Your browser is old and dusty. Try Google Chrome!

Details for sll1787

ORF sll1787
Accession NP_440685.1
Symbol rpoB
Category RNA synthesis, modification, and DNA transcription
Definition RNA polymerase beta subunit
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -26 -40 10.4227 0.28
NP_441061.1_2 Reverse -174 -188 13.5693 0.0392
NP_440795.1_7 Forward -181 -174 14.6904 0.0123
NP_440795.1_7 Reverse -174 -181 14.6904 0.0123
NP_440795.1_7 Forward -79 -72 8.8889 0.188
NP_440795.1_7 Forward -399 -392 6.92228 0.26
NP_441418.1_6 Forward -182 -163 -11.4069 0.0496
NP_441418.1_6 Forward -80 -61 -13.4719 0.0767
NP_441418.1_6 Reverse -271 -290 -29.7948 0.238
NP_441418.1_6 Forward -302 -283 -30.7781 0.296
NP_441480.1_1 Reverse -299 -318 -0.885524 0.287
NP_441480.1_10 Forward -50 -31 8.25926 0.282
NP_441453.1_4 Reverse -173 -181 16.6374 0.00633
NP_441453.1_4 Forward -182 -174 16.539 0.00633
NP_441453.1_4 Reverse -271 -279 6.80426 0.121
NP_441453.1_4 Forward -280 -272 6.11594 0.121
NP_441453.1_4 Reverse -71 -79 4.64098 0.257
NP_441623.1_1 Forward -172 -154 4.14905 0.184
NP_441623.1_1 Reverse -64 -82 -2.53746 0.241
NP_441960.1_3 Forward -280 -261 12.8414 0.291
NP_442151.1_6 Reverse -173 -187 8.55439 0.171
NP_442151.1_6 Forward -166 -152 5.40779 0.278
NP_442151.1_6 Reverse -71 -85 5.40779 0.278
NP_441818.1_9 Reverse -30 -49 -2.26216 0.203
NP_441818.1_9 Forward -242 -223 -8.16202 0.274
NP_440226.1_1 Forward -182 -163 10.3242 0.0635
NP_440226.1_1 Forward -280 -261 3.93269 0.209
NP_441630.1_3 Reverse -263 -282 10.1275 0.0923
NP_440150.1_2 Reverse -153 -172 13.5683 0.165
NP_440150.1_6 Forward -185 -166 6.98095 0.223
NP_441816.1_8 Reverse -43 -57 20.0591 0.118
NP_442744.1_8 Reverse -157 -176 -4.22878 0.297
NP_442655.1_2 Reverse -20 -39 6.58763 0.175
NP_442173.1_1 Forward -181 -173 17.3257 0.00633
NP_442173.1_1 Reverse -174 -182 15.4574 0.00633
NP_442173.1_1 Forward -279 -271 12.0158 0.0316
NP_442173.1_1 Reverse -272 -280 4.83764 0.241
NP_442752.1_4 Reverse -271 -278 13.8055 0.0199
NP_442752.1_4 Forward -182 -175 13.8055 0.0199
NP_442752.1_4 Forward -80 -73 5.25066 0.256
NP_443027.1_4 Reverse -171 -181 15.418 0.0437
NP_443027.1_4 Forward -184 -174 15.3197 0.0437
NP_442975.1_10 Reverse -169 -183 11.307 0.0508
NP_440784.1_7 Forward -181 -174 15.9687 0.0123
NP_440784.1_7 Reverse -174 -181 15.9687 0.0123
NP_440784.1_7 Reverse -272 -279 6.23397 0.241
NP_440784.1_7 Forward -279 -272 6.13563 0.241
NP_440061.1_9 Reverse -161 -175 5.89884 0.266
NP_440110.1_4 Forward -270 -251 3.14605 0.233
NP_440110.1_8 Forward -97 -78 -2.55715 0.274
NP_441054.1_1 Forward -189 -175 17.8958 0.129
NP_441476.1_5 Forward -187 -168 -0.590531 0.2
NP_441476.1_5 Reverse -168 -187 -2.65548 0.231
NP_440878.1_9 Forward -90 -71 2.75272 0.174
NP_440878.1_9 Forward -250 -231 -3.63879 0.299
NP_442062.1_8 Forward -182 -172 19.1546 0.00121
NP_442062.1_8 Reverse -173 -183 7.84651 0.0871
NP_442062.1_8 Forward -80 -70 4.60159 0.206
NP_441859.1_3 Reverse -172 -191 3.04693 0.25
NP_441802.1_1 Reverse -235 -254 13.4708 0.175
NP_440304.1_4 Forward -184 -174 18.9579 0.00406
NP_440304.1_4 Reverse -229 -239 11.0914 0.051
NP_440304.1_4 Reverse -291 -301 3.02829 0.299
NP_442242.1_4 Forward -181 -174 14.3954 0.0124
NP_442242.1_4 Reverse -174 -181 14.3954 0.0124
NP_440044.1_8 Forward -181 -162 -2.26216 0.261
NP_441035.1_3 Forward -83 -64 1.47442 0.234
NP_439918.1_2 Reverse -139 -158 0.491109 0.225
NP_439918.1_2 Reverse -31 -50 -4.03212 0.265
NP_441935.1_1 Forward -181 -162 10.2259 0.211
NP_441208.1_9 Forward -185 -171 6.98109 0.229
NP_441208.1_9 Forward -208 -194 5.50613 0.267
NP_441594.1_6 Forward -191 -172 14.3558 0.109
NP_440370.1_10 Reverse -164 -183 7.07928 0.268
NP_440132.1_1 Forward -82 -64 10.0489 0.223
NP_442110.1_7 Reverse -173 -187 21.1407 0.013
NP_441082.1_10 Reverse -31 -44 10.7374 0.236
NP_441925.1_4 Forward -55 -36 -8.26108 0.207
NP_441925.1_4 Forward -45 -26 -13.2759 0.257
NP_441925.1_4 Forward -54 -35 -14.8492 0.263
NP_441925.1_4 Forward -46 -27 -17.2092 0.29
NP_440856.1_1 Forward -192 -173 4.12936 0.157
NP_440856.1_4 Forward -189 -170 -1.67217 0.202
NP_441083.1_3 Forward -103 -93 12.0743 0.287
NP_441083.1_5 Forward -280 -270 8.73149 0.0307
NP_441083.1_5 Reverse -71 -81 7.35486 0.0566
NP_441083.1_5 Reverse -173 -183 2.04498 0.195
NP_441083.1_5 Forward -182 -172 1.55333 0.204
NP_441083.1_5 Forward -80 -70 -0.0199663 0.251
NP_441083.1_5 Reverse -271 -281 -0.904945 0.283
NP_442827.1_8 Reverse -165 -184 1.57197 0.176
NP_441738.1_2 Forward -278 -271 15.28 0.0102
NP_441738.1_2 Reverse -175 -182 15.28 0.0102
NP_441738.1_2 Forward -180 -173 11.5435 0.084
NP_441558.1_5 Reverse -269 -288 4.71934 0.271
NP_440209.1_1 Forward -182 -174 18.1123 0.00295
NP_440209.1_1 Reverse -271 -279 8.57422 0.0425
NP_440209.1_1 Reverse -173 -181 8.57422 0.0425
NP_440209.1_1 Forward -280 -272 5.52596 0.0821
NP_442889.1_1 Reverse -151 -170 -14.3569 0.273
NP_440447.1_1 Forward -187 -169 3.75572 0.246
NP_441713.1_1 Forward -188 -169 1.76941 0.0651
NP_441713.1_1 Forward -86 -67 -14.7502 0.259
NP_442675.1_1 Reverse -19 -38 8.35759 0.192
NP_440178.1_7 Forward -281 -262 -14.7502 0.156
NP_442706.1_5 Forward -27 -8 12.7671 0.263
NP_442570.1_3 Reverse -34 -53 -2.26216 0.212
NP_441792.1_5 Forward -40 -24 9.98996 0.234
NP_440538.1_10 Reverse -177 -196 11.5042 0.253
NP_441716.1_1 Reverse -71 -85 5.89945 0.211
NP_441716.1_1 Forward -242 -228 4.12949 0.258
NP_443013.1_8 Forward -193 -175 15.3588 0.172
NP_442111.1_4 Reverse -172 -186 11.7993 0.048
NP_442111.1_4 Reverse -70 -84 6.98109 0.108
NP_442111.1_4 Forward -183 -169 5.30946 0.169
NP_441163.1_1 Forward -288 -271 7.01961 0.251
NP_440906.1_5 Forward -181 -174 15.8704 0.0124
NP_440906.1_5 Reverse -174 -181 15.8704 0.0124
NP_440906.1_5 Reverse -272 -279 6.23397 0.234
NP_440906.1_5 Forward -279 -272 6.13563 0.241
NP_440747.1_10 Forward -185 -173 -2.02597 0.0196
NP_440747.1_10 Forward -283 -271 -2.61596 0.0556
NP_440747.1_10 Reverse -170 -182 -11.7607 0.142
NP_440747.1_10 Reverse -268 -280 -12.0557 0.199
NP_441130.1_10 Forward -282 -268 14.7492 0.0417
NP_441854.1_10 Reverse -171 -190 0.58944 0.282
NP_441486.1_1 Reverse -170 -184 -4.81863 0.209
NP_442634.1_4 Forward -184 -170 4.91614 0.0699
NP_442634.1_4 Reverse -171 -185 4.62115 0.0764
NP_440403.1_4 Reverse -272 -291 -2.0655 0.175
NP_440403.1_4 Reverse -164 -183 -9.34199 0.274
NP_440403.1_10 Forward -191 -172 0.982764 0.293
NP_440842.1_10 Forward -243 -229 4.71948 0.254
NP_442848.1_1 Reverse -167 -181 3.63784 0.128
NP_442848.1_1 Forward -188 -174 -2.75368 0.263
NP_443018.1_3 Forward -181 -174 14.8871 0.0123
NP_443018.1_3 Reverse -174 -181 14.8871 0.0123
NP_443018.1_3 Forward -279 -272 11.7405 0.0655
NP_443018.1_3 Reverse -272 -279 5.44732 0.193
NP_441316.1_7 Reverse -171 -186 5.78142 0.118
NP_441634.1_8 Forward -184 -170 -1.77037 0.295
NP_440376.1_1 Reverse -173 -182 9.73449 0.0365
NP_440376.1_1 Forward -182 -173 9.63616 0.0385
NP_440376.1_1 Reverse -71 -80 7.76787 0.0688
NP_440376.1_1 Forward -80 -71 7.07956 0.0869
NP_440376.1_1 Reverse -271 -280 5.99792 0.111
NP_440376.1_1 Forward -280 -271 -0.196935 0.285
NP_440376.1_1 Reverse -36 -45 -0.295266 0.286
NP_441588.1_4 Forward -278 -268 6.76487 0.185
NP_442687.1_7 Forward -183 -173 8.04317 0.116
NP_442687.1_7 Reverse -172 -182 6.27322 0.175
NP_442687.1_7 Forward -224 -214 6.07655 0.179
NP_442687.1_7 Reverse -249 -259 5.68323 0.189
NP_442687.1_7 Reverse -70 -80 5.68323 0.189
NP_442191.1_4 Reverse -43 -57 10.6053 0.294
NP_442485.1_3 Reverse -282 -301 -3.14714 0.272
NP_442485.1_3 Forward -245 -226 -3.54046 0.276
NP_441846.1_10 Reverse -42 -61 -20.2567 0.256
NP_441846.1_10 Reverse -53 -72 -21.0434 0.256
NP_441846.1_10 Reverse -44 -63 -22.42 0.259
NP_441846.1_10 Reverse -145 -164 -22.8133 0.266
NP_441846.1_10 Reverse -156 -175 -23.01 0.275
NP_441846.1_10 Reverse -19 -38 -23.6983 0.295
NP_441422.1_7 Reverse -171 -188 16.1651 0.0565
NP_442483.1_6 Forward -132 -113 17.2065 0.139
NP_442658.1_1 Reverse -171 -181 17.8758 0.00565
NP_442658.1_1 Forward -184 -174 15.9091 0.00966
NP_442658.1_1 Reverse -229 -239 12.9592 0.0423
NP_442658.1_1 Reverse -291 -301 10.1076 0.132
NP_442658.1_1 Reverse -195 -205 7.0594 0.214
NP_442658.1_1 Forward -282 -272 5.28945 0.274
NP_442198.1_7 Reverse -170 -189 8.25844 0.298
NP_440141.1_4 Reverse -45 -64 -8.94866 0.298
NP_442205.1_9 Forward -188 -172 1.33684 0.253
NP_442205.1_9 Reverse -167 -183 -3.57971 0.287
NP_441414.1_9 Forward -280 -261 -8.94866 0.249
NP_442321.1_1 Reverse -155 -174 -1.18052 0.176
NP_442321.1_1 Forward -304 -285 -1.67217 0.194
NP_441958.1_5 Forward -183 -173 19.9412 0.00158
NP_441958.1_5 Reverse -270 -280 9.81313 0.0174
NP_441958.1_5 Reverse -172 -182 2.53664 0.0409
NP_441958.1_5 Reverse -70 -80 0.963343 0.12
NP_441958.1_5 Forward -81 -71 0.963343 0.12
NP_441958.1_5 Reverse -249 -259 -2.47824 0.273
NP_441127.1_1 Reverse -231 -245 18.8791 0.0445
NP_441127.1_1 Forward -188 -174 7.76774 0.3
NP_440950.1_1 Forward -241 -222 3.44104 0.185
NP_440203.1_5 Reverse -176 -186 12.7626 0.138
NP_439905.1_1 Forward -239 -226 7.19745 0.264
NP_440984.1_7 Reverse -266 -280 5.70279 0.245
NP_439990.1_5 Forward -187 -174 9.95071 0.128
NP_442376.1_2 Reverse -168 -187 -4.42544 0.253
NP_442376.1_2 Reverse -66 -85 -6.1954 0.286
NP_442376.1_2 Forward -81 -62 -6.78538 0.286
NP_442911.1_2 Forward -192 -173 -4.91709 0.145
NP_442911.1_2 Reverse -163 -182 -5.21209 0.153
NP_442911.1_2 Forward -90 -71 -5.60541 0.163
NP_442911.1_2 Forward -290 -271 -8.85033 0.244
NP_440153.1_5 Reverse -174 -188 4.22782 0.199
NP_440153.1_5 Forward -181 -167 0.88457 0.288
NP_441591.1_10 Forward -184 -165 9.43923 0.204
NP_440369.1_5 Reverse -19 -38 8.75091 0.281
NP_443055.1_3 Forward -157 -138 11.0271 0.27
NP_443055.1_6 Forward -316 -298 -0.473239 0.261
NP_440993.1_2 Reverse -168 -184 12.9399 0.0665
NP_440993.1_2 Forward -187 -171 6.15506 0.232
NP_440827.1_3 Reverse -168 -187 11.2092 0.274
NP_442995.1_5 Forward -187 -168 11.4058 0.211
NP_441099.1_5 Forward -90 -71 1.67108 0.0619
NP_441099.1_5 Forward -192 -173 -9.83364 0.234
NP_441099.1_5 Forward -55 -36 -11.3086 0.276
NP_441294.1_7 Reverse -169 -183 12.2263 0.107
NP_441294.1_7 Reverse -67 -81 11.2664 0.15
NP_441646.1_1 Reverse -166 -185 2.16274 0.221
NP_442438.1_10 Reverse -168 -182 13.5693 0.0347
NP_442438.1_10 Forward -187 -173 2.16287 0.185
NP_440879.1_6 Reverse -168 -187 -2.95047 0.279
NP_441000.1_6 Forward -281 -267 12.586 0.0408
NP_441000.1_6 Forward -183 -169 4.42448 0.0953
NP_440605.1_4 Forward -192 -173 13.9592 0.243
NP_442771.1_1 Forward -184 -166 -4.79907 0.166
NP_442771.1_1 Forward -82 -64 -4.99573 0.166
NP_442771.1_1 Reverse -171 -189 -6.66736 0.168
NP_440484.1_1 Forward -156 -137 14.7483 0.191
NP_440147.1_4 Reverse -171 -184 10.1474 0.0355
NP_440147.1_4 Forward -184 -171 9.75405 0.0371
NP_440147.1_4 Reverse -269 -282 5.52582 0.122
NP_440147.1_4 Forward -82 -69 2.37923 0.208
NP_441550.1_8 Forward -184 -174 17.4824 0.00754
NP_441550.1_8 Reverse -269 -279 14.5325 0.0141
NP_441550.1_8 Reverse -171 -181 5.68278 0.236
NP_441916.1_7 Reverse -173 -183 19.6462 0.00144
NP_441916.1_7 Forward -182 -172 16.4013 0.00539
NP_441916.1_7 Reverse -71 -81 4.0116 0.193
NP_441916.1_7 Forward -280 -270 1.06167 0.294
NP_441916.1_10 Reverse -155 -174 2.75272 0.241
NP_440465.1_10 Reverse -170 -189 4.42435 0.228
NP_441041.1_4 Forward -280 -261 -10.9153 0.238
NP_441041.1_4 Forward -194 -175 -12.0953 0.258
NP_441041.1_4 Reverse -42 -61 -13.1769 0.282
NP_441041.1_7 Reverse -268 -280 12.0821 0.0689
NP_441041.1_7 Forward -185 -173 11.6934 0.0733
NP_441041.1_7 Reverse -170 -182 9.36115 0.114
NP_441041.1_7 Reverse -247 -259 7.22324 0.171
NP_440099.1_1 Forward -255 -236 9.43841 0.234
NP_442642.1_4 Forward -382 -363 13.3725 0.166
NP_442004.1_6 Reverse -173 -187 15.9292 0.0577
NP_441725.1_4 Forward -187 -173 4.62054 0.278
NP_441725.1_5 Reverse -174 -184 8.92815 0.0553
NP_441725.1_5 Forward -239 -229 5.19158 0.115
NP_441725.1_5 Forward -181 -171 -0.0199663 0.223
NP_441725.1_5 Reverse -72 -82 -0.314959 0.246
NP_441725.1_5 Forward -79 -69 -0.609952 0.265
NP_439966.1_7 Forward -282 -272 17.6791 0.00636
NP_439966.1_7 Forward -184 -174 13.8442 0.0234
NP_439966.1_7 Reverse -171 -181 9.22267 0.119
NP_439966.1_7 Reverse -269 -279 4.60114 0.265
NP_439966.1_9 Reverse -171 -180 10.7178 0.0863
NP_439966.1_9 Forward -184 -175 0.983037 0.253
NP_440736.1_3 Forward -184 -165 9.14423 0.145
NP_442941.1_3 Reverse -174 -184 10.9931 0.0116
NP_442941.1_3 Forward -279 -269 9.41981 0.0319
NP_442941.1_3 Forward -181 -171 -0.0199663 0.244
NP_440289.1_2 Reverse -68 -81 1.69091 0.118
NP_440289.1_2 Reverse -268 -281 -4.9956 0.294
NP_440289.1_2 Forward -83 -70 -5.09393 0.297
NP_440260.1_8 Reverse -154 -172 -4.40575 0.272
NP_442281.1_1 Forward -187 -173 9.83206 0.0661
NP_442281.1_1 Forward -171 -157 5.70218 0.15
NP_442281.1_1 Reverse -168 -182 2.45727 0.266
NP_442281.1_1 Reverse -288 -302 1.96562 0.282
NP_441334.1_7 Reverse -171 -190 6.78429 0.0214
NP_441334.1_7 Forward -184 -165 -3.04881 0.0842
NP_442256.1_2 Forward -282 -264 1.39578 0.107
NP_440647.1_9 Forward -282 -264 10.6389 0.175
NP_442012.1_1 Reverse -65 -84 18.4857 0.0354
NP_442012.1_1 Forward -188 -169 5.80098 0.143
NP_442012.1_1 Reverse -167 -186 1.96607 0.208
NP_441457.1_7 Reverse -171 -190 -1.08219 0.293
NP_441556.1_4 Reverse -59 -78 10.1979 0.286
NP_441556.1_7 Forward -149 -130 4.52188 0.247
NP_440498.1_4 Reverse -350 -369 14.9458 0.104
NP_440375.1_8 Forward -279 -260 4.71934 0.193
NP_441644.1_6 Reverse -173 -183 16.6958 0.00284
NP_441644.1_6 Forward -280 -270 16.1058 0.0048
NP_441644.1_6 Forward -259 -249 4.7978 0.224
NP_443049.1_6 Reverse -270 -280 12.3241 0.24
NP_440867.1_10 Reverse -222 -241 6.68596 0.252
NP_442215.1_2 Forward -181 -165 -4.1697 0.228
NP_442215.1_2 Reverse -155 -171 -4.1697 0.228
NP_442177.1_5 Reverse -33 -47 11.5043 0.22
NP_442029.1_6 Reverse -287 -306 9.43923 0.188
NP_442029.1_6 Reverse -37 -56 2.94938 0.286
NP_442247.1_8 Forward -184 -170 12.291 0.247
NP_440929.1_8 Reverse -173 -182 9.93116 0.0249
NP_440929.1_8 Forward -182 -173 9.83282 0.0254
NP_440929.1_8 Forward -280 -271 7.07956 0.0713
NP_442933.1_10 Forward -182 -173 17.601 0.00325
NP_442933.1_10 Reverse -173 -182 17.601 0.00325
NP_441310.1_10 Forward -228 -218 16.6663 0.0807
NP_441751.2_8 Reverse -174 -188 14.9459 0.0119
NP_442926.1_3 Forward -193 -174 16.4207 0.083
NP_442926.1_5 Reverse -203 -222 9.20238 0.282
NP_442554.1_8 Reverse -174 -184 19.1546 0.00369
NP_442554.1_8 Forward -279 -269 7.45319 0.092
NP_442554.1_8 Forward -181 -171 6.37155 0.12
NP_442554.1_8 Forward -165 -155 4.99491 0.163
NP_442554.1_8 Reverse -272 -282 2.24165 0.276
NP_441762.1_7 Reverse -172 -184 13.5103 0.0142
NP_441762.1_7 Forward -183 -171 5.05386 0.0443
NP_441762.1_7 Reverse -270 -282 -4.58258 0.179
NP_442142.1_4 Forward -185 -172 13.8833 0.0324
NP_442142.1_4 Forward -283 -270 9.85179 0.0854
NP_442292.1_1 Reverse -174 -183 17.5026 0.00435
NP_442292.1_1 Forward -279 -270 7.66954 0.0634
NP_442292.1_1 Forward -181 -172 0.688044 0.23
NP_442476.1_6 Forward -181 -167 11.406 0.056
NP_442476.1_6 Forward -310 -296 9.43936 0.086
NP_442381.1_1 Forward -247 -228 21.6002 0.0368
NP_442381.1_8 Reverse -268 -287 -14.2585 0.28
NP_441711.1_4 Reverse -262 -281 4.22769 0.219
NP_441523.1_6 Forward -294 -275 4.42435 0.252
NP_443009.1_5 Forward -183 -172 18.5443 0.00265
NP_443009.1_5 Forward -81 -70 7.23633 0.135
NP_443009.1_5 Reverse -70 -81 7.03967 0.141
NP_443009.1_5 Reverse -172 -183 3.79477 0.278
NP_442301.1_2 Reverse -172 -191 7.66846 0.245
NP_441715.1_4 Forward -181 -171 8.04317 0.107
NP_441715.1_4 Reverse -174 -184 7.25653 0.108
NP_441715.1_4 Forward -279 -269 6.96153 0.121
NP_441715.1_4 Reverse -57 -67 4.10993 0.299
NP_440357.1_3 Forward -82 -63 8.45592 0.206
NP_440357.1_3 Forward -242 -223 -0.0988766 0.287
NP_440881.1_10 Forward -181 -168 12.5073 0.249
NP_440730.1_4 Forward -80 -61 -4.32711 0.298
NP_440183.1_9 Reverse -159 -178 -17.5035 0.276
NP_441198.1_8 Forward -184 -174 15.4199 0.0427
NP_441198.1_8 Forward -82 -72 13.662 0.108
NP_441198.1_8 Reverse -69 -79 11.9041 0.174
NP_440379.1_5 Forward -191 -172 0.392778 0.172
NP_440379.1_5 Reverse -170 -189 -11.2103 0.291
NP_441468.1_1 Forward -181 -174 15.8704 0.0124
NP_441468.1_1 Reverse -174 -181 15.8704 0.0124
NP_441468.1_1 Reverse -272 -279 6.13563 0.209
NP_441468.1_1 Forward -279 -272 6.0373 0.223
NP_441020.2_6 Reverse -171 -188 10.9536 0.131
NP_441020.2_6 Forward -184 -167 10.0686 0.154
NP_441015.1_10 Forward -187 -168 9.0459 0.078
NP_441015.1_10 Reverse -152 -171 2.26107 0.151
NP_441015.1_10 Reverse -27 -46 -2.0655 0.178
NP_441015.1_10 Reverse -57 -76 -10.3253 0.284
NP_441015.1_10 Reverse -30 -49 -10.4236 0.284
NP_441673.1_1 Reverse -173 -182 11.1111 0.0121
NP_441673.1_1 Forward -182 -173 11.0128 0.018
NP_441673.1_1 Reverse -271 -280 1.37636 0.114
NP_441673.1_1 Forward -80 -71 1.27803 0.155
NP_441673.1_1 Reverse -71 -80 1.27803 0.155
NP_441673.1_1 Forward -280 -271 1.1797 0.163
NP_441016.2_6 Forward -44 -25 8.75009 0.222
NP_441826.1_2 Forward -188 -174 6.98109 0.0899
NP_441826.1_2 Reverse -167 -181 -1.67204 0.252
NP_441330.1_1 Reverse -266 -285 -4.13045 0.0894
NP_442490.1_9 Forward -194 -175 -7.76869 0.278
NP_442868.1_6 Forward -184 -174 8.63316 0.0555
NP_442868.1_6 Reverse -69 -79 4.10993 0.186
NP_442868.1_6 Reverse -269 -279 0.668351 0.213
NP_442868.1_6 Forward -282 -272 0.176696 0.247
NP_442868.1_6 Reverse -171 -181 -0.314959 0.284
NP_441056.1_1 Reverse -173 -192 -4.22878 0.249
NP_442227.1_4 Forward -309 -290 15.5349 0.152
NP_442808.1_1 Forward -281 -271 19.449 0.00201
NP_442808.1_1 Reverse -172 -182 9.91099 0.0481
NP_442808.1_1 Reverse -70 -80 4.60114 0.195
NP_442808.1_1 Forward -155 -145 2.63453 0.26
NP_441101.1_10 Forward -186 -167 -3.73712 0.262
NP_441101.1_10 Forward -84 -65 -6.29373 0.289
NP_441101.1_10 Forward -171 -152 -7.57203 0.29
NP_440145.1_3 Forward -192 -173 2.75272 0.114
NP_440145.1_3 Reverse -153 -172 -3.04881 0.185
NP_442820.1_10 Forward -188 -170 14.0805 0.152
NP_442542.1_2 Reverse -248 -261 5.03416 0.288
NP_442542.1_9 Reverse -264 -278 11.7003 0.111
NP_442113.1_5 Reverse -171 -190 16.9115 0.101
NP_442050.1_1 Forward -224 -205 9.43923 0.247
NP_442050.1_5 Forward -184 -174 17.1874 0.00812
NP_442050.1_5 Reverse -171 -181 7.35439 0.26
NP_442342.1_9 Reverse -171 -187 9.49831 0.161
NP_442342.1_9 Reverse -69 -85 8.41667 0.194
NP_441114.1_3 Forward -300 -291 8.65285 0.231
NP_441114.1_3 Forward -147 -138 7.86621 0.231
NP_440558.1_2 Forward -191 -172 5.99764 0.137
NP_440558.1_2 Reverse -170 -189 -3.44213 0.236
NP_440558.1_2 Forward -152 -133 -4.22878 0.243
NP_440558.1_2 Reverse -154 -173 -4.81876 0.249
NP_440558.1_2 Forward -243 -224 -7.27704 0.291
NP_442789.1_4 Reverse -171 -190 -6.88371 0.289
NP_441878.1_6 Reverse -70 -80 2.24165 0.0462
NP_441878.1_6 Reverse -230 -240 1.65166 0.0795
NP_441878.1_6 Reverse -292 -302 1.55333 0.0937
NP_441878.1_6 Forward -81 -71 1.25834 0.108
NP_441878.1_6 Reverse -156 -166 0.766681 0.134
NP_441878.1_6 Forward -183 -173 0.668351 0.139
NP_441878.1_6 Reverse -172 -182 0.668351 0.139
NP_441878.1_6 Forward -167 -157 0.57002 0.14
NP_441036.1_8 Reverse -172 -182 17.4829 0.0012
NP_441036.1_8 Forward -183 -173 11.7798 0.106
NP_441036.1_8 Reverse -66 -76 6.76487 0.215
NP_441036.1_8 Forward -281 -271 6.07655 0.242
NP_441557.1_5 Forward -182 -173 18.6826 0.0015
NP_441557.1_5 Reverse -173 -182 10.5211 0.00695
NP_441557.1_5 Reverse -271 -280 1.08137 0.0794
NP_441557.1_5 Forward -280 -271 0.589713 0.134
NP_441557.1_5 Forward -80 -71 0.393051 0.166
NP_441557.1_5 Reverse -71 -80 0.393051 0.166
NP_441557.1_8 Forward -60 -50 13.1559 0.225
NP_441590.1_4 Reverse -350 -369 8.35677 0.249
NP_441590.1_4 Forward -55 -36 1.6703 0.299
NP_442066.2_4 Reverse -173 -192 -7.4737 0.28
NP_442066.2_9 Forward -22 -9 13.589 0.154
NP_442777.1_1 Forward -39 -20 5.01354 0.295
NP_441739.1_2 Forward -28 -12 4.77774 0.237
NP_441308.1_8 Forward -184 -174 12.4681 0.218
NP_440101.1_3 Reverse -168 -187 6.98095 0.18
NP_440101.1_10 Forward -188 -169 8.06259 0.193
NP_440101.1_10 Reverse -167 -186 3.14605 0.244
NP_441564.1_3 Reverse -146 -165 16.0274 0.112
NP_442183.1_1 Reverse -173 -187 13.8643 0.0389
NP_442183.1_1 Forward -80 -66 3.73617 0.299
NP_441574.1_1 Reverse -173 -192 -4.22878 0.252
NP_441574.1_1 Reverse -26 -45 -7.67036 0.293
NP_441549.1_9 Reverse -169 -187 -7.35568 0.207
NP_441549.1_9 Forward -176 -158 -9.0273 0.241
NP_442347.1_2 Reverse -174 -183 3.34298 0.284
NP_442347.1_10 Forward -147 -133 17.4035 0.143
NP_442645.1_2 Forward -190 -171 -15.4385 0.2
NP_441037.1_4 Forward -184 -174 16.5761 0.0168
NP_441037.1_4 Reverse -69 -79 7.41515 0.237
NP_441037.1_4 Reverse -171 -181 7.22024 0.237
NP_442594.1_8 Reverse -52 -71 5.30933 0.247
NP_442594.1_8 Reverse -51 -70 3.93269 0.274
NP_441633.1_3 Reverse -171 -184 -1.45568 0.158
NP_441633.1_3 Forward -184 -171 -5.88057 0.236
NP_441633.1_3 Reverse -212 -225 -6.66722 0.265
NP_440136.1_2 Forward -181 -174 15.9687 0.0123
NP_440136.1_2 Reverse -174 -181 15.9687 0.0123
NP_440136.1_2 Reverse -272 -279 6.23397 0.171
NP_440136.1_2 Forward -279 -272 6.13563 0.193
NP_442998.1_10 Forward -278 -271 15.5754 0.0102
NP_442998.1_10 Reverse -175 -182 15.5754 0.0102
NP_442998.1_10 Forward -180 -173 5.74231 0.255
NP_442998.1_10 Forward -78 -71 3.97235 0.297
NP_440299.1_1 Forward -186 -173 12.8017 0.0348
NP_440299.1_1 Reverse -169 -182 10.1468 0.0597
NP_441799.1_1 Reverse -169 -183 14.1586 0.0264
NP_441799.1_1 Forward -186 -172 8.55376 0.112
NP_441799.1_1 Reverse -267 -281 3.53891 0.295
NP_441007.1_10 Forward -187 -174 13.0973 0.0499
NP_441007.1_10 Reverse -226 -239 1.00259 0.209
NP_442299.1_1 Reverse -68 -87 20.4523 0.263
NP_440256.1_1 Forward -185 -166 -0.787193 0.0961
NP_441957.1_1 Forward -190 -171 7.47261 0.206
NP_440087.1_1 Reverse -43 -62 -8.35868 0.278
NP_441512.1_4 Reverse -169 -188 8.16093 0.264
NP_441559.1_8 Forward -56 -42 6.88276 0.0752
NP_441559.1_8 Forward -285 -271 2.06454 0.148
NP_441559.1_8 Forward -306 -292 -5.60527 0.267
NP_441559.1_8 Forward -295 -281 -6.19526 0.275
NP_440915.1_6 Reverse -169 -183 11.8976 0.0236
NP_440915.1_6 Forward -84 -70 10.1277 0.0346
NP_440915.1_6 Forward -186 -172 3.93283 0.1
NP_440915.1_6 Forward -284 -270 2.2612 0.121
NP_440915.1_6 Reverse -67 -81 0.687908 0.155
NP_440915.1_6 Reverse -267 -281 0.196253 0.173
NP_442785.1_8 Reverse -215 -233 19.6853 0.269
NP_442967.1_9 Reverse -187 -201 13.0776 0.282
NP_442866.1_1 Reverse -168 -187 6.19431 0.122
NP_441464.1_8 Reverse -71 -85 5.89945 0.248
NP_440026.1_4 Reverse -27 -46 10.1275 0.239
NP_441939.1_3 Reverse -174 -193 5.40766 0.276
NP_441199.1_6 Reverse -169 -188 7.07928 0.12
NP_441199.1_6 Forward -58 -39 0.0977854 0.254
NP_441494.1_6 Forward -187 -174 18.6038 0.059
NP_439985.1_7 Reverse -151 -170 6.88262 0.192
NP_442993.1_1 Reverse -271 -287 -6.92296 0.146
NP_442993.1_1 Reverse -250 -266 -9.97122 0.201
NP_442386.1_9 Reverse -172 -181 16.7155 0.0144
NP_442386.1_9 Forward -281 -272 13.8639 0.0289
NP_442386.1_9 Reverse -41 -50 9.14408 0.172
NP_442386.1_9 Forward -183 -174 6.39082 0.219
NP_440570.1_5 Forward -198 -179 4.12936 0.231
NP_440570.1_5 Forward -90 -71 -0.688862 0.263
NP_441750.1_1 Reverse -48 -67 -12.6852 0.3
NP_441750.1_4 Forward -284 -265 9.3409 0.159
NP_441750.1_7 Reverse -29 -39 18.0729 0.254
NP_441340.1_5 Forward -181 -174 15.6737 0.0124
NP_441340.1_5 Reverse -174 -181 15.6737 0.0124
NP_441340.1_5 Reverse -272 -279 13.5105 0.0314
NP_441340.1_5 Forward -279 -272 5.84064 0.208
NP_440186.1_8 Reverse -226 -245 3.44104 0.264
NP_442791.1_5 Forward -69 -50 -8.06369 0.279
NP_440168.1_8 Reverse -167 -186 7.17762 0.187
NP_440168.1_9 Reverse -291 -310 -0.983855 0.273
NP_440059.1_3 Forward -250 -231 7.86512 0.238
NP_441132.1_3 Reverse -378 -397 8.06259 0.21
NP_442240.1_2 Reverse -174 -193 -13.1769 0.166
NP_442714.1_7 Forward -148 -129 1.37609 0.226
NP_440586.1_8 Forward -181 -174 13.2151 0.026
NP_440586.1_8 Reverse -174 -181 13.2151 0.026
NP_440586.1_8 Forward -279 -272 9.47853 0.146
NP_440586.1_8 Reverse -272 -279 5.74197 0.283
NP_442251.1_6 Forward -181 -174 15.2804 0.0124
NP_442251.1_6 Reverse -174 -181 15.2804 0.0124
NP_440192.1_5 Reverse -25 -44 4.52268 0.25
NP_441262.1_3 Reverse -271 -278 14.7888 0.0223
NP_441262.1_3 Forward -182 -175 14.7888 0.0223
NP_441262.1_3 Reverse -173 -180 13.9038 0.0336
NP_440027.1_3 Reverse -163 -181 10.5398 0.173
NP_440027.1_3 Forward -45 -27 7.88485 0.202
NP_440027.1_8 Forward -283 -264 6.48849 0.27
NP_443051.1_1 Forward -183 -174 19.5676 0.00335
NP_443051.1_1 Reverse -270 -279 16.6177 0.00754
NP_443051.1_1 Reverse -172 -181 1.08137 0.123
NP_441232.1_10 Reverse -162 -181 1.27776 0.284
NP_439937.1_8 Reverse -171 -190 -5.50708 0.297
NP_439937.1_9 Forward -167 -150 -0.256846 0.115
NP_439937.1_9 Reverse -229 -246 -2.22346 0.145
NP_439937.1_9 Forward -81 -64 -6.45167 0.157
NP_439937.1_9 Reverse -70 -87 -16.1864 0.287
NP_439937.1_9 Forward -183 -166 -16.2847 0.287
NP_441595.1_5 Forward -87 -69 4.83737 0.274
NP_440408.1_7 Reverse -157 -176 15.3391 0.165
NP_440439.1_1 Forward -185 -172 18.2105 0.0105
NP_440439.1_1 Reverse -170 -183 9.06573 0.0475
NP_440439.1_1 Reverse -49 -62 8.37742 0.0537
NP_440439.1_1 Forward -283 -270 5.03416 0.0943
NP_440439.1_1 Reverse -166 -179 4.05085 0.107
NP_440439.1_1 Reverse -268 -281 0.510939 0.188
NP_439943.1_4 Reverse -286 -305 8.84924 0.256
NP_440372.1_2 Forward -181 -174 16.3621 0.0124
NP_440372.1_2 Reverse -174 -181 16.3621 0.0124
NP_440372.1_2 Reverse -272 -279 13.8055 0.0214
NP_440372.1_2 Forward -279 -272 6.52896 0.188
NP_441789.1_7 Reverse -262 -281 -5.40949 0.298
NP_440316.1_10 Reverse -230 -240 17.2863 0.153
NP_440316.1_10 Reverse -270 -280 12.4681 0.214
NP_440316.1_10 Reverse -156 -166 7.84651 0.245
NP_440316.1_10 Reverse -292 -302 7.45319 0.251
NP_442488.1_7 Reverse -171 -190 16.8141 0.13
NP_441803.1_2 Forward -187 -168 6.58763 0.151
NP_439977.1_5 Reverse -167 -186 4.32602 0.153
NP_440589.1_3 Forward -98 -79 10.9142 0.147
NP_440139.1_1 Reverse -265 -284 5.30853 0.161
NP_440139.1_1 Reverse -167 -186 2.85027 0.222
NP_441572.1_7 Forward -188 -169 0.982764 0.157
NP_442384.1_10 Reverse -173 -186 8.86907 0.0606
NP_442384.1_10 Reverse -42 -55 5.52582 0.127
NP_442384.1_10 Reverse -71 -84 1.19926 0.267
NP_442384.1_10 Forward -182 -169 0.412608 0.291
NP_442114.1_4 Forward -182 -171 12.2517 0.107
NP_442114.1_4 Reverse -173 -184 10.1868 0.17
NP_441980.1_4 Forward -201 -182 5.211 0.206
NP_441877.1_7 Reverse -168 -187 0.981987 0.248
NP_441018.1_7 Reverse -114 -133 6.88262 0.281
NP_442790.1_4 Forward -289 -270 -5.80207 0.144
NP_442790.1_4 Reverse -164 -183 -7.67036 0.156
NP_442790.1_4 Reverse -208 -227 -14.8485 0.282
NP_442262.1_10 Forward -181 -174 14.1988 0.0123
NP_442262.1_10 Reverse -174 -181 14.1988 0.0123
NP_442262.1_10 Forward -279 -272 13.2155 0.0213
NP_441689.1_5 Forward -184 -174 8.43603 0.132
NP_441689.1_5 Reverse -269 -279 5.78111 0.197
NP_442244.1_6 Forward -185 -166 0.294447 0.291
NP_440344.1_10 Forward -189 -172 -9.59759 0.15
NP_440282.1_10 Reverse -283 -302 -5.21209 0.25
NP_440531.1_6 Forward -157 -138 7.27595 0.0998
NP_440531.1_6 Reverse -263 -282 -3.83545 0.272
NP_440531.1_6 Forward -156 -137 -4.6221 0.284
NP_440531.1_6 Forward -69 -50 -5.01543 0.291
NP_440562.1_3 Reverse -174 -191 5.44704 0.163
NP_441965.1_10 Reverse -170 -186 2.8118 0.282
NP_442065.1_5 Forward -204 -185 4.52268 0.16
NP_440297.1_9 Forward -399 -389 -0.118297 0.282
NP_440297.1_9 Forward -165 -155 -0.314959 0.282
NP_440297.1_9 Reverse -174 -184 -0.314959 0.282
NP_442187.1_3 Reverse -270 -280 13.4514 0.245
NP_440298.1_2 Reverse -211 -230 3.44104 0.295
NP_441896.1_5 Reverse -298 -305 12.2322 0.273
NP_440650.1_5 Forward -260 -241 14.3558 0.274
NP_440999.1_9 Reverse -169 -183 9.93102 0.0574
NP_440999.1_9 Forward -284 -270 7.57108 0.0846
NP_440999.1_9 Forward -39 -25 -1.18038 0.229
NP_440999.1_9 Forward -102 -88 -2.45868 0.27
NP_440888.1_2 Reverse -173 -187 14.0603 0.0211
NP_440888.1_2 Forward -182 -168 12.782 0.0389
NP_440888.1_2 Forward -280 -266 11.602 0.0635
NP_440888.1_2 Forward -172 -158 6.68548 0.223
NP_440792.1_5 Forward -181 -162 5.80098 0.244
NP_440491.1_1 Reverse -42 -61 10.5229 0.184
NP_440491.1_1 Reverse -170 -189 9.25599 0.218
NP_440491.1_1 Reverse -53 -72 8.0865 0.251
NP_442277.1_4 Reverse -62 -81 8.35677 0.13
NP_442033.1_10 Forward -292 -273 -0.590531 0.12
NP_442033.1_10 Reverse -171 -190 -6.98204 0.186
NP_442033.1_10 Reverse -69 -88 -7.96535 0.188
NP_441949.1_4 Forward -247 -228 8.06259 0.224
NP_441543.1_2 Reverse -174 -183 15.9293 0.00518
NP_441543.1_2 Forward -181 -172 15.4377 0.00784
NP_441543.1_2 Forward -279 -270 6.09625 0.153
NP_442845.1_2 Forward -188 -174 15.7325 0.0694
NP_442845.1_2 Reverse -36 -50 9.14437 0.18
NP_442845.1_2 Reverse -157 -171 4.42448 0.259
NP_440380.1_5 Forward -187 -168 4.62101 0.251
NP_440771.1_8 Reverse -345 -364 17.3048 0.244
NP_441551.1_5 Reverse -169 -185 22.6739 0.00905
NP_441178.1_6 Forward -169 -150 3.04693 0.269
NP_441469.1_4 Reverse -33 -52 15.8307 0.249
NP_441469.1_8 Reverse -156 -165 9.04618 0.227
NP_441469.1_8 Reverse -172 -181 8.06287 0.227
NP_441469.1_8 Forward -183 -174 6.5879 0.227
NP_441469.1_8 Forward -281 -272 5.60459 0.258
NP_441469.1_8 Forward -52 -43 5.40793 0.272
NP_442315.1_2 Reverse -31 -43 17.0502 0.241
NP_442337.1_8 Reverse -25 -44 -1.27885 0.28
NP_442578.1_7 Forward -181 -174 14.5921 0.026
NP_442578.1_7 Reverse -174 -181 14.5921 0.026
NP_442578.1_7 Reverse -272 -279 6.0373 0.18
NP_441462.1_2 Forward -182 -172 10.5998 0.0068
NP_441462.1_2 Reverse -173 -183 10.5014 0.00824
NP_441462.1_2 Reverse -271 -281 7.55152 0.0543
NP_441462.1_2 Reverse -71 -81 0.57002 0.144
NP_441462.1_2 Forward -280 -270 0.57002 0.144
NP_441462.1_2 Forward -80 -70 0.57002 0.144
NP_441621.1_7 Reverse -171 -185 16.0275 0.0266
NP_441621.1_7 Forward -184 -170 -1.37704 0.178
NP_443062.1_1 Forward -280 -262 19.1742 0.022
NP_443062.1_1 Reverse -173 -191 9.521 0.133
NP_443062.1_1 Reverse -26 -44 3.76806 0.285
NP_443062.1_6 Reverse -189 -208 10.1275 0.118
NP_443062.1_6 Reverse -285 -304 0.786102 0.288
NP_440519.1_3 Forward -357 -338 9.24257 0.282
NP_442204.1_1 Forward -186 -175 11.9567 0.0565
NP_442204.1_1 Reverse -267 -278 2.02529 0.266
NP_442204.1_5 Reverse -163 -182 -0.787193 0.298
NP_442204.1_7 Forward -209 -190 17.8948 0.243
NP_441560.1_8 Forward -187 -168 13.5579 0.205
NP_442487.1_5 Forward -291 -272 8.4551 0.198
NP_442487.1_5 Forward -62 -43 4.91521 0.234
NP_440454.1_2 Forward -330 -316 10.6112 0.291
NP_442872.1_1 Forward -46 -27 -12.0953 0.252
NP_440516.1_2 Forward -286 -268 9.45892 0.0998
NP_440516.1_6 Forward -205 -191 8.25877 0.247
NP_440516.1_8 Reverse -271 -280 18.9776 0.00442
NP_440516.1_8 Forward -182 -173 9.4395 0.0183
NP_440516.1_8 Reverse -173 -182 7.17789 0.0754
NP_440516.1_8 Forward -280 -271 5.01461 0.118
NP_442428.1_5 Forward -181 -174 15.8704 0.0124
NP_442428.1_5 Reverse -174 -181 15.8704 0.0124
NP_442428.1_5 Reverse -272 -279 6.13563 0.209
NP_442428.1_5 Forward -279 -272 6.0373 0.212
NP_441032.1_6 Forward -280 -261 13.6675 0.0869
NP_441443.1_7 Forward -200 -181 -0.688862 0.245
NP_441790.1_4 Reverse -358 -377 12.6841 0.268
NP_442859.1_2 Reverse -174 -193 4.03102 0.227
NP_440673.1_3 Forward -180 -173 14.0021 0.0426
NP_440673.1_3 Forward -278 -271 12.4288 0.0426
NP_440673.1_3 Reverse -175 -182 12.4288 0.0426
NP_440673.1_3 Reverse -210 -217 7.41394 0.263
NP_440865.1_9 Forward -188 -169 -0.885524 0.167
NP_440865.1_9 Reverse -265 -284 -5.50708 0.214
NP_441052.1_2 Reverse -173 -183 1.94665 0.221
NP_441052.1_2 Forward -280 -270 1.16001 0.25
NP_441052.1_2 Forward -182 -172 0.668351 0.256
NP_442219.1_9 Forward -181 -172 9.04618 0.0681
NP_442219.1_9 Reverse -174 -183 8.25953 0.0681
NP_442219.1_9 Forward -50 -41 2.75299 0.233
NP_440436.1_4 Forward -181 -172 16.9122 0.00357
NP_440436.1_4 Reverse -174 -183 9.24241 0.0871
NP_441884.1_8 Forward -183 -164 -7.67036 0.254
NP_441884.1_8 Reverse -25 -44 -13.2752 0.278
NP_441884.1_9 Forward -83 -64 -14.9469 0.138
NP_441884.1_9 Forward -185 -166 -21.535 0.25
NP_441357.1_2 Forward -257 -238 16.1257 0.191
NP_440314.1_9 Reverse -174 -193 -9.047 0.258
NP_440648.1_1 Forward -280 -261 4.22769 0.228
NP_441719.1_4 Forward -181 -174 16.3621 0.0124
NP_441719.1_4 Reverse -174 -181 16.3621 0.0124
NP_441719.1_4 Reverse -272 -279 6.82395 0.0855
NP_441719.1_4 Forward -279 -272 6.52896 0.188
NP_441733.1_10 Forward -185 -172 16.9322 0.0382
NP_441733.1_10 Reverse -268 -281 8.9674 0.131
NP_441733.1_10 Forward -83 -70 4.05085 0.276
NP_441004.1_1 Reverse -36 -55 -16.2252 0.283
NP_441004.1_1 Reverse -225 -244 -16.9135 0.287
NP_441004.1_1 Reverse -32 -51 -17.6018 0.292
NP_441004.1_2 Reverse -27 -46 3.34271 0.204
NP_441004.1_2 Reverse -220 -239 -1.57384 0.261
NP_441004.1_4 Forward -234 -224 13.648 0.216
NP_441004.1_4 Reverse -228 -238 10.3048 0.254
NP_442366.1_3 Reverse -172 -190 6.60732 0.0776
NP_442366.1_3 Reverse -270 -288 -2.3408 0.226
NP_441115.1_4 Forward -183 -165 9.35981 0.218
NP_442206.1_1 Forward -80 -61 -14.3569 0.269
NP_442206.1_4 Reverse -174 -193 15.6341 0.101
NP_442206.1_10 Forward -182 -167 4.01147 0.179
NP_442206.1_10 Forward -187 -172 3.22482 0.188
NP_440328.1_10 Reverse -306 -324 16.6363 0.216
NP_442430.1_10 Reverse -261 -280 11.995 0.245
NP_442430.1_10 Forward -192 -173 9.53674 0.287
NP_441851.1_9 Reverse -59 -78 15.1424 0.166
NP_441851.1_10 Forward -183 -173 9.7148 0.114
NP_441851.1_10 Reverse -172 -182 6.76487 0.156
NP_441851.1_10 Reverse -70 -80 6.66654 0.159
NP_441851.1_10 Forward -81 -71 6.37155 0.172
NP_442622.1_1 Forward -183 -164 -2.55715 0.177
NP_442622.1_8 Forward -280 -262 -18.9587 0.293
NP_442011.1_1 Forward -183 -164 10.3242 0.16
NP_441668.1_4 Reverse -283 -302 -0.295539 0.251
NP_442515.1_1 Reverse -70 -84 6.6861 0.0975
NP_440593.1_3 Forward -68 -49 -3.24547 0.233
NP_440593.1_3 Forward -334 -315 -3.3438 0.235
NP_440165.1_5 Forward -183 -164 12.0942 0.0454
NP_440940.1_7 Reverse -163 -181 12.0147 0.102
NP_440940.1_7 Forward -233 -215 3.06666 0.282
NP_441349.1_10 Reverse -163 -182 -5.70374 0.21
NP_441349.1_10 Reverse -32 -51 -9.93197 0.3
NP_441409.1_6 Forward -286 -267 -5.01543 0.0973
NP_440432.1_9 Forward -279 -264 13.2546 0.0201
NP_440432.1_9 Forward -258 -243 -4.445 0.209
NP_442843.1_1 Reverse -27 -46 -11.5053 0.291
NP_439960.1_10 Forward -198 -180 -4.01242 0.287
NP_440474.1_8 Forward -181 -167 9.14375 0.167
NP_440726.1_2 Forward -300 -281 4.12936 0.224
NP_440431.1_3 Forward -150 -131 2.0644 0.0992
NP_440431.1_3 Forward -303 -284 -11.4069 0.286
NP_442168.1_5 Reverse -169 -188 -1.96717 0.264
NP_440588.1_2 Forward -191 -172 -0.885524 0.154
NP_440588.1_2 Forward -289 -270 -2.65548 0.17
NP_440588.1_2 Reverse -205 -224 -5.9004 0.264
NP_440195.1_5 Reverse -151 -170 2.45773 0.276
NP_442335.1_7 Reverse -294 -308 12.5853 0.27
NP_440943.1_4 Reverse -285 -297 15.0836 0.198
NP_442006.1_3 Reverse -48 -66 -7.06068 0.298
NP_442006.1_3 Forward -188 -170 -7.65067 0.298
NP_443047.1_7 Forward -258 -239 5.01433 0.246
NP_441570.1_1 Forward -182 -164 -6.66736 0.0813
NP_441570.1_1 Forward -280 -262 -11.5839 0.198
NP_441078.1_4 Reverse -71 -80 14.5527 0.00789
NP_441078.1_4 Reverse -173 -182 9.93116 0.0203
NP_441078.1_4 Forward -182 -173 9.83282 0.0226
NP_441078.1_4 Forward -80 -71 8.35786 0.0338
NP_441078.1_4 Reverse -271 -280 0.196389 0.205
NP_441078.1_4 Forward -280 -271 -0.000272808 0.205
NP_442729.1_8 Forward -84 -71 10.2457 0.125
NP_442388.1_4 Forward -39 -20 14.2566 0.201
NP_441663.1_7 Reverse -190 -209 7.07928 0.209
NP_441663.1_8 Forward -308 -289 -3.14714 0.276
NP_442348.1_2 Reverse -118 -127 6.5879 0.299
NP_442443.1_1 Reverse -223 -242 -3.04881 0.264
NP_440526.1_3 Reverse -174 -185 9.3996 0.0876
NP_440526.1_3 Reverse -72 -83 1.3365 0.267
NP_441432.1_8 Forward -183 -174 16.8143 0.00595
NP_441432.1_8 Reverse -270 -279 14.0611 0.0258
NP_442320.1_8 Forward -188 -174 -0.885388 0.0817
NP_442320.1_8 Reverse -167 -181 -3.04867 0.105
NP_442320.1_9 Forward -246 -232 13.0776 0.246
NP_441732.1_2 Forward -186 -170 3.30346 0.0141
NP_441732.1_5 Reverse -357 -371 11.406 0.21
NP_441990.1_3 Forward -174 -155 15.9291 0.147
NP_440497.1_6 Reverse -266 -285 -6.1954 0.264
NP_440685.1_1 Forward -217 -198 32.9403 0.0000211
NP_440685.1_2 Forward -241 -222 28.0238 0.0012
NP_440685.1_3 Forward -262 -243 31.1704 0.0000951
NP_440685.1_4 Forward -124 -105 23.5006 0.0383
NP_440685.1_5 Forward -151 -132 33.8253 0.00000452
NP_440685.1_6 Forward -283 -264 24.3846 0.00648
NP_440685.1_7 Forward -193 -174 25.4672 0.0108
NP_440685.1_8 Forward -376 -357 27.5321 0.00193
NP_440685.1_9 Forward -355 -336 32.7437 0.000111
NP_440685.1_10 Forward -334 -315 29.3021 0.00106
NP_440760.1_1 Reverse -71 -90 -5.40875 0.05
NP_440760.1_1 Reverse -173 -192 -11.9969 0.0903
NP_440760.1_1 Forward -240 -221 -22.715 0.267
NP_442797.1_6 Forward -176 -157 8.12808 0.266
NP_442797.1_6 Reverse -175 -194 7.06155 0.294
NP_442797.1_7 Reverse -64 -82 2.77242 0.238
NP_442353.1_4 Reverse -272 -291 -0.984623 0.296
NP_441072.1_2 Reverse -260 -279 11.6025 0.188
NP_441072.1_2 Reverse -25 -44 7.47261 0.257
NP_442489.1_7 Reverse -173 -182 10.4228 0.0151
NP_442489.1_7 Forward -182 -173 10.3245 0.0193
NP_442489.1_7 Reverse -71 -80 1.08137 0.109
NP_442489.1_7 Forward -280 -271 0.688044 0.152
NP_442489.1_7 Reverse -271 -280 0.688044 0.152
NP_442489.1_7 Forward -80 -71 0.589713 0.17
NP_441830.1_2 Reverse -44 -63 -5.50708 0.29
NP_442079.1_7 Reverse -174 -193 3.44104 0.212
NP_440559.1_1 Forward -181 -172 8.84951 0.0586
NP_440559.1_1 Reverse -174 -183 8.65285 0.0586
NP_441659.2_8 Reverse -173 -183 18.6629 0.00133
NP_441659.2_8 Forward -280 -270 8.23984 0.0462
NP_441659.2_8 Forward -182 -172 2.33998 0.205
NP_441659.2_8 Forward -259 -249 0.766681 0.258
NP_441659.2_8 Forward -80 -70 0.0783647 0.277
NP_441659.2_8 Reverse -71 -81 -0.216628 0.292
NP_440118.1_4 Reverse -34 -53 6.68596 0.153
NP_440779.1_5 Forward -166 -149 -14.8091 0.274
NP_442346.1_5 Forward -183 -173 15.8113 0.0045
NP_442346.1_5 Reverse -172 -182 6.8632 0.188
NP_442346.1_5 Forward -81 -71 4.60159 0.281
NP_442346.1_5 Reverse -292 -302 4.40493 0.29
NP_442346.1_10 Forward -82 -63 4.71934 0.172
NP_442346.1_10 Forward -184 -165 -2.16383 0.294
NP_440545.1_3 Forward -186 -169 15.6735 0.013
NP_440545.1_3 Reverse -169 -186 11.0519 0.028
NP_440545.1_3 Reverse -67 -84 8.59364 0.0438
NP_440545.1_3 Forward -84 -67 -1.43612 0.168
NP_440545.1_3 Reverse -153 -170 -5.46769 0.25
NP_440545.1_3 Reverse -277 -294 -5.56602 0.253
NP_440545.1_5 Reverse -32 -49 15.1818 0.121
NP_441856.1_8 Forward -190 -171 13.4708 0.232
NP_440831.1_3 Reverse -222 -241 7.74622 0.245
NP_440831.1_3 Reverse -154 -173 6.48422 0.273
NP_441629.1_3 Forward -141 -122 -2.45958 0.269
NP_440010.1_4 Forward -192 -173 3.9319 0.22
NP_440010.1_4 Reverse -169 -188 -0.689632 0.26
NP_442027.1_5 Forward -258 -239 11.8975 0.23
NP_442551.1_4 Reverse -68 -83 6.76473 0.179
NP_442551.1_4 Reverse -155 -170 -3.26502 0.287
NP_442551.1_4 Forward -242 -227 -3.46169 0.29
NP_442900.1_1 Reverse -127 -146 -3.14714 0.202
NP_442603.1_7 Reverse -271 -285 10.422 0.126
NP_442603.1_7 Reverse -71 -85 7.27547 0.211
NP_441888.1_7 Reverse -168 -182 3.34284 0.225
NP_441888.1_7 Forward -285 -271 1.08123 0.267
NP_441948.1_4 Reverse -264 -282 -5.19239 0.256
NP_441833.1_4 Forward -181 -174 15.9687 0.0124
NP_441833.1_4 Reverse -174 -181 15.9687 0.0124
NP_441833.1_4 Forward -279 -272 6.52896 0.0924
NP_441833.1_4 Reverse -272 -279 6.23397 0.163
NP_441112.1_6 Reverse -261 -280 -4.72043 0.299
NP_442162.1_8 Reverse -167 -186 -3.24547 0.291
NP_442162.1_9 Forward -181 -174 16.2637 0.0124
NP_442162.1_9 Reverse -174 -181 16.2637 0.0124
NP_442162.1_9 Forward -279 -272 12.9205 0.0282
NP_442162.1_9 Reverse -272 -279 12.9205 0.0282
NP_440671.1_4 Forward -188 -174 11.701 0.127
NP_440671.1_4 Forward -286 -272 7.76774 0.208
NP_443026.1_5 Reverse -139 -158 -5.21209 0.293
NP_442045.1_5 Forward -191 -172 0.392778 0.266
NP_442199.1_5 Forward -190 -171 -1.47551 0.181
NP_442140.1_3 Forward -181 -171 17.188 0.0228
NP_442140.1_3 Reverse -174 -184 7.94484 0.124
NP_442140.1_3 Reverse -272 -282 6.76487 0.159
NP_440875.1_9 Reverse -175 -185 17.5217 0.0116
NP_440875.1_9 Forward -278 -268 15.867 0.0233
NP_440875.1_9 Forward -180 -170 11.6815 0.157
NP_441813.1_5 Forward -282 -272 16.303 0.01
NP_441813.1_5 Reverse -171 -181 9.22315 0.0286
NP_441813.1_5 Forward -184 -174 8.73149 0.0367
NP_441813.1_5 Reverse -269 -279 8.4365 0.0432
NP_440590.1_4 Reverse -272 -285 5.32916 0.0585
NP_440590.1_4 Reverse -174 -187 4.44418 0.0601
NP_440590.1_4 Forward -181 -168 -4.7006 0.265
NP_440590.1_4 Reverse -43 -56 -4.9956 0.272
NP_440590.1_4 Reverse -164 -177 -5.78224 0.289
NP_440567.1_1 Forward -181 -167 20.4524 0.012
NP_440567.1_1 Reverse -174 -188 16.3225 0.0166
NP_440567.1_1 Forward -79 -65 -0.492064 0.287
NP_442497.1_10 Reverse -174 -183 17.601 0.00813
NP_442497.1_10 Forward -181 -172 8.55452 0.0294
NP_442497.1_10 Forward -279 -270 7.76787 0.0731
NP_442497.1_10 Reverse -72 -81 0.29472 0.199
NP_442497.1_10 Forward -79 -70 0.29472 0.199
NP_440821.1_4 Forward -184 -174 10.7964 0.0146
NP_440821.1_4 Reverse -171 -181 10.0098 0.0221
NP_440821.1_4 Forward -82 -72 6.56821 0.0853
NP_440821.1_4 Reverse -69 -79 -0.0199663 0.217
NP_441239.1_9 Reverse -171 -183 14.4936 0.0272
NP_441239.1_9 Forward -184 -172 13.3137 0.037
NP_441239.1_9 Forward -282 -270 12.6253 0.0446
NP_441239.1_9 Forward -82 -70 5.84051 0.206
NP_441239.1_9 Reverse -229 -241 5.15219 0.227
NP_441239.1_9 Reverse -155 -167 4.46387 0.253
NP_441239.1_9 Forward -168 -156 4.26721 0.256
NP_441239.1_9 Forward -295 -283 3.57889 0.283
NP_441239.1_9 Reverse -291 -303 3.2839 0.289
NP_441239.1_9 Reverse -176 -188 3.18557 0.292
NP_441951.1_9 Forward -157 -138 -0.197208 0.27
NP_441727.1_3 Forward -189 -170 3.6377 0.284
NP_441892.1_1 Forward -175 -158 7.02034 0.0929
NP_441892.1_1 Forward -191 -174 3.38209 0.127
NP_442044.1_1 Forward -187 -168 -3.3438 0.176
NP_442044.1_1 Forward -85 -66 -14.1602 0.283
NP_442193.1_1 Reverse -140 -158 12.8022 0.223
NP_442193.1_3 Forward -358 -339 15.5967 0.294
NP_442193.1_8 Reverse -170 -189 15.7316 0.211
NP_442643.1_3 Forward -34 -15 -5.50708 0.261
NP_440833.1_6 Forward -151 -137 6.98048 0.292
NP_441526.1_6 Forward -190 -171 6.58763 0.265
NP_440354.1_5 Reverse -170 -189 10.4225 0.174
NP_442138.1_1 Forward -181 -162 3.44025 0.24
NP_442052.1_8 Reverse -291 -301 13.0581 0.253
NP_440546.1_4 Reverse -173 -183 14.3121 0.0459
NP_440546.1_4 Reverse -271 -281 14.0213 0.0459
NP_440546.1_4 Forward -182 -172 13.5365 0.0459
NP_440546.1_4 Forward -280 -270 8.20381 0.199
NP_440546.1_4 Forward -196 -186 6.45857 0.296
NP_440546.1_6 Forward -192 -173 7.7676 0.267
NP_439974.1_4 Forward -193 -174 8.06259 0.287
NP_441230.1_5 Reverse -266 -285 3.24438 0.204
NP_440462.1_6 Forward -184 -174 19.4496 0.00371
NP_440462.1_6 Reverse -171 -181 17.2863 0.00752
NP_440462.1_6 Forward -282 -272 13.353 0.0279
NP_440462.1_6 Reverse -269 -279 9.22315 0.049
NP_440462.1_6 Forward -313 -303 3.91327 0.224
NP_442611.1_1 Forward -187 -168 14.6508 0.0532
NP_440868.1_4 Reverse -169 -181 11.642 0.0295
NP_440868.1_4 Forward -186 -174 7.4138 0.0691
NP_440868.1_4 Reverse -267 -279 5.25052 0.102
NP_440868.1_4 Forward -284 -272 2.49725 0.153
NP_440401.1_9 Forward -41 -34 14.5917 0.287
NP_442499.1_3 Reverse -172 -190 6.11567 0.282
NP_442499.1_3 Forward -249 -231 4.14905 0.289
NP_441474.1_1 Forward -300 -281 2.55527 0.247
NP_442402.1_10 Reverse -257 -267 12.8609 0.204
NP_441848.1_7 Forward -294 -275 -2.75457 0.27
NP_441084.1_6 Forward -184 -170 9.24716 0.29
NP_440696.1_3 Reverse -169 -187 14.0805 0.0874
NP_440696.1_3 Forward -182 -164 0.117479 0.237
NP_441843.2_9 Forward -278 -260 12.34 0.205
NP_442039.1_4 Forward -181 -174 15.1821 0.0124
NP_442039.1_4 Reverse -174 -181 15.1821 0.0124
NP_442039.1_4 Reverse -272 -279 11.6422 0.0747
NP_442039.1_4 Reverse -72 -79 8.59391 0.193
NP_442039.1_7 Reverse -189 -199 9.41981 0.257
NP_441926.1_3 Forward -280 -264 4.77842 0.179
NP_440825.1_7 Forward -181 -171 12.0313 0.195
NP_442837.1_3 Forward -181 -174 15.7721 0.0124
NP_442837.1_3 Reverse -174 -181 15.7721 0.0124
NP_442837.1_3 Forward -279 -272 6.0373 0.25
NP_442837.1_3 Reverse -272 -279 6.0373 0.25
NP_442837.1_3 Reverse -303 -310 5.84064 0.272
NP_440160.1_2 Forward -308 -289 0.294447 0.228
NP_442053.1_1 Forward -280 -271 14.4544 0.0114
NP_442053.1_1 Forward -182 -173 9.24284 0.068
NP_442053.1_1 Reverse -173 -182 8.94785 0.07
NP_442053.1_1 Reverse -271 -280 7.86621 0.0863
NP_442053.1_1 Forward -80 -71 5.21127 0.203
NP_440505.1_3 Reverse -269 -279 15.6147 0.0106
NP_440505.1_3 Forward -184 -174 15.418 0.0114
NP_440505.1_3 Reverse -171 -181 4.40493 0.292
NP_441102.1_1 Reverse -174 -193 3.44104 0.286
NP_440207.2_2 Forward -82 -63 15.385 0.299
NP_441252.1_6 Reverse -137 -144 14.3954 0.168
NP_441203.1_1 Reverse -272 -291 -20.0601 0.297
NP_442532.1_7 Forward -182 -168 6.48943 0.171
NP_441408.2_7 Reverse -171 -190 -3.63879 0.274
NP_440914.1_1 Reverse -173 -183 15.0561 0.00832
NP_440914.1_1 Forward -280 -270 11.8356 0.0767
NP_441011.1_8 Forward -181 -172 18.191 0.00602
NP_441011.1_8 Reverse -174 -183 16.6177 0.00602
NP_441011.1_8 Reverse -272 -281 11.7994 0.0629
NP_441011.1_8 Forward -279 -270 6.78456 0.184
NP_442533.1_1 Reverse -36 -55 -14.4552 0.243
NP_442533.1_6 Forward -182 -173 15.1427 0.00675
NP_442533.1_6 Reverse -173 -182 7.47288 0.0898
NP_442533.1_6 Reverse -71 -80 7.37455 0.0898
NP_442533.1_6 Forward -51 -42 5.40793 0.14
NP_442533.1_6 Forward -280 -271 4.42462 0.179
NP_442533.1_6 Forward -172 -163 2.55633 0.25
NP_442533.1_6 Forward -301 -292 1.37636 0.3
NP_442533.1_6 Forward -239 -230 1.37636 0.3
NP_442541.1_10 Forward -102 -88 0.687325 0.3
NP_440263.1_5 Reverse -12 -26 7.17775 0.294
NP_442232.1_3 Forward -190 -171 -4.81876 0.163
NP_442232.1_3 Reverse -34 -53 -5.80207 0.171
NP_442232.1_3 Reverse -276 -295 -7.4737 0.201
NP_442232.1_3 Reverse -151 -170 -15.1435 0.289
NP_442232.1_3 Reverse -165 -184 -15.2418 0.289
NP_442322.1_4 Forward -156 -139 -9.49991 0.295
NP_441482.1_7 Forward -188 -174 8.65272 0.0162
NP_441482.1_7 Forward -86 -72 -10.9151 0.222
NP_441482.1_7 Forward -286 -272 -11.9968 0.288
NP_439944.1_9 Reverse -174 -184 17.7779 0.00341
NP_439944.1_9 Forward -181 -171 8.73149 0.102
NP_439944.1_9 Forward -79 -69 4.99491 0.284
NP_440816.1_7 Forward -186 -167 11.2092 0.218
NP_441028.1_6 Forward -201 -191 7.74772 0.218
NP_441028.1_6 Forward -161 -151 3.51951 0.292
NP_440115.1_6 Forward -185 -175 16.9913 0.0288
NP_440115.1_6 Reverse -170 -180 8.33817 0.13
NP_440115.1_6 Reverse -68 -78 6.96153 0.166
NP_440115.1_6 Reverse -268 -278 4.89658 0.28
NP_440115.1_6 Forward -397 -387 4.79825 0.282
NP_441347.1_5 Forward -188 -174 8.25877 0.294
NP_441602.1_3 Reverse -297 -316 3.34271 0.175
NP_441602.1_3 Forward -187 -168 -1.47551 0.227
NP_441602.1_3 Reverse -168 -187 -2.26216 0.233
NP_441602.1_3 Reverse -113 -132 -3.83545 0.253
NP_441106.1_1 Forward -183 -174 18.486 0.0028
NP_441106.1_1 Reverse -172 -181 17.306 0.00607
NP_441106.1_1 Reverse -270 -279 8.75118 0.0469
NP_439903.1_6 Forward -305 -286 4.12856 0.202
NP_442588.1_6 Reverse -136 -155 8.06259 0.173
NP_442588.1_6 Reverse -45 -64 -2.85214 0.296
NP_440302.1_9 Forward -155 -137 14.5721 0.209
NP_441286.1_1 Forward -183 -171 -3.89426 0.147
NP_441286.1_1 Reverse -172 -184 -3.99259 0.148
NP_441286.1_1 Forward -81 -69 -4.77924 0.175
NP_441286.1_1 Reverse -70 -82 -4.77924 0.175
NP_441286.1_1 Reverse -213 -225 -6.15587 0.251
NP_440670.1_8 Forward -182 -173 8.94785 0.0606
NP_440670.1_8 Reverse -173 -182 8.84951 0.0606
NP_440670.1_8 Reverse -271 -280 8.75118 0.0606
NP_440670.1_8 Forward -280 -271 6.19458 0.124
NP_441705.1_3 Reverse -13 -32 -6.88371 0.299
NP_441930.1_2 Reverse -230 -240 12.2714 0.262
NP_440886.1_7 Forward -281 -271 16.4991 0.0104
NP_440886.1_7 Forward -39 -29 12.3692 0.0805
NP_440886.1_7 Reverse -172 -182 9.02601 0.0805
NP_442072.1_9 Reverse -70 -88 -14.9272 0.165
NP_442072.1_9 Reverse -172 -190 -22.7936 0.259
NP_441753.1_10 Reverse -164 -183 5.60432 0.186
NP_441753.1_10 Reverse -262 -281 2.75272 0.227
NP_440907.2_8 Reverse -174 -184 19.1541 0.00362
NP_440907.2_8 Forward -181 -171 14.6309 0.029
NP_440907.2_8 Forward -79 -69 13.2542 0.0469
NP_440907.2_8 Reverse -72 -82 8.73102 0.117
NP_440907.2_8 Forward -310 -300 8.43603 0.117
NP_440907.2_8 Forward -279 -269 7.84605 0.117
NP_442264.1_2 Forward -192 -175 6.43035 0.259
NP_441021.1_1 Reverse -72 -91 -10.4236 0.238
NP_441463.1_3 Reverse -163 -182 -0.885524 0.134
NP_441626.1_2 Forward -181 -174 15.7721 0.0124
NP_441626.1_2 Reverse -174 -181 15.7721 0.0124
NP_441626.1_2 Reverse -272 -279 12.2322 0.0511
NP_441626.1_2 Forward -279 -272 5.93897 0.231
NP_441988.1_5 Forward -223 -204 10.0292 0.276
NP_442365.1_5 Forward -181 -162 27.7288 0.00109
NP_442365.1_7 Forward -186 -167 -1.08219 0.189
NP_440107.1_5 Forward -189 -170 -0.4922 0.178
NP_442794.1_1 Forward -284 -272 9.47875 0.0795
NP_442794.1_1 Forward -186 -174 3.57889 0.286
NP_442794.1_5 Reverse -170 -184 11.7993 0.275
NP_442615.1_1 Forward -191 -173 5.72234 0.0374
NP_442615.1_1 Reverse -164 -182 -2.43913 0.144
NP_441962.1_4 Forward -187 -168 -3.93378 0.155
NP_441962.1_4 Reverse -174 -193 -10.817 0.232
NP_441962.1_4 Reverse -168 -187 -13.0786 0.268
NP_440387.1_1 Forward -182 -166 15.5948 0.00527
NP_440387.1_1 Reverse -173 -189 6.45005 0.0282
NP_440387.1_1 Reverse -71 -87 -4.26803 0.181
NP_441431.1_2 Reverse -170 -184 17.8952 0.0234
NP_441431.1_2 Forward -185 -171 13.6669 0.0834
NP_441431.1_2 Forward -283 -269 7.17714 0.247
NP_441431.1_2 Forward -305 -291 6.19383 0.279
NP_441431.1_2 Forward -38 -24 5.89884 0.284
NP_441488.1_7 Forward -188 -169 17.3057 0.0543
NP_441836.1_2 Reverse -167 -186 9.14423 0.101
NP_440634.1_1 Reverse -269 -288 12.6841 0.26
NP_441993.1_1 Forward -188 -169 7.11193 0.175
NP_441174.1_2 Forward -185 -171 19.8624 0.00567
NP_441174.1_2 Reverse -170 -184 12.586 0.248
NP_440114.1_10 Forward -280 -266 14.7492 0.0346
NP_440114.1_10 Forward -182 -168 9.34103 0.177
NP_440114.1_10 Forward -80 -66 8.16106 0.213
NP_440114.1_10 Reverse -250 -264 6.58777 0.263
NP_440114.1_10 Reverse -369 -383 5.60446 0.3
NP_440287.1_6 Forward -184 -165 5.30933 0.183
NP_440293.1_3 Reverse -30 -49 8.94757 0.184
NP_440293.1_3 Forward -190 -171 7.66927 0.184
NP_440293.1_3 Reverse -156 -175 -6.68705 0.291
NP_440766.1_4 Forward -186 -172 17.6992 0.0255
NP_440766.1_4 Reverse -267 -281 2.45787 0.184
NP_441237.1_9 Forward -79 -69 14.6313 0.0285
NP_442635.1_3 Forward -190 -171 10.2259 0.18
NP_441133.1_3 Forward -191 -172 11.4058 0.295
NP_442867.1_8 Reverse -216 -235 8.94757 0.23
NP_440457.1_1 Forward -186 -174 6.72548 0.113
NP_440457.1_1 Forward -84 -72 2.79224 0.205
NP_440457.1_1 Reverse -267 -279 1.7106 0.227
NP_440457.1_1 Reverse -169 -181 0.23564 0.25
NP_440457.1_1 Reverse -67 -79 0.23564 0.25
NP_440798.1_6 Forward -181 -168 3.46087 0.151
NP_440798.1_6 Forward -279 -266 2.2809 0.182
NP_441801.1_4 Reverse -352 -362 2.7333 0.262
NP_440473.1_9 Reverse -162 -181 23.2056 0.00288
NP_440473.1_9 Reverse -239 -258 -9.14533 0.26
NP_442509.1_9 Reverse -271 -281 11.9759 0.107
NP_442509.1_9 Forward -290 -280 7.0594 0.24
NP_442509.1_9 Reverse -71 -81 6.96107 0.244
NP_442509.1_9 Forward -182 -172 6.86274 0.248
NP_442509.1_9 Forward -80 -70 6.17443 0.286
NP_441253.1_1 Reverse -262 -281 9.24257 0.205
NP_442514.1_5 Forward -53 -34 -7.08111 0.275
NP_440554.1_4 Forward -181 -171 16.008 0.0199
NP_440554.1_4 Reverse -174 -184 15.418 0.0199
NP_440554.1_4 Forward -279 -269 15.0247 0.02
NP_441885.1_5 Forward -182 -172 10.2065 0.012
NP_441885.1_5 Reverse -173 -183 1.65166 0.106
NP_441885.1_5 Forward -80 -70 0.373358 0.164
NP_441885.1_5 Reverse -271 -281 0.0783647 0.183
NP_441885.1_5 Reverse -71 -81 -0.609952 0.215
NP_441885.1_5 Forward -51 -41 -1.3966 0.26
NP_442341.1_7 Reverse -70 -84 3.53951 0.22
NP_442341.1_7 Forward -81 -67 2.5562 0.252
NP_442341.1_7 Reverse -172 -186 1.08123 0.299
NP_442341.1_9 Reverse -269 -283 5.80051 0.255
NP_441756.1_5 Forward -284 -265 24.2872 0.0117
NP_441756.1_5 Forward -72 -53 -0.0988766 0.242
NP_441756.1_5 Reverse -222 -241 -4.91709 0.297
NP_441173.1_9 Reverse -260 -268 11.0321 0.228
NP_442534.1_7 Reverse -165 -184 13.3725 0.181
NP_440423.1_6 Reverse -263 -282 -2.36049 0.126
NP_443000.1_7 Forward -184 -174 10.7964 0.0345
NP_443000.1_7 Reverse -269 -279 10.5998 0.0345
NP_443000.1_7 Reverse -171 -181 1.35667 0.251
NP_440507.2_3 Forward -191 -172 13.9616 0.141
NP_441842.1_10 Reverse -166 -180 13.3726 0.0776
NP_440275.1_3 Forward -184 -174 18.6629 0.0082
NP_440275.1_3 Reverse -269 -279 13.5497 0.0268
NP_440275.1_3 Reverse -171 -181 9.41981 0.0535
NP_440275.1_3 Reverse -248 -258 4.40493 0.196
NP_440091.1_1 Reverse -169 -181 21.8685 0.00953
NP_442275.1_1 Forward -182 -163 1.27776 0.284
NP_440679.1_10 Reverse -224 -243 -20.7484 0.286
NP_443010.1_10 Forward -185 -168 4.70347 0.223
NP_442451.1_2 Reverse -294 -313 -1.57384 0.172
NP_442451.1_2 Forward -190 -171 -10.522 0.274
NP_439962.1_4 Forward -288 -269 -0.000545616 0.197
NP_439962.1_4 Forward -190 -171 -5.99873 0.28
NP_439962.1_4 Reverse -165 -184 -8.06369 0.292
NP_441105.1_3 Forward -193 -174 18.9773 0.00932
NP_441105.1_3 Reverse -158 -177 -8.55534 0.274
NP_440216.1_1 Forward -280 -266 13.5693 0.00572
NP_440216.1_1 Forward -182 -168 -1.96703 0.0431
NP_440216.1_1 Forward -80 -66 -11.7018 0.212
NP_440216.1_1 Reverse -271 -285 -11.8001 0.219
NP_440216.1_1 Reverse -173 -187 -12.2918 0.256
NP_440216.1_9 Forward -33 -24 5.60459 0.292
NP_440678.1_9 Forward -187 -168 20.649 0.0677
NP_440172.1_1 Forward -182 -172 10.9931 0.0445
NP_440172.1_1 Reverse -173 -183 7.84651 0.0718
NP_440172.1_1 Forward -280 -270 4.79825 0.166
NP_440172.1_1 Reverse -293 -303 4.3066 0.194
NP_440172.1_1 Reverse -231 -241 1.74999 0.299
NP_440172.1_6 Forward -194 -175 19.174 0.0344
NP_440167.1_3 Reverse -163 -182 9.63589 0.247
NP_442015.1_10 Forward -284 -271 11.819 0.0372
NP_441226.1_1 Forward -304 -290 16.1252 0.27
NP_441226.1_7 Forward -181 -174 14.4934 0.0123
NP_441226.1_7 Reverse -174 -181 14.4934 0.0123
NP_441226.1_7 Reverse -272 -279 12.7234 0.0312
NP_441226.1_7 Forward -279 -272 11.5435 0.0757
NP_441226.1_7 Forward -231 -224 6.52862 0.253
NP_440198.1_10 Reverse -291 -310 17.3057 0.0986
NP_442446.1_3 Forward -194 -175 27.5321 0.00109
NP_442446.1_5 Forward -278 -259 7.7676 0.178
NP_441111.1_7 Reverse -174 -182 18.7023 0.00294
NP_441111.1_7 Forward -279 -271 8.86921 0.0589
NP_441111.1_7 Forward -181 -173 8.86921 0.0589
NP_442379.1_10 Reverse -166 -183 5.44704 0.13
NP_440244.1_1 Reverse -28 -47 -9.34199 0.287
NP_441766.1_2 Forward -182 -173 17.896 0.00297
NP_441766.1_2 Forward -280 -271 14.7494 0.00772
NP_441766.1_2 Reverse -173 -182 9.4395 0.0285
NP_440416.1_1 Forward -280 -261 -14.4552 0.288
NP_440416.1_9 Forward -189 -170 -5.60541 0.0813
NP_440416.1_9 Reverse -178 -197 -8.55534 0.117
NP_440416.1_9 Forward -58 -39 -8.55534 0.117
NP_440416.1_9 Reverse -264 -283 -18.9784 0.267
NP_443052.1_8 Reverse -163 -182 16.0274 0.00687
NP_443052.1_8 Forward -212 -193 -13.2752 0.279
NP_441940.1_4 Forward -304 -285 8.35759 0.266
NP_440591.1_9 Forward -189 -171 10.1472 0.13
NP_440591.1_9 Forward -287 -269 4.34571 0.283
NP_442154.1_1 Reverse -27 -45 3.3624 0.0634
NP_442154.1_1 Reverse -18 -36 -12.1739 0.217
NP_442154.1_1 Reverse -223 -241 -14.1405 0.217
NP_441430.1_6 Reverse -168 -187 14.5524 0.167
NP_440261.1_5 Reverse -174 -187 -1.16069 0.0662
NP_440261.1_5 Forward -165 -152 -6.66722 0.201
NP_440261.1_5 Reverse -72 -85 -12.2721 0.277
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGGGGTGGCACTCCTGAAGAAACCCAATGGTTTTTGGACCTGGGGTTTTACATCAGTTTTAGCGGCACAGTTACCTTCAAAAAAGCTGAAGGGATCCAAGCCAGTGCCCAGATGGTCCCCCCCGATCGCCTGTTGGTGGAAACCGATTGTCCCTTTTTGGCGCCAGTGCCCCAACGGGGTAAACGCAATGAACCAGCCTTTGTCCGCCATGTGGCCGAGGCGATCGCTGCCCTGCGCCATGTCCCCCTAGAAACCCTTGCCCAACAAACCACTACTAATGCCCGCAACCTTTTTAAACTACCGGTGCCTGCCTAATCTGGGGGTATCGCCCCCCTGGTAACCTCTCCCCGGCCTTCCCTAACCCCAACCACCGCAAATTTCCGGAGACTTCTGAGCCACC

CDS

ATGACAAACCTTGCCACCACGATGTTGCCCGATTTAATTGAAATCCAACACGCTAGTTTCCACTGGTTTTTGGAGGAAGGTTTAATCGAGGAATTGAATAGTTTTTCGCCGATTTCTGACTACACAGGCAAGCTGGAACTCCACTTTTTGGGCAAAGATTACAAGCTCAAACAACCCAAGTATGATGTTGATGAATCCAAGCGACGGGATGCTAGTTATTCGGTGCAGATGTATGTGCCGACCCGTCTGATTAACAAAGAAACCGGGGAAATTAAGGAGCAGGAAGTCTTCATCGGCGATCTCCCCCTAATGACAGAGCGGGGAACCTTCATCATCAATGGTGCGGAGCGGGTCATCGTTAACCAAATTGTGCGATCGCCAGGGGTTTACTACAAAAAAGAATTAGATAAAAACGGTCGCCGCACCTATTCCGCTTCCCTGATCCCCAACCGGGGGGCCTGGCTGAAATTTGAAACTGACAAAAATGGTCTAGTCTATGTCCGCATCGACAAGACCCGTAAATTGTCGGCTCAAGTGCTCCTAAAGGCGATCGGTCTGAGCGATAACGAAATTCTCGACTCCCTCAGCCACCCAGAGTTTTATCAAAAAACCCTCGACAAAGAAGGCAATCCCACCGAAGAGGAAGCTTTGGTGGAACTGTACAAAAAACTTCGCCCCGGTGAGCCCCCCACCGTTAGTGGTGGTCAACAGTTATTGGAGTCCCGCTTCTTCGACCCCAAACGCTATGACCTTGGTCGAGTGGGACGATACAAACTCAATAAAAAACTCCGGCTCAATGAAGCGGACACCACCCGGGTGCTTACCCCCCAAGACATCCTGGCCGCCATCAACTATCTGATTAATCTGGAATTTGACGTCGGCACCACCGATGACATCGACCACTTGGGCAATCGACGGGTACGTTCCGTTGGAGAACTATTGCAGAACCAAATTCGGGTTGGCTTAAATCGCCTGGAACGGATTATTAGGGAACGCATGACCGTTAGCGAATCCGATGCCCTTACCCCTGCTTCCTTGGTGAATCCCAAGCCTCTAGTGGCGGCCATCAAGGAATTCTTTGGTTCCTCCCAACTGTCCCAGTTCATGGACCAAACCAATCCCCTGGCGGAGTTGACCCACAAACGGCGTATTTCTGCCCTCGGCCCTGGGGGTCTAACCCGGGAGCGGGCCGGTTTTGCGGTGCGGGATATTCACCCTTCCCACCACGGCCGTATTTGCCCAGTGGAAACGCCGGAAGGCCCCAATGCCGGTTTGATCGGTTCCTTAGCTACCTGTGCCCGGGTCAATGATTACGGTTTCATTGAAACCCCCTATTTTCGGGTGGAGAGTGGTCGAGTCAGGAAAGATTTAGACCCCGTTTACCTCACCGCCGACGAAGAAGACGACATGCGGGTGGCCCCCGGGGACATTCCCACAGACGAAGAGGGCAACATCATTGGCGAGTCGGTACCTATTCGCTACCGCCAGGAATTTTCCACCACCAGCCCAGAACAAGTTGACTATGTAGCCGTTTCCCCGGTGCAAATTATTTCCGTTGCCACCTCCATGATCCCCTTCCTGGAGCATGACGATGCTAACCGGGCCCTAATGGGCTCCAACATGCAACGGCAGGCAGTGCCCCTGTTGCGTCCTGAACGGCCCTTGGTCGGTACAGGCTTGGAAGCCCAAGCTGCTCGCGACTCCGGCATGGTAATTGTTTCCCGTACCCATGGCATTGTCACCTATGTGGACGCCACCGAAATTCGGGTGCAGCCCCACTCCCCCGATAACCCTGCGGAGAAAGGGGAAGAAATCGTTTACCCAATCCAAAAATACCAACGGTCTAACCAAGATACCTGTTTAAACCAACGGCCCCTTGTTTATGCCGGGGAAGATGTGGTGCCTGGTCAAGTGCTAGCGGACGGTTCCGCCACGGAAGGGGGAGAGCTGGCCCTGGGCCAAAACATTCTCGTAGCCTATATGCCCTGGGAGGGTTACAACTACGAAGACGCCATTCTGATCAGTGAAAGGTTAGTCTATGACGATGTTTACACCAGTATCCACATCGAAAAATTTGAAATTGAAGCCCGTCAAACCAAGCTAGGACCCGAAGAAATCACCAGGGAAATCCCCAACGTCGGGGAAGATGCCCTGCGAAATCTGGATGAACATGGCATTATCCGCATCGGTGCTTGGGTGGAATCCGGCGATATCCTGGTGGGTAAAGTCACTCCCAAAGGGGAAGCAGATCAACCCCCCGAAGAAAAACTGCTGCGGGCTATTTTCGGTGAAAAAGCTCGGGACGTGCGGGACAACTCGCTACGGGTACCCAACGGTGAAAAAGGTCGGGTAGTGGATGTGCGAGTGTTCACCCGGGAAAAAGGAGACGAATTACCCCCCGGTGCCAATATGGTGGTGCGGATTTACGTAGCCCAAAAACGGAAAATCCAAGTGGGAGACAAAATGGCCGGTCGCCACGGCAATAAAGGGATTATTTCCCGCATTTTGCCCATCGAAGATATGCCCTATCTCCCTGATGGTCGCCCCATTGACATTGCCCTTAATCCCCTGGGGGTTCCTTCCCGGATGAACGTAGGTCAGGTGTTCGAATGCTTGCTGGGTTGGGCTGGGGAAAACCTTGGTGTGCGCTTCAAAATTACCCCCTTCGATGAGATGTACGGGGAAGAAGCGTCCCGGGATACGGTCCATGGCTTGTTGGAAGAAGCCTCCCAACGGCCGAACAAAGACTGGGTATTTAACGAAAACCACCCCGGCAAAATCCAAGTGTTCGACGGCCGCACCGGGGAACCCTTTGACCGTCCGATTACCGTTGGGCAAGCTTATATGCTCAAACTGGTGCATTTGGTGGACGATAAAATCCACGCCCGTTCCACCGGGCCCTACTCCTTGGTTACCCAACAGCCTTTGGGGGGTAAAGCCCAACAGGGGGGACAGCGGTTCGGAGAAATGGAAGTGTGGGCCCTGGAAGCCTACGGCGCCGCCTACATTTTGCAGGAACTACTCACCGTTAAATCCGATGACATGCAGGGTCGTAACGAAGCCCTCAATGCCATTGTTAAAGGCAAGAGTATTCCCCGGCCCGGTACCCCAGAATCCTTCAAGGTGTTGATGCGGGAACTACAATCCCTTGGTTTGGACATTGCCGCCCACAAAGTACAACTGTCCGAAGATGGTGAAAGCGCCGATGCAGAAGTAGATTTGATGATCGACAGCCAGCGTCGGGCCCCCAATCGTCCCACCTATGAGTCCCTCCACACCGAGGAGGATTTGGAAGAAGAAGAAGTGTAG

Protein

MTNLATTMLPDLIEIQHASFHWFLEEGLIEELNSFSPISDYTGKLELHFLGKDYKLKQPKYDVDESKRRDASYSVQMYVPTRLINKETGEIKEQEVFIGDLPLMTERGTFIINGAERVIVNQIVRSPGVYYKKELDKNGRRTYSASLIPNRGAWLKFETDKNGLVYVRIDKTRKLSAQVLLKAIGLSDNEILDSLSHPEFYQKTLDKEGNPTEEEALVELYKKLRPGEPPTVSGGQQLLESRFFDPKRYDLGRVGRYKLNKKLRLNEADTTRVLTPQDILAAINYLINLEFDVGTTDDIDHLGNRRVRSVGELLQNQIRVGLNRLERIIRERMTVSESDALTPASLVNPKPLVAAIKEFFGSSQLSQFMDQTNPLAELTHKRRISALGPGGLTRERAGFAVRDIHPSHHGRICPVETPEGPNAGLIGSLATCARVNDYGFIETPYFRVESGRVRKDLDPVYLTADEEDDMRVAPGDIPTDEEGNIIGESVPIRYRQEFSTTSPEQVDYVAVSPVQIISVATSMIPFLEHDDANRALMGSNMQRQAVPLLRPERPLVGTGLEAQAARDSGMVIVSRTHGIVTYVDATEIRVQPHSPDNPAEKGEEIVYPIQKYQRSNQDTCLNQRPLVYAGEDVVPGQVLADGSATEGGELALGQNILVAYMPWEGYNYEDAILISERLVYDDVYTSIHIEKFEIEARQTKLGPEEITREIPNVGEDALRNLDEHGIIRIGAWVESGDILVGKVTPKGEADQPPEEKLLRAIFGEKARDVRDNSLRVPNGEKGRVVDVRVFTREKGDELPPGANMVVRIYVAQKRKIQVGDKMAGRHGNKGIISRILPIEDMPYLPDGRPIDIALNPLGVPSRMNVGQVFECLLGWAGENLGVRFKITPFDEMYGEEASRDTVHGLLEEASQRPNKDWVFNENHPGKIQVFDGRTGEPFDRPITVGQAYMLKLVHLVDDKIHARSTGPYSLVTQQPLGGKAQQGGQRFGEMEVWALEAYGAAYILQELLTVKSDDMQGRNEALNAIVKGKSIPRPGTPESFKVLMRELQSLGLDIAAHKVQLSEDGESADAEVDLMIDSQRRAPNRPTYESLHTEEDLEEEEV