Your browser is old and dusty. Try Google Chrome!

Details for sll1712

ORF sll1712
Accession NP_440778.1
Symbol
Category Nucleoproteins
Definition DNA binding protein HU
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -227 -213 2.65453 0.173
NP_440795.1_7 Forward -296 -289 14.1988 0.0267
NP_441418.1_6 Reverse -288 -307 -30.2865 0.267
NP_440815.1_5 Reverse -288 -307 3.24438 0.286
NP_440897.1_6 Forward -222 -203 6.58682 0.0946
NP_440897.1_6 Forward -297 -278 -1.96793 0.2
NP_441453.1_4 Reverse -288 -296 6.80426 0.121
NP_441453.1_4 Forward -297 -289 6.80426 0.121
NP_441623.1_1 Forward -304 -286 -4.11075 0.274
NP_442877.1_3 Forward -233 -214 23.893 0.0121
NP_442838.1_7 Forward -302 -283 15.6341 0.0215
NP_441818.1_1 Forward -296 -285 9.59626 0.232
NP_441642.1_1 Forward -317 -298 -2.36049 0.289
NP_440226.1_1 Reverse -288 -307 12.8808 0.0399
NP_442287.1_1 Forward -233 -223 13.0576 0.288
NP_442173.1_1 Forward -296 -288 7.59091 0.163
NP_442173.1_1 Reverse -289 -297 5.72262 0.203
NP_442752.1_4 Reverse -213 -220 10.8555 0.0846
NP_442752.1_4 Forward -297 -290 4.26735 0.293
NP_443027.1_4 Forward -299 -289 12.9597 0.0595
NP_440784.1_7 Reverse -289 -296 13.2155 0.0365
NP_440784.1_7 Forward -296 -289 12.1338 0.0604
NP_440061.1_6 Forward -144 -126 16.7346 0.202
NP_442062.1_8 Forward -297 -287 7.64985 0.0911
NP_442062.1_8 Reverse -288 -298 7.25653 0.104
NP_442062.1_8 Forward -33 -23 3.91327 0.243
NP_442062.1_8 Reverse -223 -233 3.22496 0.279
NP_441859.1_3 Forward -298 -279 6.29183 0.18
NP_440304.1_4 Reverse -211 -221 7.55152 0.109
NP_440304.1_4 Reverse -221 -231 4.40493 0.266
NP_442242.1_4 Forward -296 -289 12.0355 0.0521
NP_442242.1_4 Reverse -289 -296 11.5438 0.089
NP_442110.1_7 Forward -228 -214 7.07942 0.126
NP_441925.1_4 Forward -232 -213 -13.0793 0.257
NP_441925.1_4 Forward -231 -212 -14.7509 0.263
NP_441083.1_5 Forward -297 -287 6.96153 0.0717
NP_441083.1_5 Forward -222 -212 -1.10161 0.295
NP_442827.1_8 Forward -305 -286 5.99684 0.113
NP_441738.1_2 Reverse -26 -33 8.29857 0.176
NP_441558.1_5 Reverse -286 -305 11.1109 0.0875
NP_440209.1_1 Forward -297 -289 8.37755 0.0576
NP_440209.1_1 Forward -222 -214 2.08437 0.286
NP_442136.1_1 Reverse -123 -142 17.7974 0.0862
NP_442889.1_8 Forward -300 -286 4.71887 0.255
NP_440178.1_7 Reverse -287 -306 -12.7836 0.124
NP_441163.1_9 Forward -354 -335 13.8641 0.236
NP_440906.1_5 Reverse -289 -296 13.3138 0.0268
NP_440906.1_5 Forward -296 -289 6.13563 0.241
NP_440747.1_10 Forward -225 -213 -12.4491 0.282
NP_441130.1_10 Reverse -286 -300 6.19444 0.197
NP_441486.1_1 Forward -300 -286 3.24451 0.0638
NP_442848.1_5 Forward -234 -216 -2.73412 0.286
NP_443018.1_3 Reverse -214 -221 11.5438 0.0752
NP_443018.1_3 Forward -296 -289 5.15232 0.226
NP_443018.1_3 Reverse -289 -296 5.05399 0.238
NP_441634.1_8 Forward -235 -221 -0.688726 0.265
NP_440376.1_1 Reverse -223 -232 4.22796 0.166
NP_440376.1_1 Reverse -288 -297 0.0980582 0.285
NP_440376.1_1 Forward -297 -288 -0.0986038 0.285
NP_442687.1_7 Reverse -287 -297 8.04317 0.116
NP_442687.1_7 Forward -298 -288 5.09324 0.221
NP_441846.1_10 Reverse -212 -231 -22.125 0.257
NP_441013.1_2 Forward -227 -209 1.10079 0.254
NP_440533.1_9 Reverse -213 -232 2.55606 0.274
NP_441763.1_10 Forward -308 -289 13.6666 0.121
NP_442658.1_1 Forward -299 -289 9.12434 0.167
NP_442782.1_2 Reverse -213 -227 6.6861 0.22
NP_440656.1_8 Reverse -358 -377 -6.29373 0.243
NP_440184.1_1 Forward -141 -122 2.11053 0.258
NP_441958.1_5 Forward -298 -288 1.25834 0.108
NP_441958.1_5 Reverse -287 -297 0.963343 0.12
NP_440203.1_5 Forward -219 -209 8.63269 0.29
NP_439905.1_2 Forward -227 -213 9.5377 0.233
NP_440984.1_7 Forward -302 -288 6.29277 0.219
NP_442690.1_1 Forward -140 -121 -15.9302 0.282
NP_442911.1_2 Reverse -278 -297 -5.01543 0.148
NP_442911.1_2 Forward -60 -41 -10.522 0.282
NP_441580.1_6 Forward -308 -289 -7.76869 0.246
NP_440153.1_5 Reverse -289 -303 3.73617 0.205
NP_440153.1_8 Forward -228 -215 -2.63565 0.246
NP_440200.1_5 Reverse -284 -303 8.35759 0.231
NP_443055.1_6 Reverse -216 -234 0.805058 0.239
NP_442002.1_9 Forward -298 -291 10.7572 0.185
NP_440809.1_9 Forward -260 -242 -8.73231 0.271
NP_441712.1_1 Forward -119 -100 9.61754 0.289
NP_440106.1_2 Reverse -213 -231 9.26226 0.298
NP_442438.1_10 Forward -302 -288 -0.492064 0.264
NP_441000.1_6 Reverse -287 -301 -2.75368 0.221
NP_440147.1_4 Reverse -286 -299 0.215946 0.261
NP_441550.1_8 Reverse -286 -296 8.04271 0.135
NP_441550.1_8 Forward -299 -289 5.38779 0.252
NP_441916.1_7 Reverse -288 -298 9.32148 0.037
NP_441916.1_7 Forward -297 -287 5.09324 0.146
NP_441041.1_4 Reverse -213 -232 -1.7705 0.103
NP_441041.1_4 Reverse -288 -307 -11.5053 0.248
NP_441041.1_7 Forward -300 -288 7.02889 0.18
NP_441041.1_7 Reverse -21 -33 4.98816 0.282
NP_441725.1_4 Reverse -283 -297 4.91554 0.278
NP_441725.1_5 Forward -221 -211 8.63316 0.0621
NP_441725.1_5 Forward -296 -286 2.24165 0.115
NP_441725.1_5 Reverse -289 -299 -0.806614 0.271
NP_439966.1_7 Forward -224 -214 12.7626 0.0365
NP_439966.1_7 Forward -299 -289 7.94438 0.145
NP_439966.1_9 Forward -299 -290 0.983037 0.253
NP_442941.1_3 Forward -296 -286 6.27322 0.0975
NP_442941.1_3 Reverse -82 -92 2.83163 0.14
NP_440289.1_2 Forward -300 -287 3.46087 0.078
NP_442281.1_1 Forward -237 -223 5.60385 0.152
NP_442281.1_1 Forward -302 -288 5.1122 0.169
NP_441457.1_7 Reverse -286 -305 3.44104 0.239
NP_441556.1_10 Forward -227 -213 10.6112 0.266
NP_440375.1_3 Reverse -124 -143 17.699 0.23
NP_443049.1_6 Reverse -212 -222 17.0085 0.0973
NP_442215.1_9 Reverse -214 -233 12.1925 0.185
NP_442029.1_1 Reverse -211 -230 -17.7985 0.272
NP_442933.1_10 Reverse -288 -297 13.9627 0.0192
NP_442933.1_10 Forward -297 -288 7.86621 0.103
NP_442554.1_8 Reverse -289 -299 6.46988 0.117
NP_442554.1_8 Forward -221 -211 3.91327 0.203
NP_441762.1_7 Reverse -287 -299 12.9203 0.0142
NP_441762.1_7 Forward -388 -376 -5.76255 0.238
NP_441762.1_7 Reverse -212 -224 -5.86088 0.246
NP_442142.1_4 Forward -225 -212 2.37867 0.294
NP_442292.1_1 Reverse -289 -298 0.196389 0.234
NP_443009.1_5 Reverse -287 -298 12.9395 0.0406
NP_443009.1_5 Forward -233 -222 6.25303 0.169
NP_441715.1_4 Forward -296 -286 5.97822 0.165
NP_442305.1_6 Forward -310 -300 16.2041 0.24
NP_441468.1_1 Reverse -289 -296 6.3323 0.202
NP_441468.1_1 Forward -296 -289 6.13563 0.209
NP_441468.1_1 Reverse -214 -221 4.07068 0.263
NP_441020.2_6 Reverse -211 -228 10.3636 0.146
NP_441020.2_6 Reverse -221 -238 7.31533 0.235
NP_441020.2_6 Forward -35 -18 7.11867 0.241
NP_441015.1_10 Reverse -214 -233 -4.91709 0.214
NP_441673.1_1 Forward -297 -288 1.27803 0.155
NP_441673.1_1 Reverse -288 -297 1.27803 0.155
NP_441956.1_10 Forward -315 -301 19.0751 0.233
NP_441764.1_8 Forward -210 -200 11.5021 0.284
NP_442719.1_2 Reverse -78 -96 -9.12632 0.259
NP_442227.1_4 Forward -121 -102 12.585 0.285
NP_442808.1_1 Forward -223 -213 15.0242 0.0285
NP_442542.1_2 Forward -299 -286 9.06573 0.142
NP_442113.1_10 Forward -229 -210 10.4225 0.119
NP_442342.1_9 Forward -224 -208 15.6932 0.087
NP_440558.1_2 Reverse -279 -298 -6.1954 0.272
NP_441498.1_3 Reverse -366 -384 7.19654 0.268
NP_442789.1_4 Forward -299 -280 -1.86883 0.229
NP_441518.1_3 Forward -307 -288 -10.0303 0.235
NP_441878.1_6 Reverse -212 -222 1.74999 0.0642
NP_441878.1_6 Reverse -222 -232 1.55333 0.0937
NP_441878.1_6 Reverse -287 -297 0.668351 0.139
NP_441557.1_5 Forward -297 -288 8.94785 0.0289
NP_441557.1_5 Reverse -288 -297 0.688044 0.128
NP_442419.1_2 Forward -227 -208 0.982764 0.238
NP_440084.1_8 Reverse -102 -116 11.8526 0.241
NP_441739.1_2 Reverse -24 -40 5.66272 0.228
NP_442830.1_5 Forward -234 -220 2.94893 0.25
NP_441819.1_5 Reverse -1 -20 10.5514 0.261
NP_441638.1_1 Reverse -216 -235 17.5024 0.0508
NP_442347.1_2 Reverse -289 -298 13.3727 0.056
NP_441037.1_4 Forward -299 -289 6.83041 0.239
NP_440151.1_5 Reverse -295 -314 2.55606 0.299
NP_441633.1_3 Reverse -22 -35 4.73917 0.0686
NP_441633.1_3 Reverse -286 -299 -5.68391 0.236
NP_441633.1_3 Forward -299 -286 -6.47056 0.253
NP_440136.1_2 Reverse -289 -296 6.43063 0.154
NP_440136.1_2 Forward -296 -289 6.23397 0.171
NP_442998.1_10 Forward -276 -269 7.21728 0.144
NP_442998.1_10 Forward -220 -213 6.13563 0.181
NP_442998.1_10 Reverse -290 -297 5.93897 0.206
NP_440299.1_1 Reverse -284 -297 6.21356 0.149
NP_441559.1_8 Reverse -19 -33 -3.34366 0.201
NP_442452.1_3 Reverse -277 -296 6.98095 0.214
NP_440537.1_7 Reverse -124 -143 11.0289 0.263
NP_440695.1_5 Forward -297 -278 6.4893 0.154
NP_440695.1_5 Reverse -213 -232 -2.0655 0.296
NP_442386.1_9 Forward -223 -214 6.48915 0.219
NP_442386.1_9 Forward -298 -289 6.19416 0.23
NP_441340.1_5 Forward -296 -289 5.93897 0.198
NP_441340.1_5 Reverse -289 -296 5.84064 0.208
NP_441340.1_9 Reverse -138 -148 8.83366 0.256
NP_441271.1_1 Reverse -282 -300 15.5546 0.202
NP_442240.1_2 Reverse -214 -233 -19.8634 0.295
NP_440586.1_8 Forward -296 -289 11.1501 0.0845
NP_440586.1_8 Reverse -214 -221 10.9535 0.119
NP_442251.1_6 Forward -296 -289 13.7071 0.0268
NP_441262.1_3 Reverse -213 -220 5.25066 0.215
NP_440027.1_3 Forward -232 -214 4.83661 0.25
NP_443051.1_1 Forward -298 -289 0.688044 0.134
NP_443051.1_1 Reverse -287 -296 -1.08191 0.281
NP_443051.1_1 Reverse -212 -221 -1.18024 0.297
NP_439937.1_9 Forward -223 -206 -11.2699 0.248
NP_440439.1_1 Forward -300 -287 2.57589 0.131
NP_440372.1_2 Forward -296 -289 6.62729 0.151
NP_440372.1_2 Reverse -289 -296 6.52896 0.188
NP_440819.1_5 Forward -160 -152 7.8859 0.266
NP_440316.1_10 Reverse -212 -222 8.4365 0.239
NP_442663.1_1 Reverse -2 -21 7.27514 0.193
NP_439977.1_5 Forward -228 -209 15.1424 0.0531
NP_440139.1_1 Forward -303 -284 5.80018 0.152
NP_442384.1_10 Forward -297 -284 5.23083 0.134
NP_442114.1_4 Reverse -288 -299 11.0717 0.147
NP_442114.1_8 Forward -117 -103 6.78381 0.234
NP_441018.1_7 Forward -27 -8 11.2092 0.19
NP_441018.1_7 Reverse -297 -316 8.55425 0.242
NP_442262.1_10 Reverse -214 -221 11.7405 0.0841
NP_441689.1_5 Forward -356 -346 4.89613 0.286
NP_440344.1_10 Reverse -281 -298 0.137172 0.0369
NP_442910.1_1 Forward -239 -220 -8.26035 0.289
NP_442910.1_1 Forward -323 -304 -8.35868 0.291
NP_442750.1_3 Forward -381 -362 -11.6036 0.256
NP_440297.1_9 Forward -221 -211 9.51814 0.0917
NP_440297.1_9 Forward -296 -286 0.766681 0.282
NP_440894.1_7 Reverse -100 -119 10.7167 0.234
NP_440999.1_9 Forward -226 -212 5.60446 0.11
NP_440888.1_2 Reverse -288 -302 14.0603 0.0211
NP_441787.1_5 Reverse -290 -309 17.109 0.183
NP_441543.1_2 Reverse -289 -298 8.65285 0.0968
NP_441543.1_3 Reverse -20 -34 10.2254 0.212
NP_441469.1_8 Forward -298 -289 12.8811 0.0929
NP_441469.1_8 Reverse -23 -32 11.8978 0.141
NP_443064.1_6 Forward -297 -287 14.1182 0.0796
NP_443064.1_6 Reverse -223 -233 8.6886 0.276
NP_442337.1_8 Reverse -295 -314 1.96607 0.225
NP_442578.1_5 Forward -225 -206 3.83436 0.257
NP_442578.1_7 Forward -296 -289 12.5271 0.0544
NP_442578.1_7 Reverse -214 -221 5.15232 0.291
NP_441462.1_2 Forward -297 -287 9.41981 0.021
NP_443062.1_1 Reverse -288 -306 12.7387 0.0744
NP_442204.1_1 Reverse -209 -220 1.33697 0.274
NP_441560.1_8 Reverse -283 -302 15.1161 0.122
NP_442487.1_5 Forward -233 -214 7.37347 0.198
NP_440516.1_8 Reverse -213 -222 0.786375 0.133
NP_440516.1_8 Forward -297 -288 -0.295266 0.232
NP_442846.1_4 Forward -144 -125 16.3224 0.126
NP_442428.1_5 Reverse -289 -296 13.1171 0.038
NP_442428.1_5 Forward -296 -289 6.23397 0.201
NP_442428.1_5 Reverse -214 -221 4.46401 0.267
NP_441790.1_3 Reverse -289 -308 -3.73712 0.291
NP_442859.1_2 Reverse -214 -233 11.2092 0.166
NP_442120.1_10 Reverse -324 -343 -10.3253 0.257
NP_440778.1_1 Forward -65 -46 30.1039 0.0000314
NP_440778.1_3 Reverse -107 -126 26.1555 0.00525
NP_440778.1_3 Forward -44 -25 19.2723 0.0522
NP_440673.1_3 Forward -220 -213 11.6422 0.0724
NP_440673.1_3 Reverse -290 -297 10.1672 0.149
NP_440673.1_3 Reverse -278 -285 5.54565 0.288
NP_441052.1_2 Reverse -288 -298 -0.216628 0.269
NP_442219.1_9 Reverse -289 -298 5.11294 0.186
NP_440436.1_4 Reverse -289 -298 8.35743 0.109
NP_440436.1_4 Forward -296 -287 5.11253 0.222
NP_442577.1_9 Forward -319 -305 11.602 0.253
NP_441719.1_4 Forward -296 -289 6.62729 0.151
NP_441719.1_4 Reverse -289 -296 6.52896 0.188
NP_441719.1_4 Reverse -214 -221 3.77569 0.285
NP_441733.1_10 Forward -300 -287 10.639 0.106
NP_441004.1_1 Reverse -207 -226 0.687771 0.116
NP_441004.1_2 Reverse -313 -332 -4.13045 0.288
NP_441004.1_5 Reverse -209 -223 11.996 0.24
NP_442813.1_4 Reverse -92 -111 -9.14533 0.299
NP_442139.1_7 Reverse -202 -221 7.07928 0.291
NP_442694.1_4 Reverse -118 -127 11.7011 0.277
NP_442694.1_9 Reverse -90 -109 9.53756 0.244
NP_442854.1_6 Reverse -213 -232 7.17762 0.229
NP_442854.1_7 Reverse -292 -311 10.7175 0.111
NP_443054.1_2 Reverse -286 -300 4.32615 0.24
NP_443054.1_2 Forward -235 -221 2.75286 0.241
NP_441851.1_10 Forward -298 -288 7.84651 0.13
NP_441851.1_10 Reverse -222 -232 4.99491 0.233
NP_441851.1_10 Reverse -212 -222 4.60159 0.259
NP_441542.1_4 Forward -132 -118 3.44117 0.282
NP_441501.1_2 Reverse -292 -311 15.2408 0.258
NP_442515.1_1 Forward -298 -284 -4.81863 0.298
NP_440593.1_3 Forward -302 -283 -3.24547 0.233
NP_441349.1_10 Reverse -213 -232 -3.93378 0.155
NP_440432.1_9 Reverse -289 -304 7.35472 0.0427
NP_442843.1_1 Reverse -214 -233 -11.6036 0.291
NP_440474.1_8 Reverse -289 -303 7.76712 0.199
NP_442450.1_5 Reverse -286 -296 8.53483 0.13
NP_442450.1_5 Reverse -211 -221 6.17489 0.197
NP_441078.1_4 Forward -297 -288 0.29472 0.205
NP_441078.1_4 Reverse -288 -297 0.0980582 0.205
NP_441078.1_4 Forward -232 -223 -1.57357 0.266
NP_441078.1_4 Reverse -213 -222 -2.06522 0.295
NP_442729.1_5 Reverse -212 -222 9.32148 0.235
NP_442729.1_8 Forward -37 -24 7.49244 0.15
NP_442729.1_8 Reverse -284 -297 7.29578 0.158
NP_440526.1_3 Reverse -289 -300 1.92649 0.267
NP_441432.1_8 Forward -298 -289 5.21127 0.185
NP_443024.1_3 Reverse -343 -353 10.2065 0.289
NP_442320.1_8 Reverse -282 -296 5.70279 0.0334
NP_442320.1_8 Forward -303 -289 4.71948 0.0472
NP_442344.1_7 Reverse -289 -308 -8.752 0.226
NP_440629.1_4 Forward -121 -102 8.65258 0.264
NP_440760.1_1 Forward -297 -278 -18.7818 0.217
NP_440578.1_10 Forward -377 -358 10.0292 0.278
NP_442489.1_7 Forward -297 -288 0.589713 0.17
NP_442489.1_7 Reverse -288 -297 0.589713 0.17
NP_442489.1_7 Reverse -213 -222 -1.57357 0.213
NP_442489.1_7 Reverse -223 -232 -1.6719 0.235
NP_442079.1_7 Reverse -208 -227 8.65258 0.119
NP_440559.1_1 Forward -296 -287 7.66954 0.0999
NP_441659.2_8 Forward -297 -287 -0.0199663 0.282
NP_441659.2_8 Reverse -288 -298 -0.118297 0.287
NP_441040.1_5 Forward -237 -218 7.66927 0.229
NP_440779.1_5 Reverse -288 -305 -5.07437 0.127
NP_442346.1_5 Reverse -287 -297 11.3864 0.0681
NP_442346.1_5 Forward -298 -288 5.19158 0.256
NP_440352.1_5 Forward -220 -201 10.2223 0.278
NP_441856.1_5 Reverse -146 -165 16.4199 0.236
NP_440831.1_3 Reverse -279 -298 5.99883 0.28
NP_441629.1_3 Reverse -20 -39 -3.34455 0.277
NP_441653.1_2 Forward -308 -289 2.27338 0.295
NP_442603.1_7 Forward -222 -208 10.3237 0.129
NP_442603.1_7 Forward -297 -283 7.47213 0.205
NP_441888.1_7 Reverse -19 -33 2.16287 0.225
NP_441888.1_7 Forward -227 -213 1.17956 0.263
NP_441948.1_4 Reverse -206 -224 -4.79907 0.242
NP_441948.1_6 Reverse -135 -152 12.4285 0.257
NP_441047.1_2 Forward -353 -334 -1.67217 0.269
NP_441833.1_4 Reverse -289 -296 6.3323 0.134
NP_441833.1_4 Forward -296 -289 6.23397 0.163
NP_442162.1_9 Forward -296 -289 6.52896 0.178
NP_442162.1_9 Reverse -289 -296 6.43063 0.208
NP_440671.1_6 Forward -317 -298 21.3364 0.0544
NP_442140.1_3 Reverse -289 -299 7.64985 0.133
NP_442140.1_3 Reverse -214 -224 5.78156 0.197
NP_440875.1_9 Reverse -290 -300 13.5309 0.0677
NP_441813.1_3 Forward -109 -90 15.8856 0.238
NP_441813.1_5 Reverse -286 -296 5.48657 0.123
NP_441813.1_5 Forward -299 -289 0.275027 0.206
NP_441813.1_5 Forward -224 -214 -0.0199663 0.227
NP_440590.1_4 Reverse -289 -302 2.57589 0.0845
NP_440567.1_1 Forward -296 -282 5.21113 0.105
NP_440567.1_1 Reverse -289 -303 0.982901 0.224
NP_442497.1_10 Forward -296 -287 8.25953 0.047
NP_442497.1_10 Reverse -289 -298 0.589713 0.153
NP_442497.1_10 Forward -221 -212 0.196389 0.208
NP_440821.1_4 Forward -299 -289 9.02648 0.0364
NP_440821.1_4 Reverse -286 -296 1.455 0.135
NP_440821.1_4 Reverse -211 -221 0.373358 0.18
NP_441239.1_9 Forward -224 -212 8.6921 0.125
NP_441239.1_9 Forward -299 -287 5.74217 0.21
NP_441239.1_9 Reverse -286 -298 3.08724 0.296
NP_440400.1_1 Forward -231 -212 -0.886293 0.285
NP_441017.1_6 Reverse -209 -223 11.1104 0.279
NP_441874.1_1 Forward -186 -172 8.75105 0.294
NP_441617.1_6 Reverse -119 -138 -0.885524 0.256
NP_442138.1_10 Reverse -291 -310 -3.44213 0.238
NP_442138.1_10 Reverse -323 -342 -5.50708 0.269
NP_442349.1_3 Reverse -25 -44 7.7676 0.272
NP_441230.1_5 Forward -302 -283 4.916 0.185
NP_440462.1_6 Forward -299 -289 8.23984 0.0687
NP_442340.1_3 Forward -352 -333 -8.06369 0.243
NP_440868.1_4 Forward -226 -214 0.432302 0.212
NP_440868.1_4 Forward -301 -289 0.0389777 0.234
NP_442479.1_9 Forward -137 -118 -1.27885 0.21
NP_442479.1_9 Reverse -98 -117 -13.8652 0.293
NP_442402.1_10 Reverse -88 -98 13.3526 0.204
NP_440696.1_3 Reverse -213 -231 0.707465 0.228
NP_441811.1_8 Reverse -282 -296 6.88276 0.259
NP_442837.1_3 Reverse -289 -296 13.5105 0.0268
NP_442837.1_3 Forward -296 -289 6.13563 0.25
NP_440160.1_2 Forward -317 -298 -0.39387 0.232
NP_442053.1_1 Forward -222 -213 4.32629 0.254
NP_440505.1_3 Forward -299 -289 4.50326 0.284
NP_442532.1_1 Reverse -362 -376 14.7781 0.215
NP_441699.1_7 Reverse -152 -171 2.55527 0.255
NP_441011.1_8 Reverse -289 -298 14.1594 0.0269
NP_441011.1_8 Forward -296 -287 5.99792 0.208
NP_442533.1_6 Forward -297 -288 12.5861 0.0277
NP_442533.1_6 Forward -232 -223 5.3096 0.145
NP_441482.1_7 Reverse -207 -221 -1.77037 0.0823
NP_441482.1_7 Reverse -282 -296 -1.96703 0.0913
NP_441482.1_7 Forward -228 -214 -10.8168 0.216
NP_439944.1_9 Forward -296 -286 6.07655 0.199
NP_441028.1_6 Reverse -89 -99 5.38779 0.255
NP_441028.1_6 Reverse -334 -344 5.19112 0.265
NP_442202.1_4 Forward -299 -285 12.8353 0.281
NP_440116.1_8 Reverse -289 -308 -10.1286 0.299
NP_441106.1_1 Forward -298 -289 8.45619 0.0548
NP_441106.1_3 Reverse -122 -141 17.699 0.078
NP_441825.1_4 Reverse -117 -127 10.9931 0.265
NP_441286.1_1 Forward -298 -286 -4.58258 0.165
NP_442674.1_2 Forward -211 -192 19.0757 0.12
NP_440886.1_7 Forward -223 -213 8.14104 0.0805
NP_440886.1_7 Forward -298 -288 7.84605 0.0827
NP_440886.1_7 Reverse -377 -387 4.99446 0.205
NP_440799.1_10 Reverse -164 -183 13.2741 0.267
NP_442072.1_9 Reverse -287 -305 -2.63579 0.0317
NP_440223.1_7 Forward -134 -120 11.8976 0.27
NP_440907.2_8 Reverse -289 -299 7.84605 0.117
NP_442264.1_2 Reverse -203 -220 7.41366 0.24
NP_441463.1_3 Forward -307 -288 -2.0655 0.149
NP_441463.1_3 Reverse -278 -297 -7.37537 0.257
NP_441626.1_2 Forward -296 -289 6.0373 0.212
NP_441626.1_2 Reverse -289 -296 5.93897 0.231
NP_442211.1_9 Reverse -22 -41 7.47261 0.164
NP_441962.1_4 Reverse -283 -302 -11.9969 0.25
NP_442020.1_1 Forward -116 -97 4.52188 0.25
NP_442020.1_1 Reverse -15 -34 -1.77127 0.299
NP_441193.1_3 Forward -31 -17 19.3708 0.258
NP_441993.1_1 Reverse -282 -301 0.777198 0.292
NP_440114.1_10 Reverse -345 -359 8.45605 0.202
NP_442357.1_8 Forward -129 -110 12.0942 0.241
NP_440287.1_6 Reverse -286 -305 12.8808 0.127
NP_440422.1_10 Forward -21 -2 6.24133 0.245
NP_442930.1_1 Reverse -199 -209 10.5993 0.276
NP_439910.1_2 Forward -305 -288 -21.889 0.195
NP_440457.1_1 Reverse -209 -221 14.002 0.0753
NP_440457.1_1 Reverse -219 -231 -0.256015 0.259
NP_440798.1_6 Reverse -289 -302 2.47756 0.17
NP_441332.1_6 Forward -223 -213 11.3563 0.261
NP_442509.1_9 Reverse -288 -298 6.56775 0.263
NP_442514.1_5 Forward -228 -209 -8.16275 0.285
NP_440554.1_4 Reverse -289 -299 4.3066 0.195
NP_441885.1_5 Forward -297 -287 0.668351 0.133
NP_442703.1_9 Reverse -1 -19 9.0656 0.244
NP_442341.1_7 Forward -223 -209 7.66941 0.0994
NP_442341.1_7 Forward -298 -284 5.40779 0.157
NP_441173.1_9 Reverse -90 -98 13.1954 0.184
NP_442395.2_3 Forward -353 -335 16.0471 0.274
NP_442395.2_4 Forward -298 -279 6.68515 0.144
NP_442395.2_9 Reverse -2 -18 12.3499 0.279
NP_443000.1_7 Reverse -286 -296 5.28991 0.136
NP_440275.1_3 Forward -299 -289 8.23984 0.0602
NP_440091.1_1 Forward -301 -289 17.1486 0.0153
NP_442591.1_7 Reverse -19 -38 10.5209 0.169
NP_440216.1_1 Reverse -288 -302 -3.44199 0.082
NP_440172.1_1 Forward -297 -287 15.713 0.00945
NP_442788.1_1 Reverse -258 -277 11.1109 0.248
NP_442015.1_10 Reverse -284 -297 1.59258 0.204
NP_442446.1_3 Forward -321 -302 10.5209 0.275
NP_441111.1_7 Reverse -289 -297 8.86921 0.0589
NP_441766.1_2 Forward -297 -288 8.25953 0.0612
NP_443052.1_8 Forward -307 -288 1.67108 0.0601
NP_441974.1_3 Forward -272 -255 16.8206 0.255
NP_440261.1_5 Reverse -289 -302 -10.9938 0.23
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTGCTGATACTCCAGAGGTAGCGGAAATTATCTTTTTAGCTCTAAAAGCAATTCCTACAGCGGAAAATACCATTTACCTAGATGTGCCAGAACCCAACCAAGCGGCGATCACTCTAGCAACGAAATATAGCCTGCAGGTAGTTTTTGAAACTGCTCGAATGTACACTGGGCAAGCCCCCTCCATCGCCCTAGATAAAATTTACGGAGTTACATCCTTTGAGTTAGGTTAACTTTTAAGTCCGGGTAAAATCCAAGTTTTCGTAAAGGATTGTGACAAAATCCCGCAAAACTGCAAAAATTCGTGGGGAAAAGTGATCCTACTTCCACACTTTGTGCATAGAATAAGGCAGTGAAACAGCCAGTCTGCGGGGATTTCAGGGGTTTTTAATGCCAAATTTCT

CDS

GTGTCTATCCGGGCTGTGGAGCCTCCCGATGACCCTGTTATGGGGAGAAAATGCCTAAAAAATGAGTCTATTCCAACAAACTCACTCTCAAGGAGATTTTTTCAGATGAATAAAGGCGAATTAGTCCATGCGGTCACGGACAAAGCGAAAGAGCAACTGGGGGAAAGCATCACTAAAAAGGAGGTAGATGCGGTAATTTCAGCCGCCATTGATTGCATCATGGAAGTGGTGGCCGAAGGGGAAAAAGTAACCCTAGTGGGCTTTGGTTCCTTTGAAGCCAGGGAACGTAAGGAACGGGAGGGCCGTAACCCCAAAACTGGGGATAAAATGCTCATTCCAGCCACTAAGGTGCCGGCTTTCTCCGCAGGCAAAATGTTCAAAGATAAAGTTGCTCCTGAGAAAAAATAA

Protein

MSIRAVEPPDDPVMGRKCLKNESIPTNSLSRRFFQMNKGELVHAVTDKAKEQLGESITKKEVDAVISAAIDCIMEVVAEGEKVTLVGFGSFEARERKEREGRNPKTGDKMLIPATKVPAFSAGKMFKDKVAPEKK