Your browser is old and dusty. Try Google Chrome!

Details for sll1689

ORF sll1689
Accession NP_441077.1
Symbol sigE,rpoD2-V
Category RNA synthesis, modification, and DNA transcription
Definition group2 RNA polymerase sigma factor SigE
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -153 -167 0.392915 0.211
NP_441418.1_1 Forward -258 -239 23.3474 0.0245
NP_442272.1_2 Forward -257 -238 11.1244 0.232
NP_441453.1_7 Forward -69 -62 12.9205 0.23
NP_441960.1_3 Forward -116 -97 15.4197 0.212
NP_441818.1_9 Forward -116 -97 -7.57203 0.272
NP_440226.1_1 Forward -328 -309 4.22769 0.199
NP_441098.1_3 Forward -259 -240 -6.59756 0.28
NP_441098.1_3 Forward -234 -215 -7.36319 0.288
NP_440996.1_3 Forward -390 -372 16.5388 0.129
NP_442173.1_1 Forward -100 -92 4.73931 0.258
NP_442752.1_4 Reverse -356 -363 4.26735 0.293
NP_442752.1_4 Forward -328 -321 4.26735 0.293
NP_443027.1_4 Reverse -354 -364 11.3864 0.107
NP_443027.1_4 Forward -330 -320 9.22315 0.172
NP_441812.1_3 Forward -329 -315 12.8809 0.189
NP_441812.1_3 Forward -360 -346 8.16106 0.254
NP_441812.1_3 Reverse -355 -369 8.06273 0.254
NP_441250.1_3 Reverse -214 -233 1.86774 0.283
NP_440061.1_3 Forward -142 -123 12.5858 0.235
NP_442062.1_3 Forward -257 -238 -1.96717 0.265
NP_442062.1_8 Reverse -356 -366 7.25653 0.104
NP_441859.1_3 Reverse -355 -374 3.24359 0.246
NP_440735.1_2 Reverse -174 -193 18.9882 0.275
NP_440044.1_8 Reverse -320 -339 11.5042 0.0497
NP_439918.1_2 Forward -198 -179 2.3594 0.207
NP_441208.1_9 Forward -116 -102 4.52282 0.299
NP_440132.1_1 Forward -367 -349 7.68896 0.295
NP_441546.1_1 Forward -131 -118 16.1456 0.278
NP_441083.1_5 Reverse -356 -366 -0.708283 0.276
NP_439957.1_5 Forward -285 -266 17.2074 0.13
NP_441434.1_1 Reverse -271 -285 11.1842 0.233
NP_441434.1_1 Forward -253 -239 7.65097 0.267
NP_440209.1_1 Forward -365 -357 5.0343 0.194
NP_441444.1_1 Forward -82 -63 5.01433 0.286
NP_442111.1_4 Forward -329 -315 5.30946 0.169
NP_442111.1_4 Reverse -112 -126 3.14618 0.253
NP_440851.1_6 Reverse -148 -165 1.61214 0.288
NP_440747.1_10 Reverse -353 -365 -11.6624 0.131
NP_442145.1_4 Reverse -239 -258 2.81659 0.299
NP_442634.1_4 Forward -367 -353 -3.83532 0.17
NP_440842.1_6 Reverse -115 -134 10.7167 0.278
NP_441014.1_10 Reverse -318 -337 6.88182 0.159
NP_442848.1_1 Forward -334 -320 -3.147 0.263
NP_441316.1_7 Forward -367 -352 -3.85501 0.296
NP_440376.1_1 Reverse -356 -365 0.0980582 0.285
NP_440376.1_1 Forward -365 -356 -0.000272808 0.285
NP_442687.1_7 Forward -366 -356 4.99491 0.225
NP_441077.1_2 Forward -351 -332 24.7797 0.0163
NP_441077.1_3 Forward -223 -204 20.0581 0.0955
NP_441077.1_4 Forward -92 -73 21.9273 0.0456
NP_441077.1_6 Forward -254 -238 17.2629 0.0933
NP_441077.1_6 Forward -253 -237 1.9342 0.293
NP_441077.1_7 Forward -28 -9 19.5673 0.12
NP_440642.1_10 Forward -40 -26 15.6336 0.119
NP_440642.1_10 Forward -72 -58 1.47397 0.293
NP_442496.1_5 Forward -353 -335 4.54237 0.289
NP_441414.1_9 Forward -328 -309 -3.93378 0.143
NP_440184.1_1 Reverse -3 -22 4.31171 0.227
NP_441958.1_5 Reverse -355 -365 2.04498 0.0554
NP_440203.1_5 Forward -362 -352 12.5659 0.146
NP_442690.1_1 Reverse -242 -261 -15.9302 0.282
NP_442911.1_2 Reverse -309 -328 -5.60541 0.163
NP_441099.1_5 Forward -171 -152 -7.86702 0.181
NP_441654.1_6 Reverse -269 -287 15.1852 0.229
NP_440809.1_9 Forward -374 -356 -7.749 0.225
NP_442567.1_3 Forward -91 -75 14.4149 0.183
NP_441294.1_7 Reverse -116 -130 9.25063 0.256
NP_441646.1_7 Forward -60 -46 15.2409 0.243
NP_442438.1_10 Reverse -159 -173 0.294584 0.232
NP_440377.1_1 Forward -245 -228 10.9838 0.293
NP_441175.1_7 Reverse -227 -246 7.57094 0.224
NP_441550.1_8 Forward -103 -93 5.58445 0.242
NP_441916.1_7 Forward -365 -355 5.87989 0.116
NP_441041.1_4 Forward -365 -346 -9.83364 0.223
NP_440569.1_7 Reverse -120 -139 9.93088 0.286
NP_442004.1_4 Reverse -325 -344 7.17681 0.299
NP_439966.1_7 Forward -367 -357 6.37109 0.185
NP_442941.1_3 Forward -364 -354 0.57002 0.199
NP_442941.1_3 Reverse -320 -330 0.57002 0.199
NP_442941.1_3 Reverse -357 -367 -0.806614 0.269
NP_440289.1_2 Forward -368 -355 -4.89726 0.294
NP_440983.1_5 Reverse -120 -139 8.65258 0.151
NP_440983.1_5 Forward -179 -160 -8.06369 0.294
NP_441076.1_3 Reverse -234 -253 12.3883 0.185
NP_440260.1_8 Forward -64 -46 0.21581 0.202
NP_442281.1_1 Forward -333 -319 2.65393 0.26
NP_441079.1_7 Reverse -268 -287 11.995 0.0814
NP_441079.1_7 Reverse -236 -255 -4.52452 0.25
NP_442288.1_3 Reverse -190 -207 5.44704 0.284
NP_442288.1_4 Forward -253 -239 17.4866 0.214
NP_441556.1_4 Forward -176 -157 11.0656 0.257
NP_441556.1_10 Forward -81 -67 13.0446 0.182
NP_441644.1_6 Forward -328 -318 3.71617 0.267
NP_443049.1_6 Forward -329 -319 13.0072 0.214
NP_440780.1_1 Forward -348 -329 8.06865 0.274
NP_442933.1_1 Reverse -332 -351 6.54077 0.266
NP_442933.1_10 Forward -365 -356 11.5045 0.042
NP_440576.1_10 Forward -62 -43 19.5664 0.174
NP_442671.1_2 Forward -333 -314 1.57835 0.232
NP_441751.2_8 Forward -364 -350 1.47456 0.104
NP_441751.2_8 Reverse -320 -334 -6.58858 0.273
NP_442970.1_3 Reverse -247 -265 15.7839 0.159
NP_442142.1_4 Reverse -353 -366 9.36014 0.0973
NP_442142.1_4 Forward -399 -386 2.57534 0.286
NP_442292.1_1 Reverse -320 -329 -0.786921 0.287
NP_440421.1_1 Forward -386 -372 21.1407 0.0178
NP_442301.1_2 Reverse -110 -129 12.29 0.159
NP_441715.1_4 Reverse -357 -367 6.56821 0.138
NP_440379.1_5 Forward -117 -98 -0.000545616 0.18
NP_441673.1_1 Reverse -356 -365 1.37636 0.114
NP_441673.1_1 Forward -365 -356 1.1797 0.163
NP_442757.1_7 Forward -114 -95 13.4708 0.201
NP_441426.1_1 Forward -110 -91 18.3873 0.161
NP_441637.1_9 Forward -90 -72 -0.570838 0.292
NP_441637.1_9 Forward -384 -366 -1.84914 0.292
NP_441637.1_9 Reverse -209 -227 -2.73412 0.292
NP_441764.1_8 Reverse -33 -43 11.5021 0.284
NP_441251.1_2 Forward -100 -82 8.96727 0.284
NP_441251.1_2 Reverse -206 -224 8.47561 0.291
NP_441612.1_2 Reverse -45 -55 9.03335 0.21
NP_442808.1_1 Forward -366 -356 7.55106 0.0756
NP_442903.1_2 Reverse -15 -34 3.10306 0.257
NP_440334.1_2 Reverse -30 -43 15.4572 0.212
NP_440334.1_2 Reverse -229 -242 14.8673 0.226
NP_442739.1_2 Forward -99 -80 13.2486 0.246
NP_442739.1_2 Reverse -229 -248 12.8642 0.246
NP_440558.1_2 Forward -64 -45 -3.83545 0.239
NP_441518.1_3 Forward -338 -319 -1.37718 0.11
NP_441557.1_5 Reverse -356 -365 0.491382 0.144
NP_441557.1_5 Forward -365 -356 0.29472 0.174
NP_440084.1_8 Forward -251 -237 14.5264 0.203
NP_440084.1_8 Forward -250 -236 11.8526 0.241
NP_441458.1_8 Forward -289 -270 4.11821 0.267
NP_441819.1_5 Reverse -367 -386 10.9334 0.261
NP_441819.1_5 Forward -336 -317 8.54611 0.295
NP_441467.1_10 Forward -89 -75 13.7659 0.222
NP_442347.1_2 Reverse -320 -329 14.5527 0.056
NP_442347.1_2 Forward -364 -355 5.40793 0.23
NP_442998.1_10 Forward -363 -356 5.93897 0.206
NP_442998.1_10 Reverse -321 -328 5.93897 0.206
NP_441799.1_1 Reverse -352 -366 4.03056 0.269
NP_441007.1_10 Reverse -314 -327 -0.177378 0.268
NP_442007.1_3 Reverse -267 -286 11.7983 0.259
NP_441296.1_9 Forward -304 -291 9.85179 0.276
NP_442069.1_6 Reverse -46 -65 8.55425 0.173
NP_442993.1_1 Reverse -356 -372 -9.77456 0.194
NP_440677.1_6 Forward -399 -380 7.37428 0.298
NP_441340.1_9 Reverse -33 -43 7.00193 0.297
NP_440586.1_8 Forward -327 -320 12.6251 0.0546
NP_440586.1_8 Reverse -357 -364 12.6251 0.0546
NP_442959.1_5 Forward -93 -74 8.35759 0.224
NP_440027.1_3 Reverse -51 -69 1.78836 0.295
NP_440027.1_4 Reverse -267 -286 0.846445 0.297
NP_443051.1_1 Reverse -355 -364 0.29472 0.195
NP_443039.1_7 Forward -305 -291 7.17714 0.19
NP_440770.1_3 Forward -391 -377 14.0609 0.288
NP_442663.1_1 Reverse -368 -387 1.47364 0.249
NP_442488.1_7 Reverse -366 -385 9.73422 0.273
NP_440210.1_10 Forward -47 -28 5.40686 0.296
NP_442384.1_10 Forward -365 -352 2.96921 0.206
NP_442384.1_10 Forward -113 -100 0.805932 0.278
NP_442114.1_8 Reverse -74 -88 10.422 0.234
NP_440163.1_10 Forward -203 -193 12.1731 0.167
NP_440344.1_10 Forward -372 -355 -7.23765 0.116
NP_441965.1_10 Forward -368 -352 3.99177 0.252
NP_442693.1_6 Reverse -98 -117 -1.08219 0.297
NP_442556.1_10 Forward -86 -67 8.54434 0.284
NP_440999.1_9 Forward -369 -355 -0.000409212 0.195
NP_442892.1_9 Forward -22 -8 13.6669 0.293
NP_440237.1_5 Reverse -330 -344 12.9786 0.2
NP_441543.1_2 Reverse -357 -366 13.5694 0.0248
NP_441918.1_7 Forward -397 -378 -3.44213 0.297
NP_442710.1_7 Forward -254 -235 10.5576 0.0963
NP_442315.1_3 Forward -340 -321 6.78429 0.233
NP_442337.1_8 Forward -71 -52 4.62101 0.21
NP_442578.1_7 Forward -327 -320 12.6255 0.0418
NP_442578.1_7 Reverse -357 -364 12.6255 0.0418
NP_440220.1_4 Reverse -79 -98 3.14526 0.226
NP_441462.1_2 Forward -365 -355 0.57002 0.144
NP_443062.1_6 Forward -373 -354 1.96607 0.264
NP_442204.1_1 Reverse -352 -363 -0.334653 0.295
NP_442780.1_3 Reverse -241 -260 10.4559 0.221
NP_442823.1_8 Forward -113 -94 13.0775 0.259
NP_440673.1_3 Forward -363 -356 10.1672 0.149
NP_440673.1_3 Reverse -321 -328 10.1672 0.149
NP_440718.1_1 Reverse -179 -198 16.0265 0.213
NP_441052.1_2 Reverse -356 -366 4.10993 0.166
NP_441052.1_2 Reverse -319 -329 -0.708283 0.294
NP_442219.1_9 Reverse -320 -329 4.71961 0.198
NP_441719.1_4 Forward -327 -320 3.77569 0.285
NP_441719.1_4 Reverse -357 -364 3.77569 0.285
NP_442813.1_4 Forward -78 -59 6.78429 0.173
NP_442366.1_3 Reverse -163 -181 -5.19239 0.284
NP_440129.1_10 Forward -397 -383 3.14618 0.228
NP_442873.1_3 Forward -177 -158 4.71854 0.262
NP_440296.1_10 Forward -132 -113 -13.9635 0.269
NP_441115.1_4 Reverse -355 -373 11.9164 0.123
NP_442694.1_4 Forward -60 -51 12.0944 0.268
NP_442515.1_1 Forward -329 -315 3.8345 0.112
NP_442515.1_1 Reverse -45 -59 -3.83532 0.298
NP_442515.1_1 Reverse -116 -130 -4.7203 0.298
NP_441982.1_6 Reverse -373 -382 11.7214 0.288
NP_442709.1_4 Reverse -235 -254 8.75086 0.161
NP_442689.1_8 Forward -385 -368 -5.27103 0.27
NP_442024.1_7 Reverse -220 -239 17.8131 0.233
NP_441409.1_6 Reverse -350 -369 -6.88371 0.14
NP_441409.1_6 Forward -371 -352 -14.4552 0.257
NP_440431.1_3 Reverse -367 -386 -9.14533 0.241
NP_442450.1_5 Forward -367 -357 5.19158 0.255
NP_440195.1_4 Forward -340 -321 11.4058 0.147
NP_442006.1_2 Forward -160 -143 -17.1691 0.27
NP_441570.1_1 Reverse -319 -337 -3.6191 0.072
NP_441078.1_4 Reverse -356 -365 0.393051 0.205
NP_441078.1_4 Forward -365 -356 -0.000272808 0.205
NP_442348.1_2 Forward -389 -380 7.17789 0.285
NP_440526.1_3 Reverse -121 -132 3.40144 0.267
NP_441432.1_8 Reverse -355 -364 4.22796 0.235
NP_441432.1_8 Forward -329 -320 4.22796 0.235
NP_441432.1_9 Forward -381 -368 9.85881 0.263
NP_440760.1_1 Forward -328 -309 -22.125 0.249
NP_440199.1_4 Forward -386 -368 14.8987 0.203
NP_440199.1_10 Forward -331 -321 14.9263 0.0861
NP_440913.1_3 Forward -179 -166 15.6539 0.215
NP_442400.1_10 Reverse -369 -382 18.5872 0.112
NP_442400.1_10 Reverse -10 -23 10.2794 0.261
NP_442489.1_7 Forward -365 -356 7.47288 0.0613
NP_442489.1_7 Reverse -356 -365 0.688044 0.152
NP_442079.1_7 Forward -364 -345 0.0977854 0.287
NP_441659.2_8 Forward -365 -355 1.455 0.24
NP_442749.1_5 Reverse -270 -287 9.7662 0.198
NP_440860.1_8 Reverse -317 -336 17.109 0.174
NP_441022.1_1 Forward -246 -237 11.5462 0.274
NP_442913.1_10 Reverse -310 -329 -2.26216 0.183
NP_440335.1_9 Reverse -5 -23 9.36059 0.298
NP_441856.1_3 Forward -368 -349 17.7974 0.0286
NP_440250.1_4 Reverse -324 -343 2.45694 0.288
NP_440459.1_2 Forward -208 -191 9.18362 0.233
NP_441593.1_8 Forward -287 -268 13.8641 0.232
NP_443040.1_1 Reverse -73 -87 17.2382 0.276
NP_443040.1_1 Forward -256 -242 10.4738 0.291
NP_441329.1_6 Reverse -21 -40 0.715766 0.249
NP_441329.1_6 Reverse -365 -384 -1.28956 0.292
NP_441329.1_6 Forward -264 -245 -1.95801 0.293
NP_441895.1_2 Forward -160 -141 -26.9432 0.275
NP_441112.1_8 Forward -235 -216 6.68596 0.207
NP_441112.1_8 Reverse -39 -58 5.11266 0.232
NP_442162.1_9 Forward -100 -93 5.93897 0.214
NP_440671.1_4 Forward -206 -192 8.25939 0.202
NP_442943.1_1 Reverse -370 -385 3.20132 0.283
NP_441609.1_1 Forward -244 -225 -1.18052 0.264
NP_441609.1_1 Forward -287 -268 -2.65548 0.291
NP_441813.1_9 Forward -386 -367 11.7008 0.256
NP_440821.1_4 Forward -367 -357 -0.41329 0.257
NP_441239.1_9 Forward -110 -98 7.61046 0.154
NP_442568.1_8 Reverse -369 -383 9.43936 0.257
NP_442568.1_8 Reverse -228 -242 8.65272 0.28
NP_441892.1_4 Forward -207 -188 -0.885524 0.28
NP_440665.1_1 Reverse -120 -139 4.12936 0.143
NP_442044.1_1 Reverse -99 -118 -10.0303 0.271
NP_441541.1_1 Reverse -240 -258 4.29912 0.171
NP_441617.1_8 Reverse -267 -286 14.3549 0.124
NP_442138.1_10 Reverse -319 -338 -5.9004 0.274
NP_440675.1_1 Forward -117 -98 8.65258 0.195
NP_440462.1_6 Reverse -354 -364 3.91327 0.224
NP_442465.1_9 Reverse -29 -43 9.83269 0.298
NP_440868.1_4 Forward -369 -357 -0.649339 0.28
NP_442479.1_9 Reverse -217 -236 -13.7669 0.29
NP_441848.1_4 Forward -261 -245 9.74698 0.275
NP_440696.1_3 Forward -65 -47 -1.35749 0.257
NP_442039.1_7 Reverse -230 -240 10.1081 0.257
NP_442273.1_5 Forward -239 -220 16.85 0.222
NP_442273.1_10 Reverse -227 -245 5.91901 0.288
NP_440753.1_2 Reverse -289 -308 19.764 0.0214
NP_442380.1_5 Forward -368 -349 15.7465 0.291
NP_442380.1_10 Reverse -287 -305 9.95058 0.26
NP_442837.1_3 Reverse -320 -327 9.87221 0.106
NP_442837.1_3 Forward -364 -357 9.87221 0.106
NP_442053.1_1 Forward -365 -356 6.5879 0.124
NP_441102.1_1 Reverse -357 -376 6.88262 0.235
NP_440520.1_1 Reverse -157 -176 -5.60541 0.294
NP_442533.1_6 Reverse -356 -365 4.91628 0.165
NP_443050.1_7 Reverse -97 -111 19.3708 0.206
NP_442232.1_1 Reverse -39 -58 -0.590531 0.298
NP_440854.1_1 Forward -261 -242 18.8592 0.0256
NP_441697.1_5 Reverse -235 -254 -9.50187 0.268
NP_441697.1_5 Reverse -236 -255 -10.5523 0.28
NP_442202.1_6 Reverse -369 -388 10.5209 0.178
NP_441527.1_4 Forward -263 -244 -4.05883 0.179
NP_441527.1_4 Reverse -6 -25 -4.91826 0.191
NP_441527.1_4 Reverse -7 -26 -6.8281 0.226
NP_441527.1_4 Reverse -74 -93 -9.88384 0.262
NP_441527.1_4 Reverse -68 -87 -11.8892 0.284
NP_441527.1_4 Reverse -23 -42 -12.0802 0.285
NP_441527.1_4 Forward -266 -247 -12.8441 0.294
NP_440115.1_6 Reverse -353 -363 4.60159 0.293
NP_441961.1_4 Forward -63 -44 7.66927 0.268
NP_439903.1_6 Forward -47 -28 2.75194 0.222
NP_442588.1_10 Forward -127 -108 17.0107 0.233
NP_440444.1_6 Forward -391 -378 17.1289 0.228
NP_441186.1_2 Reverse -47 -66 16.2241 0.242
NP_442674.1_1 Reverse -64 -83 11.0468 0.252
NP_440670.1_8 Forward -101 -92 10.2261 0.0437
NP_441930.1_2 Reverse -158 -168 13.4514 0.248
NP_442072.1_9 Forward -329 -311 -22.302 0.229
NP_441808.1_8 Forward -63 -44 6.68596 0.284
NP_440907.2_8 Forward -327 -317 4.89613 0.235
NP_441463.1_3 Reverse -358 -377 -3.73712 0.184
NP_442842.1_10 Forward -81 -62 0.174202 0.27
NP_442893.1_4 Reverse -234 -253 -3.14789 0.295
NP_441742.1_10 Reverse -125 -138 16.9329 0.267
NP_441431.1_2 Reverse -122 -136 6.98048 0.255
NP_442020.1_1 Reverse -369 -388 0.686995 0.255
NP_441193.1_1 Reverse -98 -117 9.34008 0.277
NP_441174.1_1 Forward -208 -193 15.2212 0.231
NP_440082.1_5 Forward -39 -20 15.2287 0.256
NP_440114.1_10 Forward -101 -87 6.29277 0.276
NP_440935.1_6 Reverse -239 -256 25.262 0.0197
NP_442090.1_2 Forward -240 -221 6.54077 0.281
NP_440766.1_5 Reverse -231 -243 6.98735 0.29
NP_440422.1_10 Forward -387 -368 11.9533 0.166
NP_442930.1_1 Reverse -280 -290 12.0743 0.242
NP_439910.1_2 Forward -373 -356 -13.1375 0.14
NP_439910.1_2 Reverse -348 -365 -22.6756 0.285
NP_440798.1_6 Reverse -93 -106 1.10092 0.234
NP_442680.1_5 Forward -258 -239 1.24451 0.248
NP_441984.1_3 Forward -112 -94 7.98396 0.239
NP_441845.1_5 Reverse -16 -35 17.1392 0.197
NP_441761.1_7 Forward -201 -182 20.1564 0.143
NP_440628.1_3 Reverse -234 -248 15.2409 0.27
NP_442703.1_1 Forward -258 -239 11.8883 0.208
NP_442703.1_1 Forward -351 -332 5.87233 0.276
NP_442341.1_9 Reverse -90 -104 6.58715 0.221
NP_441173.1_9 Reverse -222 -230 12.1137 0.21
NP_443000.1_7 Reverse -354 -364 4.89658 0.158
NP_443000.1_7 Forward -330 -320 4.50326 0.188
NP_440091.1_1 Forward -332 -320 3.67722 0.15
NP_441397.1_5 Forward -285 -269 23.3075 0.00635
NP_440679.1_10 Forward -64 -45 -13.2752 0.222
NP_441122.1_1 Forward -241 -226 3.71647 0.28
NP_442591.1_10 Reverse -339 -358 25.5024 0.00486
NP_442373.1_2 Forward -66 -47 -11.7019 0.297
NP_440216.1_9 Reverse -63 -72 6.39124 0.289
NP_441226.1_7 Reverse -126 -133 6.52862 0.253
NP_442116.1_6 Forward -262 -245 6.92756 0.271
NP_442403.1_8 Reverse -321 -340 1.67108 0.239
NP_442154.1_1 Forward -128 -110 -15.5171 0.22
NP_442226.1_8 Reverse -329 -339 14.828 0.256
NP_440261.1_5 Reverse -93 -106 -11.0921 0.237
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GTTTCACCAGGGCGGATTTTTTTGGCAATTTTAACGTTGATCGCCTTGAAATTAAGGAAAGCTGACAAAAATGGCGATCAAATCAAGTTTGTATCACGAATTACACTGCCGTGAAAATTTAACGATATTTTGGACAGATAGATATTAAAAAAAACTAAAGTTTTGCCATTTTTGGAAAATCAATGACACAATCTAGCCACGGGGACTGGTATCTGGTTCTGGAACACCACTACCGCAGTGCGCATAGCTGAAAGTGGAGAGCCTTAACCGTTGGGGTGGTCTATCTGGATGATGCTCTGGCCGATTGGATAATTTCTGGTTGTTTTCTGTTTCCTTGGGTGGCCTTGTTGTTGCCACATCTTTTCCTTTCTCGATTGTTTCCGTTTAGTTTTTTCAACCT

CDS

ATGAGCGATATGTCTTCCCTCTCCACCCCCAACACCAGTGCCGTTGACCAATGGCAGGCTTTGGATGGCCTCGCTGATGGCCAGGCGATCGCCAATGATGACCCTCCGGCGATCGAAGTCACCCTGGGAGATGGCCAACAAGGAAGTTTTAATAAAGCAGTAAGTGAAGACACTGTGGGGGCTTTTTTTAAAGAAATGGCCCGCTATCCCCTCCTGAGTGCCGCCGAAGAAGTGGAATTGGCTAGACAAATCCGATTGTTGGTCAGCGCAGAAGATGTTAGACAACAACTCACCCAACAACTGGAACGAACGCCTTCCCTCCAGGAGTGGGGGCAAGCCCTAGAATTTCCCCAGGTCAGACAATTTGAGATTTGGCTTTATCAACTGCGGGCTGCCAAACGACGGATGATCCGCTCCAATCTCCGCCTAGTGGTTTCCATTGCCAAGCGTTACCTCAACCGTGGTGTTCCCTTCCTCGACCTGATCCAAGAAGGGGCGATCGGTCTCAACCGAGCCGCAGAAAAGTTTGATCCCGATAAAGGTTATAAATTTTCCACCTATGCCTACTGGTGGATCCGCCAGGCCATCACCCGCACCATTGCCAATGACGCTCGCACCATTCGTTTGCCCATCCATGTGGTGGAAAAGCTCAACAAAATCAAGAAAGCCCAACGCAGTCTCAAGCAGGAATTGAAGCGCAATCCCAACGAAGGGGAATTGGCCGCTGCTTTGGACATTACCCCTGCCCAACTAAGACAATTACTGCAATTGCGTCGTCAGTCCCTGTCCTTAAACCATCGGGTAGGCAAAGGGGAAGACACCGAGTTGGTAGATCTACTAGAAGATCAACAACTGCAGTTGCCGGAGGATTTGATGAATGAATCCATGTTGCGGCGGGAAATTGTCGAAGTATTGGCCGAGGTACTAACGGAACGGGAAATGGAAGTGATTTGTCTGCGCTACGGCATTGCCAGCCACCAAAGTTACACCCTTGAGGAAGTGGGCAATATGTTTAATCTTTCCCGGGAAAGGGTTAGACAAATCCAAAGCAAAGCCATGCGGAAACTCCGTCGTCCCCAAGTGGCCCGCCGCCTCAAAGGTTGGTTATAG

Protein

MSDMSSLSTPNTSAVDQWQALDGLADGQAIANDDPPAIEVTLGDGQQGSFNKAVSEDTVGAFFKEMARYPLLSAAEEVELARQIRLLVSAEDVRQQLTQQLERTPSLQEWGQALEFPQVRQFEIWLYQLRAAKRRMIRSNLRLVVSIAKRYLNRGVPFLDLIQEGAIGLNRAAEKFDPDKGYKFSTYAYWWIRQAITRTIANDARTIRLPIHVVEKLNKIKKAQRSLKQELKRNPNEGELAAALDITPAQLRQLLQLRRQSLSLNHRVGKGEDTELVDLLEDQQLQLPEDLMNESMLRREIVEVLAEVLTEREMEVICLRYGIASHQSYTLEEVGNMFNLSRERVRQIQSKAMRKLRRPQVARRLKGWL