865 0.29
NP_440216.1_1 Forward -71 -57 7.37441 0.00942
NP_440216.1_1 Reverse -62 -76 -0.295402 0.0284
NP_440172.1_1 Forward -71 -61 17.5813 0.00421
NP_440172.1_1 Reverse -62 -72 15.0247 0.00945
NP_440172.1_1 Reverse -252 -262 7.15819 0.0897
NP_442015.1_3 Reverse -67 -86 11.7983 0.288
NP_442015.1_10 Reverse -58 -71 12.2123 0.0372
NP_442015.1_10 Forward -75 -62 9.55739 0.0475
NP_441226.1_7 Forward -70 -63 14.4934 0.0123
NP_441226.1_7 Reverse -63 -70 14.4934 0.0123
NP_441226.1_7 Reverse -173 -180 5.64364 0.286
NP_441757.1_3 Forward -72 -53 1.37609 0.164
NP_441111.1_7 Forward -70 -62 18.7023 0.00294
NP_441111.1_7 Reverse -63 -71 18.7023 0.00294
NP_442379.1_10 Forward -78 -61 13.8052 0.0528
NP_441766.1_2 Forward -71 -62 17.5026 0.00297
NP_441766.1_2 Reverse -62 -71 17.5026 0.00297
NP_442417.1_5 Forward -71 -57 15.0442 0.0589
NP_440416.1_9 Reverse -55 -74 -15.0452 0.184
NP_440416.1_9 Forward -268 -249 -21.4367 0.294
NP_443052.1_8 Forward -81 -62 -12.5869 0.259
NP_443052.1_9 Reverse -208 -227 -5.9004 0.274
NP_440261.1_5 Forward -70 -57 -1.06236 0.0655
NP_440261.1_5 Reverse -63 -76 -12.1738 0.272
NP_440988.1_10 Forward -73 -59 6.15739 0.232
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AACTACTCACCGTTAAATCCGATGACATGCAGGGTCGTAACGAAGCCCTCAATGCCATTGTTAAAGGCAAGAGTATTCCCCGGCCCGGTACCCCAGAATCCTTCAAGGTGTTGATGCGGGAACTACAATCCCTTGGTTTGGACATTGCCGCCCACAAAGTACAACTGTCCGAAGATGGTGAAAGCGCCGATGCAGAAGTAGATTTGATGATCGACAGCCAGCGTCGGGCCCCCAATCGTCCCACCTATGAGTCCCTCCACACCGAGGAGGATTTGGAAGAAGAAGAAGTGTAGTCCCAACCATTTTTCCCGTTAGTTTTTCAGGAGGATGGCGATCGCCTAGGGTCTAATCCTCCTGCCCCCTTAATTGCCTTGCCCCCTAATCTCAATCTTGGAGCGTT

CDS

ATGACGTTTTATAACTACACCATCGACAAAGGCCGCCTGAAAAAACTCATTGCCCTTGCCTACCGTCGTTACGGTTCTGCCCGCTGTTCACAGTTGGCTGATGAACTGAAGGAACTGGGGTTTCGTTTTGCCACCAAAGCGGGGGTTTCCATTAGTGTAGATGACCTAACTATTCCTCCAGAGAAAAAGCAAATGCTGGAGGCGGCGGAAAAGGAAATTCGCACCACGGAGGAACGCTATGCTCGGGGGGAAATCACCGAGGTAGAACGGTTCCAAAAGGTAATTGATACCTGGAACGGTACTTCGGAGGAGTTGAAGGATCAGGTGGTGGTTAACTTCCGCAAAACCGATCCTCTCAACTCCGTCTATATGATGGCTTTCTCCGGTGCCCGGGGGAACATGAGCCAGGTGCGGCAATTGGTGGGGATGCGGGGCTTGATGGCGGATCCCCAGGGGGAAATTATCGACTTGCCCATTAAAACCAATTTCCGGGAAGGACTGACGGTTACTGAGTATGTAATTTCTTCCTATGGTGCCCGCAAGGGTCTGGTGGACACGGCTCTGCGGACGGCGGATTCTGGTTACCTCACCCGGCGTTTGGTGGACGTTTCCCAGGACGTAATTGTGCGGGAACAGGATTGTGGCACCGAGCGCAGTCTACGGGTCACCGCCATGACCGATGGGGACCAGGTAAAAATCAGCTTGGCCGATCGCCTGTTTGGTCGTTTGCTGGCTAAGGATGTGGTGGGCCCGGACGGAGAAATTATTGCCAAACGGAACGATGAAATTGACGAAGCCTTGGCAAACCGCATTGCCGCCGTCACCGATGAGGTTTATGTACGATCGCCGTTGACCTGTGAAGCGGCCCGGTCCGTGTGCCAAAACTGCTACGGCTGGAGCTTGGCCCATGGTCACAAAGTTGACCTAGGGGAAGCGGTAGGCATTATCGCCGCCCAATCGATCGGGGAACCCGGCACCCAGTTGACCATGCGGACTTTCCACACTGGGGGGGTATTCACCGGGGAAGTGGCCCGCCAAGAGAAAGCGCCCGAAGACGGCACCGTCAAATGGGGTAAAGGTTTAAGCACCCGTAAAGTCCGTACCCGCCACGGGGAAGATGCGGAGCAGGTGGAAATTGCCGGGGATTTAATCTGGAAAGGGGAAGGCAAAAAAGCTGCCACCCAAACCTACTCCCTCACCCCCGGTTCCCTACTGTTTGTGCAGGATGGACAGACGGTGACAGCGGGGCAGTTGATGACGGAAATTTCCCTCTCCAAAACCCAACGTTCCACGGAGCGGGCCACCAAGGACGTAGCTGGGGATCTGGCCGGAGAAGTGCTGTTCGATCGCCTGGTGCCGGAGGAAAAAACTGACCGTCAGGGGAACACCACCCGCATCGCCCAACGGGGTGGTCTAGTCTGGATCCTTTCCGGGGAAGTATATAACTTACCGCCTGGGGCAGAACCCGTGGTGAAAAATGACGAGCAGGTGGAAGTAGGCAGCATCATGGCCGAAACCAAGCTGGTCACCAACGACGGTGGGGTGGTGCGCCTTGTGAGTAACCGGGAAATTGAAATCATCACCGCCTCTGTGCTGTTAGATCAAGCCCAGGTCAAGCTGGAAAGTAGTGGCGGCCGGGAACAATACGTTATCTACACGGCCGATAAGCAACGCTTCCTGCTCAAAGCCGCTCCCGGTACCAAAGTGCAGAACCACAGCATTGTGGCGGAATTAATCGACGACCGTTACCGTACCACCACCGGGGGCATGATTCGCTATGCCGGCGTGGAAGTGGCTAAGGGCGGCCGCAAACAAGGCTATGAAGTCACTAAAGGGGGTACCCTGCTCTGGATTCCCGAAGAAACCCACGAAATTAACAAAGATATTTCCCTGTTAATTGTGGAAGATGGCCAGTATGTGGAAGCGGGCACGGAAGTGGTCAAGGACATTTTCTGCCAATCCAGCGGCATCGTTGAAGTGGTGCAGAAAAACGATATTCTGCGGGAAATTATTATCAAACCCGGTGACTTCTACCAAGATGTGGACCCCGGTTCGGTGAAAATTGAAAGCGGCCAGTTGCTGCAACCAGGGCAGGATGTTTTCCCCGGTGTTACCGTTAGCACCCTCAGCCAGGCCGAATGGATTGAAAGTCCCGAAGGCAATGGTTTGCTGCTACGCCCCGTGGAAGAGTACAAAGTATTTGATGAGCCCGCCGCCCCCTCCCAGGGTTCCCAAAACGAAGAAGGGGGCCGCCAGATTGAATTGCGCTCAGTGCAACGTCTATTCTATAAAGACGGCGATCGGGTTAAATCCGTCGAAGGGGCCCCCCTGCTCAGCACCCAATTGGTGTTGGAAATTTATGGCAGTGGTAACGAAGGTATTTCCCACCTTTCCGCCGATATTGAACTCCAGGACGACGAAGAGGAAGATTGCCAGCGCTTACAGTTGGTGATTTTAGAATCTTTGGTACTACGCCGGGACCAGGAATCCGATCCCCTCGGCGGAGCCTCCAAAACCCGCTTACTGGTGCAAGATGGCGACCAAATTCCCCCCGGAGCGGTGGTGGCTCGTACCGAAATTCAATGTAAGGAAGCGGGCACTGTGCGGGGTATCAAGGAAGGACAGGAATCCATCCGCCGGGTGTTACTGGAACGGGCAGCAGATCGCCTGGTGGTGGATCTGCCAAGTGCCCCGGAAGTCAAACCAGGACAACTCTTGGTGGCAGGGCAGGAATTGGTGCCCGGGGTCAAACTGGAGGAGTCCGGCAAAGTCCTGGAAATCAACGGCAAAGGGGACAACTATCAGTTAGTGTTACGCCGAGCCCGACCCTATCGGGTTTCCCCTGGGGCAGTGCTCCACATCGAAGACGGCGACCTGGTGCAACGGGGGGATAACCTCGTGCTGCTGGTGTTTGAGCGGGCTAAAACCGGGGATATCGTCCAGGGTTTACCCCGGATTGAAGAACTGTTGGAAGCCCGTAAACCTAAAGAAGCCTGCGTCCTGGCCCGGGCCCCTGGGGTCTGTCAGGTGGAATACCTGGAAGATGAGAGTGTCGACATCAAAGTGGTGGAAGACGACGGCACCGTGAGCGAATATCCCCTGTTACCGGGACAAAACGCCATGGTCACCGACGGACAACGCATTGACGTAGGCCACGCCCTCACCGATGGCTACAACAATCCCCACGAAATTTTGGATGTGTTCTTCAGCTACTACGTGGACAAGGACGGTTGTTACCAAGCGGCCCTGAGAGGACTGCAAGCGGCGCAAAAATTCCTCGTCAATGAAGTGCAAACGGTTTATCAATCCCAAGGGGTGGATATTTCTGACAAACACATTGAGGTAATTGTGCGGCAGATGACCGCCAAAGTCCGCATTGATGATGGGGGAGACACCACCATGCTCCCAGGGGAATTGGTGGAATTACGCCAAGTGGAACAGGTTAATGAAGCCATGGGCATCACTGGTAGTGCTCCGGCCCGCTATACTCCTGTATTGCTTGGTATCACCAAAGCTTCTTTGAATACCGATAGTTTCATCAGTGCGGCTTCCTTCCAAGAAACCACTCGGGTGCTTACCGAAGCGGCAATCGAAGGCAAGTCCGATTGGTTACGGGGCCTGAAGGAGAACGTGATCATTGGTCGTCTTATTCCTGCGGGTACTGGCTTCAGTAGCCATGAGGAAGTGTTGGGATTGATTGAAACCCAGGACGATATTCAAGGCTATATGATTGAGCCAATTGAATTACCAACGACGAAGAAAAAGGCTAGCGCCACCAAGGTGAAAACTAAAAAAGTTGAAGCCGATGACGACCTTTTGGACGACACTAGGGCCCGGGCCTATGCCGGCACTCAACTCAGTCAGGATGACGAAGAGTTTGAAGAAACCTACGACACCGATGAGGATGATTTCGATATGGATGACGATGACGATTTTGGGGATGATGAGGATTAA

Protein

MTFYNYTIDKGRLKKLIALAYRRYGSARCSQLADELKELGFRFATKAGVSISVDDLTIPPEKKQMLEAAEKEIRTTEERYARGEITEVERFQKVIDTWNGTSEELKDQVVVNFRKTDPLNSVYMMAFSGARGNMSQVRQLVGMRGLMADPQGEIIDLPIKTNFREGLTVTEYVISSYGARKGLVDTALRTADSGYLTRRLVDVSQDVIVREQDCGTERSLRVTAMTDGDQVKISLADRLFGRLLAKDVVGPDGEIIAKRNDEIDEALANRIAAVTDEVYVRSPLTCEAARSVCQNCYGWSLAHGHKVDLGEAVGIIAAQSIGEPGTQLTMRTFHTGGVFTGEVARQEKAPEDGTVKWGKGLSTRKVRTRHGEDAEQVEIAGDLIWKGEGKKAATQTYSLTPGSLLFVQDGQTVTAGQLMTEISLSKTQRSTERATKDVAGDLAGEVLFDRLVPEEKTDRQGNTTRIAQRGGLVWILSGEVYNLPPGAEPVVKNDEQVEVGSIMAETKLVTNDGGVVRLVSNREIEIITASVLLDQAQVKLESSGGREQYVIYTADKQRFLLKAAPGTKVQNHSIVAELIDDRYRTTTGGMIRYAGVEVAKGGRKQGYEVTKGGTLLWIPEETHEINKDISLLIVEDGQYVEAGTEVVKDIFCQSSGIVEVVQKNDILREIIIKPGDFYQDVDPGSVKIESGQLLQPGQDVFPGVTVSTLSQAEWIESPEGNGLLLRPVEEYKVFDEPAAPSQGSQNEEGGRQIELRSVQRLFYKDGDRVKSVEGAPLLSTQLVLEIYGSGNEGISHLSADIELQDDEEEDCQRLQLVILESLVLRRDQESDPLGGASKTRLLVQDGDQIPPGAVVARTEIQCKEAGTVRGIKEGQESIRRVLLERAADRLVVDLPSAPEVKPGQLLVAGQELVPGVKLEESGKVLEINGKGDNYQLVLRRARPYRVSPGAVLHIEDGDLVQRGDNLVLLVFERAKTGDIVQGLPRIEELLEARKPKEACVLARAPGVCQVEYLEDESVDIKVVEDDGTVSEYPLLPGQNAMVTDGQRIDVGHALTDGYNNPHEILDVFFSYYVDKDGCYQAALRGLQAAQKFLVNEVQTVYQSQGVDISDKHIEVIVRQMTAKVRIDDGGDTTMLPGELVELRQVEQVNEAMGITGSAPARYTPVLLGITKASLNTDSFISAASFQETTRVLTEAAIEGKSDWLRGLKENVIIGRLIPAGTGFSSHEEVLGLIETQDDIQGYMIEPIELPTTKKKASATKVKTKKVEADDDLLDDTRARAYAGTQLSQDDEEFEETYDTDEDDFDMDDDDDFGDDED