Your browser is old and dusty. Try Google Chrome!

Details for sll1772

ORF sll1772
Accession NP_440990.1
Symbol mutS
Category DNA mismatch repair protein MutS
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_7 Forward -202 -195 11.3472 0.0978
NP_441418.1_6 Reverse -290 -309 -30.0898 0.256
NP_441453.1_4 Reverse -194 -202 13.6874 0.0221
NP_441453.1_4 Forward -203 -195 7.29591 0.0589
NP_441818.1_9 Reverse -72 -91 -10.7186 0.298
NP_441642.1_1 Forward -113 -94 -1.57384 0.289
NP_440226.1_1 Reverse -194 -213 2.55606 0.259
NP_442655.1_10 Forward -261 -242 -19.0768 0.282
NP_442173.1_1 Forward -202 -194 7.8859 0.134
NP_442173.1_1 Reverse -195 -203 7.49257 0.171
NP_443027.1_4 Forward -205 -195 10.8948 0.112
NP_440784.1_7 Reverse -195 -202 12.4288 0.0475
NP_440784.1_7 Forward -202 -195 6.23397 0.241
NP_440061.1_5 Forward -396 -377 13.7658 0.241
NP_440061.1_9 Reverse -346 -360 14.2569 0.0707
NP_440061.1_9 Reverse -374 -388 6.68548 0.235
NP_440061.1_9 Reverse -192 -206 6.19383 0.255
NP_442062.1_8 Reverse -194 -204 11.2881 0.0483
NP_440761.1_4 Forward -208 -189 -13.7669 0.257
NP_440304.1_4 Reverse -346 -356 5.78156 0.19
NP_440304.1_4 Reverse -325 -335 1.94665 0.299
NP_441781.1_7 Forward -336 -317 -2.85214 0.289
NP_441200.1_4 Forward -356 -337 8.45592 0.251
NP_441208.1_9 Reverse -72 -86 4.62115 0.297
NP_440518.1_8 Reverse -341 -360 11.6017 0.288
NP_441558.1_5 Reverse -346 -365 7.7676 0.17
NP_441558.1_5 Reverse -288 -307 7.17762 0.19
NP_442889.1_1 Forward -342 -323 -13.1769 0.248
NP_442570.1_3 Reverse -300 -319 -8.752 0.292
NP_441716.1_1 Reverse -348 -362 18.0925 0.0205
NP_441327.1_1 Reverse -155 -174 10.941 0.184
NP_441831.1_2 Forward -233 -214 13.8633 0.205
NP_440343.1_3 Reverse -260 -278 3.06666 0.285
NP_440906.1_5 Forward -202 -195 6.23397 0.234
NP_440906.1_5 Reverse -195 -202 6.0373 0.262
NP_440906.1_9 Reverse -260 -279 12.4867 0.296
NP_441486.1_1 Reverse -191 -205 -5.9986 0.272
NP_442634.1_4 Forward -359 -345 -5.21195 0.241
NP_441014.1_5 Forward -322 -304 13.6872 0.204
NP_443018.1_3 Forward -202 -195 13.8055 0.024
NP_443018.1_3 Reverse -195 -202 13.6088 0.0352
NP_441634.1_8 Forward -254 -240 -0.295402 0.252
NP_441588.1_4 Forward -201 -191 13.648 0.0943
NP_442730.1_8 Reverse -186 -205 3.24359 0.276
NP_442485.1_3 Forward -362 -343 2.45773 0.209
NP_440667.1_2 Reverse -84 -103 -6.1954 0.273
NP_441950.1_7 Forward -66 -47 -6.49039 0.257
NP_442658.1_1 Forward -205 -195 7.84605 0.205
NP_440141.1_4 Forward -327 -308 -5.9004 0.296
NP_442205.1_9 Forward -189 -173 2.02515 0.224
NP_442544.1_2 Reverse -335 -349 -1.37704 0.287
NP_441414.1_9 Forward -203 -184 -10.522 0.287
NP_442321.1_1 Forward -205 -186 -7.17871 0.255
NP_442321.1_4 Reverse -339 -358 -7.37537 0.284
NP_441958.1_5 Reverse -193 -203 0.373358 0.154
NP_441127.1_1 Forward -189 -175 8.25939 0.3
NP_440203.1_5 Forward -333 -323 10.501 0.224
NP_440203.1_5 Reverse -137 -147 8.43603 0.299
NP_440995.1_8 Reverse -184 -203 2.45773 0.264
NP_440153.1_8 Reverse -348 -361 5.32916 0.18
NP_440153.1_8 Reverse -194 -207 4.64084 0.196
NP_441941.1_9 Reverse -337 -356 9.3409 0.219
NP_442210.1_9 Reverse -304 -322 15.3588 0.198
NP_441646.1_1 Forward -91 -72 -0.295539 0.26
NP_442438.1_10 Forward -142 -128 4.81781 0.142
NP_442231.1_5 Forward -107 -88 18.1907 0.263
NP_442771.1_1 Forward -338 -320 -5.88071 0.166
NP_440147.1_3 Forward -344 -325 10.3242 0.115
NP_440147.1_4 Reverse -192 -205 15.9489 0.0141
NP_441550.1_8 Reverse -192 -202 7.35439 0.164
NP_441916.1_7 Forward -203 -193 14.828 0.0115
NP_440206.1_4 Reverse -344 -363 5.70185 0.242
NP_440206.1_4 Forward -328 -309 -0.689632 0.29
NP_441041.1_4 Forward -363 -344 -10.0303 0.227
NP_441041.1_4 Forward -357 -338 -11.5053 0.248
NP_440569.1_7 Reverse -330 -349 10.5209 0.286
NP_442941.1_3 Forward -202 -192 -1.19994 0.288
NP_440674.1_3 Reverse -216 -235 5.211 0.23
NP_440260.1_7 Reverse -87 -106 1.86774 0.241
NP_440260.1_8 Forward -366 -348 -7.06068 0.295
NP_441514.1_6 Forward -145 -138 12.8221 0.252
NP_441678.1_9 Reverse -303 -322 -2.0655 0.257
NP_001035871.2_7 Forward -355 -345 14.533 0.187
NP_442012.1_1 Forward -342 -323 12.3892 0.0689
NP_441556.1_7 Reverse -347 -366 -0.689632 0.3
NP_440375.1_8 Forward -202 -183 5.30933 0.187
NP_441644.1_6 Forward -357 -347 6.17443 0.165
NP_441644.1_6 Forward -203 -193 5.58445 0.184
NP_441644.1_6 Reverse -348 -358 4.60114 0.233
NP_441644.1_6 Reverse -194 -204 3.8145 0.261
NP_442215.1_2 Reverse -306 -322 3.69678 0.093
NP_442933.1_10 Forward -203 -194 14.2577 0.0126
NP_442933.1_10 Reverse -194 -203 7.76787 0.11
NP_442926.1_3 Reverse -337 -356 6.29264 0.209
NP_442554.1_8 Reverse -195 -205 7.35486 0.0931
NP_442554.1_8 Reverse -349 -359 6.37155 0.12
NP_442554.1_8 Forward -202 -192 5.68323 0.141
NP_442554.1_8 Forward -356 -346 5.38824 0.15
NP_442554.1_8 Forward -298 -288 2.92996 0.249
NP_442142.1_4 Reverse -143 -156 4.14862 0.231
NP_442142.1_4 Reverse -345 -358 3.85363 0.243
NP_442142.1_4 Forward -360 -347 2.28034 0.295
NP_442292.1_1 Reverse -195 -204 6.5879 0.101
NP_440122.1_2 Reverse -307 -326 -0.39387 0.273
NP_443009.1_5 Forward -372 -361 3.5981 0.286
NP_440015.1_9 Reverse -194 -212 6.50899 0.117
NP_441198.1_8 Reverse -192 -202 11.7088 0.189
NP_441468.1_1 Forward -202 -195 13.8055 0.0242
NP_441468.1_1 Reverse -195 -202 6.0373 0.223
NP_441468.1_2 Forward -233 -219 16.3225 0.272
NP_441020.2_2 Forward -357 -338 21.5339 0.111
NP_441251.1_2 Reverse -101 -119 10.8356 0.262
NP_441612.1_2 Forward -50 -40 12.809 0.21
NP_442227.1_2 Reverse -136 -155 -0.787193 0.259
NP_442050.1_8 Forward -363 -344 16.6138 0.272
NP_440558.1_2 Forward -361 -342 3.73603 0.153
NP_440558.1_2 Forward -360 -341 -2.85214 0.231
NP_440558.1_2 Reverse -345 -364 -3.24547 0.234
NP_441878.1_6 Reverse -347 -357 9.81313 0.0212
NP_441878.1_6 Forward -358 -348 0.963343 0.128
NP_441878.1_6 Reverse -326 -336 -7.59145 0.245
NP_441878.1_6 Reverse -308 -318 -7.59145 0.245
NP_441557.1_5 Forward -203 -194 -0.491928 0.193
NP_441557.1_5 Reverse -194 -203 -0.590259 0.219
NP_441445.1_1 Forward -242 -223 -0.39387 0.291
NP_442267.1_4 Reverse -313 -332 17.6007 0.061
NP_442066.2_9 Forward -331 -318 7.88576 0.202
NP_441433.1_8 Forward -350 -331 1.0811 0.236
NP_442419.1_2 Reverse -349 -368 -2.26216 0.247
NP_442183.1_1 Forward -126 -112 3.73617 0.299
NP_442166.1_3 Forward -277 -258 -10.9153 0.271
NP_442397.1_9 Reverse -223 -242 2.94938 0.268
NP_440595.1_9 Forward -363 -344 15.6341 0.0983
NP_441116.1_9 Forward -144 -130 19.4691 0.111
NP_441063.1_8 Forward -119 -105 17.5524 0.212
NP_441549.1_9 Forward -361 -343 -8.92897 0.238
NP_442594.1_8 Forward -146 -127 2.3594 0.295
NP_442047.1_2 Forward -322 -308 16.4209 0.161
NP_440136.1_2 Forward -202 -195 6.52896 0.116
NP_440136.1_2 Reverse -195 -202 6.13563 0.193
NP_442590.1_9 Reverse -85 -104 3.93269 0.28
NP_442590.1_10 Forward -364 -345 4.42435 0.276
NP_440731.1_2 Forward -357 -338 7.27595 0.279
NP_440899.1_1 Reverse -303 -322 7.33393 0.261
NP_440299.1_1 Forward -207 -194 5.62358 0.169
NP_440299.1_1 Reverse -190 -203 5.23026 0.184
NP_441799.1_1 Reverse -190 -204 14.5519 0.0228
NP_441559.1_8 Reverse -358 -372 -7.47356 0.294
NP_440915.1_5 Forward -151 -132 17.2475 0.212
NP_440915.1_6 Forward -207 -193 7.37441 0.0709
NP_442158.1_4 Forward -58 -48 10.8948 0.283
NP_440748.1_4 Forward -387 -368 14.4533 0.288
NP_442386.1_9 Forward -204 -195 12.7823 0.0537
NP_442386.1_9 Reverse -193 -202 5.89917 0.233
NP_442386.1_10 Reverse -296 -309 5.82081 0.262
NP_440570.1_5 Forward -355 -336 2.65439 0.234
NP_441750.1_1 Forward -393 -374 -6.49039 0.239
NP_441750.1_1 Forward -351 -332 -7.57203 0.267
NP_441340.1_5 Reverse -195 -202 13.5105 0.0314
NP_441340.1_5 Forward -202 -195 6.23397 0.132
NP_441271.1_8 Forward -322 -312 14.7297 0.266
NP_442484.1_2 Forward -310 -291 -0.4922 0.266
NP_442791.1_5 Forward -364 -345 -9.24366 0.279
NP_440586.1_8 Reverse -195 -202 11.3468 0.0736
NP_440586.1_8 Forward -202 -195 9.47853 0.146
NP_441262.1_2 Reverse -122 -136 18.0596 0.279
NP_443051.1_1 Reverse -193 -202 0.393051 0.169
NP_439937.1_9 Reverse -176 -193 -15.1047 0.287
NP_440408.1_7 Forward -357 -338 9.14423 0.264
NP_440372.1_2 Forward -202 -195 6.62729 0.151
NP_440372.1_2 Reverse -195 -202 6.52896 0.188
NP_442783.1_8 Reverse -267 -286 15.5349 0.247
NP_441181.1_2 Reverse -298 -317 2.26107 0.272
NP_440316.1_10 Reverse -347 -357 6.8632 0.251
NP_442384.1_10 Forward -203 -190 3.65753 0.183
NP_440948.1_4 Reverse -266 -285 13.2741 0.175
NP_442121.1_4 Forward -308 -289 -4.72043 0.273
NP_442262.1_10 Forward -202 -195 13.0188 0.0314
NP_442262.1_10 Reverse -195 -202 11.6422 0.092
NP_440282.1_10 Reverse -338 -357 9.93088 0.107
NP_442910.1_1 Forward -194 -175 -3.44213 0.254
NP_440189.1_10 Reverse -183 -202 5.11266 0.279
NP_441965.1_10 Forward -360 -344 5.07341 0.219
NP_440297.1_9 Forward -356 -346 -0.118297 0.282
NP_440350.1_1 Reverse -214 -233 19.6656 0.0128
NP_440298.1_6 Forward -305 -291 20.7467 0.241
NP_440990.1_4 Forward -248 -229 18.6823 0.168
NP_440990.1_10 Forward -390 -371 18.3873 0.249
NP_440999.1_2 Forward -323 -304 9.0459 0.285
NP_440888.1_2 Reverse -194 -208 12.9786 0.0354
NP_440888.1_2 Reverse -216 -230 6.29216 0.241
NP_440888.1_2 Reverse -177 -191 5.89884 0.258
NP_442454.1_2 Forward -168 -149 7.01823 0.291
NP_440600.1_4 Reverse -186 -204 9.16393 0.0635
NP_440052.1_8 Forward -148 -129 10.6192 0.228
NP_442277.1_4 Reverse -80 -99 2.9486 0.235
NP_441543.1_2 Reverse -195 -204 11.6028 0.0504
NP_442845.1_2 Reverse -342 -356 8.16106 0.195
NP_442845.1_2 Forward -209 -195 6.3911 0.21
NP_442845.1_2 Reverse -188 -202 5.30946 0.237
NP_441551.1_5 Forward -361 -345 16.0857 0.0726
NP_442637.1_8 Forward -176 -157 17.404 0.0686
NP_440710.1_1 Reverse -186 -204 -8.24065 0.261
NP_441462.1_2 Forward -203 -193 -0.216628 0.192
NP_443062.1_1 Forward -203 -185 13.3238 0.0638
NP_443062.1_6 Forward -343 -324 0.58944 0.292
NP_442204.1_1 Forward -322 -311 3.0086 0.266
NP_442204.1_2 Forward -391 -372 9.3409 0.225
NP_441351.1_8 Forward -91 -72 1.96607 0.263
NP_440516.1_6 Reverse -327 -341 15.4369 0.188
NP_442428.1_5 Forward -202 -195 14.1988 0.0242
NP_442428.1_5 Reverse -195 -202 6.0373 0.212
NP_441443.1_7 Forward -78 -59 -1.96717 0.268
NP_440603.1_9 Reverse -75 -94 1.76941 0.278
NP_440673.1_3 Reverse -196 -203 13.2155 0.0426
NP_441052.1_2 Reverse -348 -358 4.20827 0.163
NP_441052.1_2 Reverse -41 -51 2.92996 0.187
NP_442219.1_9 Reverse -195 -204 8.65285 0.0681
NP_440436.1_4 Reverse -195 -204 12.979 0.0276
NP_441719.1_4 Forward -202 -195 6.62729 0.151
NP_441719.1_4 Reverse -195 -202 6.52896 0.188
NP_441004.1_1 Forward -201 -182 -9.63698 0.21
NP_441004.1_2 Reverse -316 -335 -3.44213 0.28
NP_441004.1_3 Forward -98 -79 5.89931 0.224
NP_441115.1_4 Reverse -193 -211 8.3765 0.25
NP_442694.1_4 Reverse -93 -102 13.3727 0.225
NP_441851.1_10 Forward -204 -194 6.27322 0.178
NP_440611.1_8 Forward -326 -307 11.8975 0.195
NP_442011.1_1 Forward -204 -185 -1.47551 0.268
NP_442515.1_1 Forward -84 -70 0.0979218 0.203
NP_441051.1_1 Reverse -87 -97 19.0562 0.292
NP_440389.1_5 Reverse -341 -360 15.5967 0.195
NP_442843.1_1 Forward -393 -374 -9.93197 0.272
NP_440396.1_10 Reverse -328 -344 9.39927 0.285
NP_442168.1_5 Reverse -305 -324 -2.85214 0.27
NP_440195.1_1 Reverse -353 -372 3.53937 0.207
NP_440954.1_1 Forward -66 -47 -11.7019 0.295
NP_442006.1_2 Forward -324 -307 -6.35267 0.161
NP_442243.1_1 Forward -384 -366 7.19654 0.178
NP_441078.1_4 Forward -357 -348 -1.37691 0.254
NP_441078.1_4 Reverse -348 -357 -1.47524 0.266
NP_442348.1_2 Reverse -92 -101 13.2744 0.198
NP_442348.1_2 Reverse -153 -162 7.27622 0.28
NP_442348.1_2 Forward -144 -135 7.17789 0.285
NP_442348.1_2 Forward -62 -53 7.17789 0.285
NP_442443.1_1 Forward -194 -175 -4.91709 0.28
NP_442443.1_4 Forward -107 -97 13.1559 0.261
NP_440526.1_3 Forward -161 -150 3.5981 0.267
NP_440526.1_3 Reverse -195 -206 1.43483 0.267
NP_441432.1_8 Forward -204 -195 4.32629 0.223
NP_443024.1_3 Forward -189 -179 10.3048 0.289
NP_441732.1_2 Reverse -344 -360 -6.92296 0.0558
NP_442003.1_10 Forward -395 -376 16.1257 0.266
NP_442797.1_1 Forward -103 -84 -3.3438 0.278
NP_441057.1_4 Reverse -71 -89 -3.42244 0.29
NP_441057.1_4 Forward -388 -370 -4.01242 0.299
NP_440913.1_1 Reverse -288 -306 7.00065 0.218
NP_442407.1_8 Reverse -290 -309 19.2723 0.138
NP_442489.1_7 Forward -357 -348 -1.37691 0.195
NP_442489.1_7 Reverse -348 -357 -1.47524 0.203
NP_442489.1_7 Forward -203 -194 -1.6719 0.235
NP_442079.1_7 Forward -356 -337 -0.000545616 0.287
NP_440559.1_1 Reverse -195 -204 7.86621 0.0856
NP_441659.2_8 Reverse -194 -204 4.20827 0.142
NP_441659.2_8 Forward -357 -347 -0.216628 0.292
NP_441040.1_2 Reverse -294 -313 -15.6352 0.286
NP_439956.1_7 Forward -209 -190 3.44104 0.257
NP_440708.1_6 Reverse -311 -330 -6.98204 0.24
NP_440335.1_9 Reverse -51 -69 10.2456 0.28
NP_440029.1_5 Reverse -116 -135 16.2232 0.187
NP_442346.1_5 Forward -204 -194 13.2547 0.0278
NP_442346.1_5 Reverse -193 -203 12.4681 0.0421
NP_442346.1_5 Forward -358 -348 5.38824 0.248
NP_442346.1_5 Reverse -347 -357 4.79825 0.272
NP_440545.1_3 Forward -361 -344 9.47861 0.0393
NP_440545.1_3 Reverse -305 -322 -0.256152 0.151
NP_440545.1_3 Reverse -323 -340 -4.18939 0.22
NP_440486.1_6 Forward -352 -333 6.58763 0.283
NP_440459.1_2 Forward -396 -379 9.77361 0.219
NP_442551.1_4 Forward -359 -344 4.1098 0.245
NP_441833.1_4 Forward -202 -195 6.23397 0.163
NP_441833.1_4 Reverse -195 -202 6.13563 0.198
NP_442162.1_9 Forward -202 -195 6.62729 0.142
NP_442162.1_9 Reverse -195 -202 6.43063 0.208
NP_440671.1_4 Forward -101 -87 6.09611 0.261
NP_442199.1_5 Forward -332 -313 6.4893 0.0809
NP_442199.1_5 Reverse -340 -359 -3.54046 0.208
NP_442199.1_5 Forward -113 -94 -6.98204 0.284
NP_442199.1_7 Reverse -45 -64 5.60352 0.212
NP_442140.1_3 Reverse -195 -205 9.41981 0.108
NP_442140.1_3 Forward -202 -192 5.38824 0.211
NP_441671.1_10 Forward -363 -344 4.52268 0.219
NP_440875.1_9 Reverse -317 -327 8.37203 0.233
NP_440875.1_9 Reverse -345 -355 7.30133 0.269
NP_441813.1_7 Reverse -375 -389 9.34041 0.256
NP_440567.1_1 Forward -202 -188 5.40779 0.103
NP_442497.1_4 Forward -175 -156 12.8432 0.271
NP_442497.1_10 Forward -202 -193 5.99792 0.095
NP_440821.1_4 Forward -205 -195 -0.511621 0.269
NP_441239.1_9 Reverse -346 -358 11.2487 0.0648
NP_441239.1_9 Reverse -192 -204 6.03717 0.202
NP_441239.1_9 Forward -309 -297 4.46387 0.253
NP_441892.1_1 Reverse -185 -202 -2.12444 0.218
NP_441508.1_4 Forward -166 -152 15.3858 0.244
NP_441874.1_1 Forward -348 -334 10.0294 0.265
NP_440833.1_6 Forward -84 -70 8.25877 0.277
NP_442216.1_4 Reverse -136 -144 8.08217 0.255
NP_440354.1_5 Forward -65 -46 1.96607 0.271
NP_441782.1_10 Forward -326 -312 17.4142 0.123
NP_440546.1_4 Forward -203 -193 15.3787 0.0459
NP_440546.1_4 Reverse -194 -204 10.8217 0.104
NP_442465.1_9 Forward -110 -96 12.8809 0.22
NP_442611.1_1 Reverse -343 -362 -0.688862 0.268
NP_442787.1_4 Forward -188 -169 21.1406 0.0566
NP_442479.1_9 Reverse -290 -309 -13.7669 0.29
NP_440270.1_1 Reverse -351 -370 18.3873 0.286
NP_442402.1_4 Reverse -33 -52 -1.27961 0.189
NP_441084.1_6 Reverse -346 -360 12.5437 0.16
NP_442039.1_4 Forward -202 -195 6.3323 0.289
NP_441811.1_8 Forward -209 -195 10.9143 0.219
NP_442679.1_1 Forward -353 -334 -5.31042 0.292
NP_442837.1_3 Forward -202 -195 6.0373 0.25
NP_442837.1_3 Reverse -195 -202 5.93897 0.265
NP_440160.1_2 Forward -312 -293 -1.86883 0.245
NP_440160.1_2 Forward -336 -317 -8.35868 0.286
NP_442532.1_1 Forward -119 -105 10.308 0.249
NP_442532.1_4 Reverse -169 -187 9.22538 0.273
NP_441011.1_8 Forward -202 -193 14.356 0.0249
NP_442533.1_1 Forward -261 -242 -8.85033 0.214
NP_442533.1_6 Forward -357 -348 13.8644 0.0178
NP_442533.1_6 Reverse -348 -357 7.17789 0.0948
NP_442533.1_6 Reverse -194 -203 5.70292 0.132
NP_442533.1_6 Forward -203 -194 4.42462 0.179
NP_442541.1_4 Reverse -43 -61 11.9164 0.262
NP_442541.1_10 Reverse -348 -362 13.077 0.182
NP_442322.1_4 Forward -320 -303 -8.8116 0.286
NP_442229.1_1 Reverse -383 -397 11.4053 0.18
NP_439944.1_9 Reverse -195 -205 7.84651 0.127
NP_439944.1_9 Forward -202 -192 4.99491 0.284
NP_441028.1_6 Reverse -331 -341 8.04271 0.217
NP_441527.1_4 Reverse -51 -70 -6.63711 0.222
NP_440007.1_4 Forward -335 -316 14.2574 0.178
NP_441106.1_1 Reverse -193 -202 7.76787 0.0764
NP_441106.1_1 Forward -204 -195 5.60459 0.141
NP_442614.1_2 Forward -95 -81 9.5377 0.242
NP_439995.1_5 Forward -213 -194 4.81767 0.283
NP_441069.1_5 Forward -322 -304 1.39578 0.261
NP_439999.1_9 Forward -145 -126 17.5024 0.0888
NP_441905.1_9 Forward -252 -233 13.7658 0.288
NP_441021.1_1 Forward -335 -316 -0.688862 0.104
NP_441463.1_3 Reverse -184 -203 -5.60541 0.23
NP_441463.1_6 Reverse -346 -360 10.1846 0.242
NP_441463.1_6 Forward -145 -131 5.93276 0.287
NP_441626.1_2 Forward -202 -195 6.52896 0.137
NP_441626.1_2 Reverse -195 -202 5.93897 0.231
NP_442362.1_7 Forward -355 -337 23.6186 0.0351
NP_442794.1_1 Forward -349 -337 4.5622 0.256
NP_442615.1_1 Forward -212 -194 -2.43913 0.144
NP_442615.1_1 Reverse -185 -203 -3.81576 0.17
NP_441962.1_4 Reverse -322 -341 -12.1936 0.253
NP_441431.1_2 Forward -327 -313 11.7987 0.132
NP_442647.1_7 Reverse -380 -393 5.91914 0.257
NP_441836.1_2 Forward -363 -344 -3.73712 0.244
NP_441836.1_2 Reverse -188 -207 -4.32711 0.255
NP_441993.1_1 Reverse -309 -328 2.23906 0.261
NP_441993.1_1 Forward -305 -286 2.04414 0.265
NP_441993.1_1 Reverse -292 -311 0.874656 0.29
NP_440358.1_8 Reverse -303 -322 3.24438 0.231
NP_440114.1_10 Forward -203 -189 9.73436 0.164
NP_442437.1_8 Reverse -381 -400 6.09597 0.242
NP_441510.2_5 Reverse -344 -363 13.47 0.275
NP_441510.2_7 Forward -400 -386 9.6354 0.281
NP_441311.1_2 Reverse -188 -202 10.9137 0.273
NP_440457.1_1 Forward -95 -83 0.530633 0.25
NP_441984.1_3 Reverse -286 -304 9.65558 0.204
NP_441332.1_6 Reverse -371 -381 12.7117 0.22
NP_442514.1_5 Forward -331 -312 -2.16459 0.216
NP_440554.1_4 Reverse -195 -205 5.48657 0.145
NP_441885.1_5 Reverse -194 -204 0.668351 0.133
NP_440478.1_10 Reverse -370 -384 7.66941 0.261
NP_442310.1_1 Reverse -307 -326 12.7825 0.234
NP_442341.1_7 Reverse -326 -340 1.27789 0.295
NP_441756.1_5 Forward -309 -290 -3.83545 0.29
NP_442534.1_7 Reverse -186 -205 12.4875 0.181
NP_440091.1_1 Forward -207 -195 3.38223 0.163
NP_439962.1_4 Reverse -269 -288 -8.55534 0.296
NP_441105.1_3 Reverse -291 -310 -5.11376 0.213
NP_441105.1_3 Forward -335 -316 -10.0303 0.3
NP_440216.1_9 Forward -350 -341 8.45619 0.286
NP_440172.1_1 Forward -203 -193 7.35486 0.0819
NP_442371.1_1 Reverse -249 -259 13.5492 0.206
NP_442418.1_5 Reverse -157 -175 19.1004 0.183
NP_441226.1_7 Reverse -195 -202 14.1984 0.024
NP_440198.1_3 Reverse -185 -204 13.3716 0.285
NP_443052.1_9 Reverse -374 -393 5.99764 0.138
NP_443052.1_9 Forward -309 -290 -1.08219 0.222
NP_441940.1_2 Forward -391 -372 12.7825 0.236
NP_442154.1_1 Forward -285 -267 -9.91228 0.195
NP_442564.1_9 Reverse -194 -208 13.832 0.274
NP_440988.1_10 Reverse -346 -360 4.51157 0.259
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GAAATCAGCAATTGGAGCGGGTGACGGAGGACCATACCTGGGTGGCCAGGGCCTTGAAAATGGGGGACATTGACCCGGCCCAGGCTAAGGTCCACCCCTGGCGCCATGTGCTGTTTCAATGTTTGGGGCGGCAGGATTTGAATTTTATCGAGGTGGAAGCTCTAGATGCCCAACCGGGAGACACCTTTATGATGTGTAGCGATGGCTTAACGGAGGAAGTGCCCGATAATTTAATTGAAAAAATCCTCACTGGTCAGGGGAATTGTGATGATCAGGCTGTCCAATTAATTGAAGAAGCCAAAAATGCCGGCGGCTCGGACAACATCACCATAGTGCTTGTGGATTTTTCTGAGGATAACCAGGACAGTTAATAGATTTAGTATGCGCGAAGACATAAAGA

CDS

GTGAGTGATTCCACCAATTTAACCATTGCGGAAGAGACCTTGGCCCTGTTGGAGTGGCCCAGGCTTTGTCAGCATTTGTCCACTTTTACCCAAACTCCCTTAGGGGCGATCGCCGCCCGCTACTTATTGCCCCCTTCCCAGTGGGAAGAAAGTCGGGAATTGCTAGCCCAAACCCAGGCGGTGGAATCGATTGAAAATTCTCCGGAAAGTAATTGGCATTTTAAAGGTATTGCCGACATTACTGAACCTTTGGCCCGGGTAGAACGGGGCGGTTTGGTTACGGGGCTGGAACTGTTGGCGATCGCCGGCACGTTAGCAGGGGTAAGGAGATTGCGGCGGGTCATCGAAGAACGGGATGACCTGGAAATTTTGCAAACCTTGGTGGCGGAAGTAAGAACCCTACCGGAATTGGAACAGGCCATCCACCATTGCCTAGGGGAAGATGGCAAAGTGGCCGAGCGGGCTAGCCCCAAATTGGGGGAAATTCGCCAAAAATTAAAGGCTGTACGGGAGCAAATCCAGCAAAAGCTACAAAAAATCATTCAACGCCAAAGCAATGCCCTCCAGGAAGCAGTAATTACCCAACGGGGGGACAGATTTGTTTTACCCATCAAAGCGGGTTACAAAGAACAGATGCCCGGCATTGTCCATGATAGTTCCGCCAGTGGTAACACCCTGTATGTGGAGCCCCAAGCCATTGTGGAATTGGGCAATAAACTGCGGCAAGCCCGTCGTCAGGAGCAAACGGAAGAAGAACGGATTCTGCGACAACTGAGTGATCAAGTTTTAGAAGTTCTGCTGGATTTGGAACATCTGTTGGCGATCGCCACCCGCTTGGATTTGGCCACGGCCAGAGTACGCTATAGCTTTTGGTTGGGGGCCCATCCTCCCCAATGGTTGACCCCAGGAGATGAAAAGCCGATTACGTTACGACAATTGCGCCATCCCCTGCTCCATTGGCAGGCAGAAAAAGAAGGGGGGCCCGCTGTGGTTCCCATCACGTTAACCATTGATTCTCAAATTCGAGTCATTGCCATTACTGGACCCAATACGGGCGGCAAAACCGTTACCCTCAAAACTCTGGGTTTGGTGGCCTTGATGGCCAAAGTGGGGTTATACATTCCTGCTAAGGAAACAGTGGAAATGCCCTGGTTTGCCCAGATATTAGCGGATATTGGCGATGAACAGTCTTTACAACAAAATCTTTCCACCTTTTCGGGGCATATTTGCCGCATTATCCGCATTTTGCAGGCTTTGCCCTCTGGAGTTCAGGATGTATTGGACCCGGAAATTGATTCTCCCAACCATCCAATTTTTCCATCTTTAGTCTTGCTGGACGAAGTAGGGGCCGGCACCGATCCTACCGAGGGTAGTGCCCTGGCGATCGCCCTATTGCGTCATTTAGCAGACCAGCCCTGTTTAACGGTGGCCACCACCCATTATGGGGAATTGAAGGCGCTGAAATACCAGGATGCCCGGTTTGAAAATGCCTCAGTGGAATTTGATGACCAAAGTCTCAGCCCCACCTACCGTTTGCTTTGGGGGATTCCTGGCCGTTCCAACGCCCTGGCGATCGCCCAACGTTTAGGTTTGCCCCTAGCCATAGTTGAACAGGCTAAGGATAAATTAGGCGGTTTTTCCGAAGACATTAACCAAGTCATTGCGGGGTTGGAGAGTCAGCGACGGGAACAGGAACAAAAGGCAGCCAATGCACAAAAGCTACTCCAGGAAACGGAAATTTTTTACCAACAGGTTTCCCAAAAAGCGGCCAGTCTGCAGGCGAGGGAAAGGGAATTAAAGTCTTATCAAGACCAGGAAGTGCAACAGGCGATCGCCGCCGCCAAGGAAGAAATTGCCAAAGTTATCCGCCAACTGCAACGGGGTAAACCTAGCGCTCAAAAGGCTCAGCAGGCGACGGAGATTCTCGGACAGATTCAGGCTGAACAAAAAGCAAAAGTTGCCCCTAAACCAATTGGTTACCAGCCCACAGTGGGGGAACGTATTCGTATTCCTAGTTTTGGCCAAACCGCCGAAGTGACCCAGGTCAATGCCACTGCCCAAACTGTTAACGTCACCCTAGGTTTGATGAAAATGACGGTGCCCATGGCGGACATTGAATCCCTAAACGGCAAAAAGGTGGAGCCGCCTCCTAAGTCGGAACCTGTGCCGAAAAAAGTTAAAGCCGAGCCTCCAGCAACTGAAGCTAAATCCCCGCCGGTGCTAGTGCGGACAGAAAAAAATACGTTGGACTGCCGCGGCGATCGCCTAGAGCGGGCCGAATCCCGCTTGGAAAAAGCCCTTAATCAAGCTTTAGATGCCGGGGTGTTATGGATTATCCATGGCAAAGGTACGGGAAAATTACGCCAAGGAGTGCAGGAATATTTGTCCCACCATCCCTTGGTAAAAAGTTATGCCCTAGCGCCCCAAAATGACGGGGGAGCTGGGGTAACCATTGCTTATTTGCGGTAA

Protein

MSDSTNLTIAEETLALLEWPRLCQHLSTFTQTPLGAIAARYLLPPSQWEESRELLAQTQAVESIENSPESNWHFKGIADITEPLARVERGGLVTGLELLAIAGTLAGVRRLRRVIEERDDLEILQTLVAEVRTLPELEQAIHHCLGEDGKVAERASPKLGEIRQKLKAVREQIQQKLQKIIQRQSNALQEAVITQRGDRFVLPIKAGYKEQMPGIVHDSSASGNTLYVEPQAIVELGNKLRQARRQEQTEEERILRQLSDQVLEVLLDLEHLLAIATRLDLATARVRYSFWLGAHPPQWLTPGDEKPITLRQLRHPLLHWQAEKEGGPAVVPITLTIDSQIRVIAITGPNTGGKTVTLKTLGLVALMAKVGLYIPAKETVEMPWFAQILADIGDEQSLQQNLSTFSGHICRIIRILQALPSGVQDVLDPEIDSPNHPIFPSLVLLDEVGAGTDPTEGSALAIALLRHLADQPCLTVATTHYGELKALKYQDARFENASVEFDDQSLSPTYRLLWGIPGRSNALAIAQRLGLPLAIVEQAKDKLGGFSEDINQVIAGLESQRREQEQKAANAQKLLQETEIFYQQVSQKAASLQARERELKSYQDQEVQQAIAAAKEEIAKVIRQLQRGKPSAQKAQQATEILGQIQAEQKAKVAPKPIGYQPTVGERIRIPSFGQTAEVTQVNATAQTVNVTLGLMKMTVPMADIESLNGKKVEPPPKSEPVPKKVKAEPPATEAKSPPVLVRTEKNTLDCRGDRLERAESRLEKALNQALDAGVLWIIHGKGTGKLRQGVQEYLSHHPLVKSYALAPQNDGGAGVTIAYLR