Your browser is old and dusty. Try Google Chrome!

Details for sll1574

ORF sll1574
Accession NP_440556.1
Symbol spkA'
Category a part of spkA: serine/threonine protein kinase, regulates cellular motility ( disrupted by frameshift mutation)
Definition Regulatory functions
Regulatory function Yes
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -201 -187 7.57108 0.101
NP_441061.1_2 Forward -207 -193 5.01447 0.142
NP_441061.1_7 Forward -325 -306 13.2741 0.282
NP_440795.1_3 Reverse -254 -273 12.585 0.224
NP_440795.1_7 Forward -207 -200 14.6904 0.0123
NP_440795.1_7 Reverse -200 -207 14.6904 0.0123
NP_440795.1_7 Reverse -23 -30 9.77388 0.169
NP_441418.1_6 Forward -208 -189 -29.1065 0.216
NP_442291.1_5 Reverse -59 -75 14.6115 0.0235
NP_442291.1_5 Forward -209 -193 0.0585348 0.174
NP_441453.1_4 Reverse -199 -207 16.539 0.00633
NP_441453.1_4 Forward -208 -200 16.539 0.00633
NP_442151.1_6 Forward -208 -194 19.4691 0.0045
NP_442151.1_6 Reverse -199 -213 16.9125 0.013
NP_441818.1_1 Forward -207 -196 9.79292 0.232
NP_442169.1_1 Forward -85 -66 -2.36049 0.274
NP_441630.1_3 Reverse -191 -210 5.99764 0.134
NP_442744.1_8 Reverse -199 -218 -6.78538 0.297
NP_442173.1_1 Forward -207 -199 15.4574 0.00633
NP_442173.1_1 Reverse -200 -208 15.4574 0.00633
NP_442752.1_4 Forward -208 -201 13.8055 0.0199
NP_442752.1_4 Reverse -199 -206 13.8055 0.0199
NP_442752.1_4 Forward -69 -62 5.34899 0.221
NP_443027.1_4 Forward -210 -200 7.25653 0.24
NP_443027.1_4 Forward -71 -61 6.8632 0.262
NP_441812.1_3 Forward -387 -373 8.65272 0.251
NP_442975.1_10 Forward -212 -198 10.8154 0.0516
NP_442975.1_10 Reverse -195 -209 10.5204 0.0541
NP_440784.1_7 Forward -207 -200 15.9687 0.0123
NP_440784.1_7 Reverse -200 -207 15.9687 0.0123
NP_442909.1_7 Forward -207 -193 11.602 0.131
NP_440061.1_9 Forward -210 -196 11.897 0.105
NP_440061.1_9 Reverse -58 -72 9.83206 0.137
NP_439979.1_2 Forward -331 -312 5.89931 0.292
NP_442062.1_8 Forward -208 -198 17.3846 0.00193
NP_442062.1_8 Reverse -199 -209 10.3048 0.0493
NP_442062.1_8 Forward -69 -59 8.82982 0.0709
NP_440304.1_4 Forward -210 -200 10.8948 0.051
NP_440304.1_4 Reverse -197 -207 1.84832 0.299
NP_442242.1_4 Forward -207 -200 14.3954 0.0124
NP_442242.1_4 Reverse -200 -207 14.3954 0.0124
NP_440044.1_8 Forward -207 -188 0.687771 0.193
NP_441208.1_1 Forward -81 -62 -4.13045 0.262
NP_441208.1_9 Reverse -196 -210 8.65272 0.219
NP_441594.1_6 Reverse -190 -209 2.75272 0.244
NP_441594.1_6 Forward -217 -198 1.47442 0.268
NP_442110.1_7 Forward -208 -194 9.63603 0.0715
NP_442110.1_7 Reverse -199 -213 3.53951 0.21
NP_440856.1_5 Forward -321 -302 12.6841 0.0988
NP_441083.1_5 Forward -208 -198 20.3345 0.00053
NP_441083.1_5 Reverse -199 -209 11.2881 0.0159
NP_442827.1_8 Reverse -191 -210 3.04693 0.152
NP_441738.1_2 Forward -206 -199 15.28 0.0102
NP_441738.1_2 Reverse -201 -208 15.28 0.0102
NP_441738.1_2 Reverse -62 -69 8.00357 0.235
NP_441558.1_5 Reverse -197 -216 4.32602 0.283
NP_441558.1_5 Forward -261 -242 3.73603 0.299
NP_440209.1_1 Reverse -199 -207 18.1123 0.00295
NP_440209.1_1 Forward -208 -200 18.1123 0.00295
NP_442889.1_8 Forward -211 -197 9.43874 0.0989
NP_441713.1_1 Forward -214 -195 -6.49039 0.12
NP_441716.1_1 Forward -208 -194 6.6861 0.191
NP_441716.1_1 Reverse -199 -213 3.8345 0.259
NP_442111.1_4 Reverse -198 -212 20.3541 0.00311
NP_442111.1_4 Forward -209 -195 7.07942 0.105
NP_441624.1_7 Reverse -187 -201 9.93102 0.217
NP_441163.1_1 Reverse -191 -208 7.3146 0.245
NP_441163.1_1 Forward -321 -304 6.3313 0.26
NP_440906.1_5 Forward -207 -200 15.8704 0.0124
NP_440906.1_5 Reverse -200 -207 15.8704 0.0124
NP_440906.1_5 Forward -162 -155 5.64398 0.292
NP_440747.1_10 Forward -211 -199 15.2803 0.0019
NP_440747.1_10 Reverse -196 -208 14.9853 0.00221
NP_442973.1_5 Reverse -190 -209 13.1758 0.179
NP_441486.1_1 Reverse -196 -210 15.4376 0.00596
NP_441486.1_1 Forward -211 -197 6.19444 0.0344
NP_441486.1_1 Reverse -57 -71 -5.70361 0.254
NP_442634.1_4 Reverse -197 -211 -1.27871 0.149
NP_441667.1_5 Forward -362 -348 18.2592 0.217
NP_440403.1_10 Forward -217 -198 2.16274 0.281
NP_441014.1_10 Forward -230 -211 0.785326 0.238
NP_442848.1_1 Reverse -193 -207 -0.590395 0.263
NP_442848.1_1 Reverse -54 -68 -4.52363 0.294
NP_441012.1_4 Forward -164 -151 6.70579 0.276
NP_443018.1_3 Forward -207 -200 14.8871 0.0123
NP_443018.1_3 Reverse -200 -207 14.8871 0.0123
NP_443018.1_3 Reverse -314 -321 8.49558 0.141
NP_440376.1_1 Forward -208 -199 19.4693 0.000692
NP_440376.1_1 Reverse -199 -208 19.4693 0.000692
NP_441588.1_4 Forward -206 -196 8.92815 0.14
NP_441588.1_4 Reverse -201 -211 7.05986 0.178
NP_442730.1_8 Reverse -191 -210 5.50519 0.248
NP_442687.1_7 Forward -209 -199 9.02648 0.0994
NP_442687.1_7 Reverse -198 -208 8.92815 0.0994
NP_442687.1_7 Reverse -168 -178 6.07655 0.179
NP_441797.1_7 Forward -239 -221 10.9339 0.286
NP_441846.1_10 Forward -271 -252 -12.2919 0.19
NP_441846.1_10 Forward -269 -250 -22.42 0.259
NP_442958.1_3 Reverse -188 -207 6.29264 0.192
NP_440642.1_3 Reverse -237 -256 17.6007 0.149
NP_441422.1_3 Forward -369 -350 14.7095 0.264
NP_442658.1_1 Forward -210 -200 13.0576 0.04
NP_442658.1_1 Reverse -225 -235 8.14104 0.199
NP_442658.1_1 Reverse -197 -207 6.76441 0.214
NP_442782.1_2 Forward -259 -245 6.3911 0.226
NP_440184.1_7 Forward -187 -168 13.7008 0.28
NP_442937.1_5 Reverse -188 -207 10.5209 0.158
NP_441958.1_5 Forward -209 -199 21.2195 0.000805
NP_441958.1_5 Reverse -198 -208 12.2714 0.00183
NP_442836.1_5 Reverse -193 -212 0.982764 0.289
NP_440203.1_5 Reverse -202 -212 13.4509 0.115
NP_440203.1_5 Forward -205 -195 13.3526 0.116
NP_440984.1_7 Reverse -194 -208 11.6026 0.122
NP_440984.1_7 Reverse -317 -331 4.91614 0.281
NP_439990.1_5 Forward -213 -200 17.6205 0.0221
NP_440153.1_5 Forward -207 -193 12.4876 0.0645
NP_441941.1_9 Forward -136 -117 4.22769 0.219
NP_443055.1_6 Reverse -185 -203 5.22993 0.179
NP_443055.1_6 Forward -222 -204 4.83661 0.181
NP_440934.1_1 Reverse -185 -204 4.42435 0.262
NP_440496.1_1 Forward -389 -370 2.16274 0.269
NP_441099.1_5 Forward -218 -199 -8.752 0.203
NP_441099.1_5 Reverse -189 -208 -9.63698 0.229
NP_441294.1_7 Reverse -195 -209 13.6661 0.0583
NP_441294.1_7 Forward -212 -198 9.15464 0.256
NP_441646.1_1 Reverse -243 -262 2.94938 0.211
NP_441646.1_1 Forward -215 -196 0.0977854 0.254
NP_442438.1_10 Reverse -194 -208 8.35772 0.0782
NP_442438.1_10 Reverse -314 -328 2.45787 0.176
NP_440147.1_4 Forward -210 -197 12.999 0.0326
NP_440147.1_4 Reverse -197 -210 10.8357 0.0353
NP_441550.1_8 Forward -210 -200 15.3192 0.0132
NP_441550.1_8 Reverse -197 -207 14.6309 0.0132
NP_441916.1_7 Reverse -199 -209 18.9579 0.00144
NP_441916.1_7 Forward -208 -198 10.3048 0.0261
NP_441916.1_10 Forward -216 -197 8.65258 0.167
NP_441041.1_4 Reverse -199 -218 -2.26216 0.109
NP_441041.1_4 Reverse -193 -212 -6.58872 0.169
NP_441041.1_7 Forward -211 -199 14.4144 0.0348
NP_442004.1_6 Forward -208 -194 8.75105 0.14
NP_442004.1_6 Reverse -199 -213 3.8345 0.231
NP_441725.1_4 Forward -213 -199 3.93223 0.278
NP_441725.1_5 Forward -207 -197 2.04498 0.115
NP_441725.1_5 Reverse -200 -210 1.94665 0.115
NP_439966.1_7 Reverse -197 -207 7.25606 0.15
NP_439966.1_7 Forward -210 -200 6.27276 0.185
NP_442941.1_3 Forward -207 -197 11.0914 0.0116
NP_442941.1_3 Reverse -200 -210 11.0914 0.0116
NP_442941.1_3 Forward -68 -58 5.38824 0.115
NP_440289.1_2 Forward -211 -198 -4.89726 0.294
NP_440983.1_9 Reverse -73 -92 0.392778 0.292
NP_440260.1_8 Forward -217 -199 -0.177514 0.206
NP_441514.1_6 Forward -260 -253 14.2971 0.248
NP_441678.1_9 Forward -80 -61 -0.197208 0.225
NP_442281.1_1 Forward -213 -199 9.53707 0.0685
NP_442281.1_1 Reverse -194 -208 8.94708 0.0747
NP_442256.1_2 Forward -210 -192 -7.06068 0.214
NP_440437.1_1 Forward -214 -195 -3.3438 0.234
NP_442012.1_1 Reverse -193 -212 1.47442 0.215
NP_442012.1_1 Forward -214 -195 -0.688862 0.265
NP_441556.1_10 Reverse -194 -208 17.8141 0.0841
NP_440498.1_1 Forward -217 -199 -1.94747 0.235
NP_443030.1_4 Forward -214 -195 0.196116 0.222
NP_441644.1_6 Reverse -199 -209 19.0557 0.000803
NP_441644.1_6 Forward -208 -198 17.3841 0.00127
NP_441644.1_6 Reverse -22 -32 5.38779 0.194
NP_440867.1_10 Forward -223 -204 6.88262 0.251
NP_442215.1_2 Forward -210 -194 9.00665 0.0605
NP_442215.1_2 Reverse -197 -213 8.515 0.0643
NP_442215.1_2 Forward -231 -215 -5.15301 0.246
NP_442215.1_2 Forward -244 -228 -5.93965 0.262
NP_442215.1_2 Reverse -190 -206 -7.41462 0.294
NP_442029.1_6 Reverse -194 -213 8.25926 0.208
NP_440929.1_8 Forward -208 -199 19.2726 0.000701
NP_440929.1_8 Reverse -199 -208 19.2726 0.000701
NP_440469.1_8 Forward -145 -126 11.4058 0.271
NP_442933.1_10 Forward -208 -199 17.601 0.00325
NP_442933.1_10 Reverse -199 -208 17.601 0.00325
NP_442933.1_10 Reverse -60 -69 5.3096 0.203
NP_441751.2_8 Reverse -200 -214 7.37441 0.0339
NP_441751.2_8 Reverse -61 -75 -5.70361 0.231
NP_442554.1_8 Reverse -200 -210 16.4013 0.0065
NP_442554.1_8 Forward -207 -197 15.3197 0.00882
NP_442554.1_8 Forward -201 -191 3.32329 0.23
NP_442075.1_3 Reverse -167 -186 14.3558 0.279
NP_442970.1_1 Forward -49 -35 9.46532 0.272
NP_441762.1_7 Forward -209 -197 0.530633 0.0747
NP_441762.1_7 Reverse -198 -210 0.333971 0.0747
NP_441762.1_7 Forward -28 -16 -5.86088 0.246
NP_442142.1_4 Forward -211 -198 11.6217 0.054
NP_442142.1_4 Reverse -310 -323 5.52525 0.188
NP_442142.1_4 Reverse -15 -28 4.34528 0.223
NP_442142.1_4 Reverse -196 -209 3.65697 0.248
NP_442142.1_4 Reverse -151 -164 3.36198 0.258
NP_442292.1_1 Forward -207 -198 18.486 0.00229
NP_442292.1_1 Reverse -200 -209 17.5026 0.00435
NP_442016.1_10 Forward -381 -362 4.916 0.277
NP_440895.1_6 Forward -214 -201 10.7374 0.202
NP_441523.1_6 Forward -212 -193 11.9958 0.161
NP_441523.1_6 Reverse -195 -214 7.37428 0.198
NP_443009.1_5 Reverse -198 -209 14.5128 0.02
NP_443009.1_5 Forward -209 -198 10.1862 0.0792
NP_443009.1_5 Reverse -127 -138 6.54802 0.157
NP_442301.1_2 Reverse -312 -331 4.12856 0.284
NP_441715.1_4 Forward -207 -197 7.94484 0.107
NP_441715.1_4 Reverse -200 -210 7.35486 0.108
NP_441198.1_5 Forward -206 -193 12.2117 0.228
NP_441198.1_8 Forward -210 -200 12.783 0.116
NP_440464.1_10 Forward -207 -197 13.0082 0.169
NP_441468.1_1 Forward -207 -200 15.8704 0.0124
NP_441468.1_1 Reverse -200 -207 15.8704 0.0124
NP_441015.1_10 Forward -213 -194 -0.0988766 0.168
NP_441673.1_1 Forward -208 -199 20.8459 0.000698
NP_441673.1_1 Reverse -199 -208 20.8459 0.000698
NP_441826.1_2 Reverse -193 -207 14.8476 0.0196
NP_441826.1_2 Forward -214 -200 -1.96703 0.261
NP_441826.1_2 Forward -235 -221 -4.62196 0.298
NP_442868.1_6 Reverse -197 -207 9.81313 0.038
NP_442868.1_6 Forward -210 -200 0.963343 0.205
NP_442719.1_2 Forward -187 -169 -11.3879 0.291
NP_441251.1_8 Reverse -171 -184 15.627 0.254
NP_441056.1_6 Forward -268 -249 14.3558 0.247
NP_441612.1_2 Forward -208 -198 8.54929 0.21
NP_442808.1_1 Forward -209 -199 8.73102 0.0481
NP_442808.1_1 Reverse -198 -208 8.63269 0.0481
NP_442808.1_1 Forward -92 -82 2.43787 0.266
NP_440145.1_3 Forward -218 -199 17.404 0.00972
NP_442542.1_9 Forward -202 -188 5.40719 0.264
NP_442113.1_10 Reverse -174 -193 -9.14533 0.294
NP_442050.1_5 Forward -210 -200 9.22267 0.193
NP_442050.1_5 Reverse -58 -68 8.63269 0.223
NP_442050.1_5 Reverse -197 -207 7.64939 0.243
NP_442342.1_4 Forward -102 -83 11.6025 0.283
NP_442342.1_9 Reverse -197 -213 2.12349 0.29
NP_440334.1_2 Reverse -228 -241 15.5556 0.203
NP_441114.1_3 Forward -234 -225 13.2744 0.231
NP_440558.1_2 Forward -217 -198 0.0977854 0.194
NP_440558.1_2 Reverse -118 -137 -5.31042 0.256
NP_441878.1_6 Forward -209 -199 10.5014 0.0176
NP_441878.1_6 Reverse -198 -208 10.4031 0.0176
NP_441036.1_8 Forward -209 -199 15.713 0.00724
NP_441036.1_8 Reverse -17 -27 9.32148 0.174
NP_441036.1_8 Reverse -198 -208 8.33817 0.174
NP_442650.1_2 Forward -208 -194 6.19444 0.134
NP_442650.1_2 Forward -328 -314 3.14618 0.217
NP_441557.1_5 Forward -208 -199 19.9609 0.000699
NP_441557.1_5 Reverse -199 -208 19.9609 0.000699
NP_441520.1_8 Reverse -223 -242 16.4207 0.0951
NP_442066.2_4 Forward -208 -189 0.196116 0.172
NP_442066.2_4 Forward -31 -12 -2.75381 0.215
NP_442066.2_4 Reverse -199 -218 -6.68705 0.254
NP_442777.1_3 Reverse -71 -89 5.32826 0.26
NP_442830.1_5 Reverse -248 -262 4.32555 0.239
NP_442166.1_7 Reverse -200 -214 8.94771 0.21
NP_442347.1_2 Forward -207 -198 12.4878 0.056
NP_442347.1_2 Reverse -61 -70 5.99792 0.201
NP_442347.1_2 Reverse -200 -209 3.34298 0.284
NP_442645.1_2 Reverse -191 -210 -15.1435 0.19
NP_442645.1_2 Forward -216 -197 -15.5368 0.203
NP_441037.1_4 Forward -210 -200 15.0168 0.028
NP_441037.1_4 Reverse -197 -207 7.9999 0.237
NP_442594.1_7 Reverse -188 -207 6.88182 0.196
NP_442594.1_8 Forward -267 -248 2.16274 0.295
NP_441633.1_2 Forward -132 -117 20.1377 0.0593
NP_441633.1_3 Reverse -197 -210 1.10092 0.109
NP_441633.1_3 Reverse -123 -136 1.10092 0.109
NP_441633.1_3 Forward -210 -197 -5.97891 0.236
NP_440136.1_2 Forward -207 -200 15.9687 0.0123
NP_440136.1_2 Reverse -200 -207 15.9687 0.0123
NP_440136.1_2 Forward -68 -61 3.97235 0.288
NP_442590.1_10 Reverse -193 -212 5.70265 0.258
NP_442590.1_10 Forward -208 -189 4.81767 0.27
NP_442998.1_10 Forward -206 -199 15.5754 0.0102
NP_442998.1_10 Reverse -201 -208 15.5754 0.0102
NP_440899.1_1 Reverse -221 -240 12.7991 0.145
NP_440299.1_1 Reverse -195 -208 19.9798 0.00161
NP_440299.1_1 Forward -212 -199 13.195 0.0319
NP_441799.1_1 Reverse -195 -209 11.7003 0.054
NP_441799.1_1 Forward -212 -198 10.0287 0.0797
NP_441799.1_4 Reverse -314 -333 -6.68705 0.283
NP_441007.1_10 Reverse -194 -207 -0.669033 0.287
NP_442201.1_10 Reverse -188 -207 3.34271 0.0961
NP_440256.1_1 Forward -211 -192 0.884433 0.0791
NP_440256.1_1 Forward -127 -108 -9.24366 0.275
NP_440087.1_1 Reverse -116 -135 -9.63698 0.297
NP_441512.1_4 Forward -212 -193 8.35759 0.264
NP_441559.1_8 Forward -213 -199 10.6193 0.0574
NP_441559.1_8 Reverse -194 -208 -6.88358 0.281
NP_440915.1_6 Reverse -195 -209 5.01447 0.0943
NP_440915.1_6 Forward -212 -198 3.73617 0.1
NP_442785.1_7 Forward -210 -196 17.6008 0.0996
NP_441704.1_8 Reverse -188 -207 8.94676 0.199
NP_442866.1_1 Reverse -93 -112 1.0811 0.165
NP_440748.1_5 Forward -128 -109 -2.26216 0.273
NP_442453.1_6 Forward -94 -80 15.3055 0.286
NP_441199.1_6 Reverse -195 -214 3.04771 0.189
NP_442993.1_1 Reverse -199 -215 0.55019 0.0631
NP_440677.1_1 Forward -217 -198 17.3057 0.0932
NP_442386.1_9 Reverse -198 -207 13.8639 0.0289
NP_442386.1_9 Forward -209 -200 6.39082 0.219
NP_441340.1_5 Forward -207 -200 15.6737 0.0124
NP_441340.1_5 Reverse -200 -207 15.6737 0.0124
NP_440327.1_6 Reverse -181 -200 6.39097 0.239
NP_442714.1_5 Reverse -149 -168 1.67108 0.238
NP_440586.1_8 Forward -207 -200 13.2151 0.026
NP_440586.1_8 Reverse -200 -207 13.2151 0.026
NP_442251.1_6 Forward -207 -200 15.2804 0.0124
NP_442251.1_6 Reverse -200 -207 15.2804 0.0124
NP_440684.1_9 Reverse -193 -207 10.521 0.195
NP_441262.1_3 Reverse -199 -206 14.7888 0.0223
NP_441262.1_3 Forward -208 -201 14.7888 0.0223
NP_440027.1_3 Forward -137 -119 3.95163 0.263
NP_443051.1_1 Forward -209 -200 19.5676 0.00335
NP_443051.1_1 Reverse -198 -207 10.4228 0.00754
NP_439937.1_9 Forward -209 -192 -15.9897 0.287
NP_440408.1_3 Reverse -371 -390 -6.09707 0.295
NP_440408.1_7 Forward -208 -189 17.3057 0.111
NP_440439.1_1 Reverse -196 -209 2.2809 0.136
NP_440439.1_1 Forward -211 -198 2.08423 0.138
NP_440439.1_1 Forward -262 -249 1.59258 0.148
NP_440439.1_1 Reverse -15 -28 -2.04567 0.293
NP_439943.1_7 Reverse -194 -213 2.16274 0.299
NP_440372.1_2 Forward -207 -200 16.3621 0.0124
NP_440372.1_2 Reverse -200 -207 16.3621 0.0124
NP_441789.1_7 Reverse -308 -327 -5.60616 0.299
NP_441803.1_2 Forward -213 -194 11.7992 0.0675
NP_441572.1_7 Forward -214 -195 -2.55715 0.197
NP_442384.1_10 Forward -208 -195 18.9972 0.00338
NP_442384.1_10 Reverse -199 -212 15.4572 0.00986
NP_442384.1_10 Forward -134 -121 2.47756 0.224
NP_440364.1_6 Reverse -186 -199 16.0466 0.275
NP_441018.1_7 Reverse -189 -208 6.98095 0.278
NP_442790.1_4 Reverse -190 -209 -10.1286 0.201
NP_442262.1_10 Forward -207 -200 14.1988 0.0123
NP_442262.1_10 Reverse -200 -207 14.1988 0.0123
NP_442262.1_10 Reverse -314 -321 8.59391 0.22
NP_441689.1_5 Reverse -58 -68 12.4676 0.132
NP_441689.1_5 Forward -210 -200 8.3377 0.132
NP_441689.1_5 Reverse -197 -207 5.78111 0.197
NP_440344.1_10 Forward -215 -198 -7.63097 0.118
NP_440344.1_10 Reverse -11 -28 -12.4492 0.254
NP_440531.1_6 Reverse -191 -210 -0.983855 0.226
NP_442917.1_8 Forward -188 -169 14.4541 0.245
NP_442910.1_8 Reverse -172 -191 15.0441 0.177
NP_440562.1_3 Reverse -200 -217 13.2152 0.0758
NP_441965.1_3 Reverse -189 -208 8.65258 0.121
NP_441965.1_10 Reverse -196 -212 2.41848 0.288
NP_440297.1_9 Forward -207 -197 -0.118297 0.282
NP_440297.1_9 Reverse -200 -210 -0.216628 0.282
NP_441592.1_4 Reverse -199 -218 4.81767 0.144
NP_441592.1_4 Reverse -313 -332 2.94938 0.186
NP_441103.1_9 Reverse -252 -262 14.3451 0.216
NP_440894.1_10 Forward -213 -194 3.53937 0.271
NP_440999.1_9 Forward -212 -198 3.34284 0.131
NP_440999.1_9 Reverse -195 -209 -0.295402 0.203
NP_440888.1_2 Forward -208 -194 12.6836 0.0405
NP_440888.1_2 Reverse -250 -264 9.04542 0.139
NP_440888.1_2 Reverse -307 -321 8.45543 0.16
NP_440888.1_2 Reverse -199 -213 7.17714 0.205
NP_440888.1_2 Reverse -186 -200 5.30886 0.284
NP_440600.1_4 Reverse -191 -209 14.7688 0.0557
NP_441748.1_3 Forward -369 -350 15.029 0.221
NP_442277.1_4 Reverse -190 -209 1.57197 0.272
NP_442033.1_10 Reverse -197 -216 -8.45701 0.199
NP_441543.1_2 Forward -207 -198 16.9127 0.00359
NP_441543.1_2 Reverse -200 -209 15.9293 0.00518
NP_442845.1_2 Reverse -193 -207 15.6342 0.0694
NP_442845.1_2 Forward -214 -200 12.0943 0.116
NP_442845.1_2 Forward -208 -194 7.37441 0.195
NP_441469.1_8 Forward -209 -200 6.5879 0.227
NP_441469.1_8 Reverse -198 -207 6.48957 0.227
NP_442315.1_5 Forward -262 -252 15.8113 0.3
NP_443064.1_6 Forward -208 -198 12.5669 0.0796
NP_443064.1_6 Reverse -199 -209 10.8217 0.13
NP_442578.1_7 Forward -207 -200 14.5921 0.026
NP_442578.1_7 Reverse -200 -207 14.5921 0.026
NP_442578.1_7 Reverse -167 -174 6.72562 0.18
NP_441462.1_2 Reverse -199 -209 20.2362 0.000805
NP_441462.1_2 Forward -208 -198 11.5831 0.00406
NP_441621.1_7 Reverse -197 -211 -5.21195 0.248
NP_443062.1_1 Forward -241 -223 4.35311 0.264
NP_442204.1_1 Forward -212 -201 18.2499 0.0189
NP_442204.1_1 Reverse -195 -206 6.94184 0.144
NP_442204.1_5 Reverse -189 -208 1.96607 0.221
NP_441560.1_8 Forward -213 -194 12.6814 0.248
NP_440516.1_2 Forward -214 -196 14.0805 0.0538
NP_440516.1_2 Reverse -193 -211 -2.83245 0.299
NP_440516.1_8 Forward -208 -199 16.9127 0.00442
NP_440516.1_8 Reverse -199 -208 16.9127 0.00442
NP_442428.1_5 Forward -207 -200 15.8704 0.0124
NP_442428.1_5 Reverse -200 -207 15.8704 0.0124
NP_440673.1_3 Forward -206 -199 12.4288 0.0426
NP_440673.1_3 Reverse -201 -208 12.4288 0.0426
NP_440673.1_3 Forward -57 -50 9.08556 0.202
NP_440673.1_3 Forward -22 -15 8.20058 0.234
NP_441052.1_2 Forward -208 -198 19.9412 0.00106
NP_441052.1_2 Reverse -199 -209 10.4031 0.0285
NP_442219.1_9 Forward -207 -198 17.7976 0.00718
NP_442219.1_9 Reverse -200 -209 8.25953 0.0681
NP_442219.1_9 Reverse -61 -70 5.70292 0.135
NP_440436.1_4 Forward -207 -198 17.2072 0.00233
NP_440436.1_4 Reverse -200 -209 9.24241 0.0871
NP_440436.1_4 Forward -235 -226 5.21086 0.214
NP_441884.1_8 Reverse -17 -36 -9.53865 0.268
NP_441884.1_9 Forward -211 -192 -22.6167 0.281
NP_441884.1_9 Reverse -301 -320 -23.2067 0.284
NP_440314.1_9 Reverse -200 -219 -0.0988766 0.104
NP_441719.1_4 Forward -207 -200 16.3621 0.0124
NP_441719.1_4 Reverse -200 -207 16.3621 0.0124
NP_441719.1_4 Forward -68 -61 3.77569 0.285
NP_441004.1_1 Reverse -193 -212 -5.40875 0.176
NP_441004.1_1 Forward -328 -309 -11.1119 0.234
NP_442813.1_4 Forward -345 -326 -9.047 0.299
NP_442366.1_3 Reverse -198 -216 4.44404 0.0975
NP_442366.1_3 Reverse -97 -115 2.0841 0.135
NP_442366.1_3 Forward -209 -191 -2.53746 0.229
NP_442366.1_5 Reverse -196 -206 17.2858 0.0141
NP_442366.1_5 Forward -211 -201 14.0409 0.0497
NP_441115.1_4 Forward -209 -191 19.4878 0.00795
NP_442206.1_7 Reverse -197 -216 8.84924 0.295
NP_440328.1_4 Reverse -193 -212 18.879 0.0206
NP_442430.1_10 Forward -218 -199 9.14342 0.297
NP_441851.1_10 Reverse -198 -208 15.8113 0.00552
NP_441851.1_10 Forward -209 -199 8.53483 0.114
NP_441851.1_10 Forward -260 -250 4.40493 0.271
NP_442856.1_8 Reverse -310 -328 12.9005 0.269
NP_441683.1_5 Forward -129 -110 6.19431 0.288
NP_440593.1_3 Reverse -194 -213 10.2259 0.107
NP_440593.1_3 Reverse -123 -142 -5.31042 0.259
NP_441982.1_6 Forward -46 -37 13.8222 0.274
NP_441349.1_10 Reverse -189 -208 12.1925 0.0216
NP_441349.1_10 Forward -79 -60 -2.0655 0.114
NP_441349.1_10 Forward -218 -199 -4.13045 0.161
NP_441349.1_10 Forward -259 -240 -8.35868 0.274
NP_439960.1_3 Forward -316 -297 0.687771 0.263
NP_441477.1_10 Reverse -192 -210 -0.177514 0.289
NP_440431.1_3 Forward -53 -34 -4.03212 0.178
NP_442450.1_5 Forward -210 -200 7.64985 0.13
NP_442450.1_5 Reverse -197 -207 7.55152 0.13
NP_440588.1_2 Forward -217 -198 7.7676 0.048
NP_440588.1_2 Reverse -190 -209 6.68596 0.0535
NP_442006.1_2 Forward -202 -185 -18.4474 0.291
NP_441570.1_1 Forward -208 -190 -7.45401 0.0895
NP_441078.1_4 Forward -208 -199 19.6659 0.0007
NP_441078.1_4 Reverse -199 -208 19.6659 0.0007
NP_442443.1_1 Reverse -108 -127 -2.95047 0.264
NP_440526.1_3 Forward -207 -196 0.943182 0.267
NP_441432.1_8 Reverse -198 -207 16.8143 0.00595
NP_441432.1_8 Forward -209 -200 16.8143 0.00595
NP_441333.1_1 Forward -378 -368 10.8273 0.293
NP_442320.1_8 Reverse -193 -207 -4.13031 0.148
NP_442344.1_7 Forward -321 -302 -8.85033 0.229
NP_441732.1_2 Forward -212 -196 21.298 0.00205
NP_441732.1_2 Reverse -195 -211 -7.51295 0.0859
NP_442003.1_4 Forward -207 -188 9.93088 0.296
NP_440760.1_1 Reverse -199 -218 -21.0434 0.228
NP_440760.1_1 Forward -208 -189 -23.2067 0.288
NP_442797.1_6 Forward -176 -157 8.80678 0.259
NP_442797.1_7 Reverse -312 -330 6.80398 0.198
NP_442353.1_4 Reverse -193 -212 2.85027 0.228
NP_442353.1_4 Forward -214 -195 0.981987 0.259
NP_441023.1_1 Reverse -199 -217 14.2771 0.18
NP_442489.1_2 Forward -213 -194 8.75091 0.168
NP_442489.1_2 Reverse -99 -118 2.55606 0.261
NP_442489.1_7 Forward -208 -199 20.1576 0.000695
NP_442489.1_7 Reverse -199 -208 20.1576 0.000695
NP_440559.1_1 Forward -207 -198 17.4043 0.00658
NP_440559.1_1 Reverse -200 -209 8.65285 0.0586
NP_440559.1_1 Forward -68 -59 4.71961 0.217
NP_441659.2_8 Reverse -199 -209 20.9245 0.000805
NP_441659.2_8 Forward -208 -198 18.1713 0.00133
NP_442749.1_5 Reverse -23 -40 7.83807 0.255
NP_442913.1_10 Reverse -190 -209 -2.45882 0.186
NP_441040.1_2 Reverse -197 -216 -12.3902 0.255
NP_442008.1_2 Forward -211 -192 15.2408 0.0806
NP_441800.1_3 Reverse -99 -117 3.3624 0.293
NP_442346.1_5 Reverse -198 -208 16.6963 0.00248
NP_442346.1_5 Forward -209 -199 16.303 0.00248
NP_440545.1_3 Reverse -195 -212 14.2968 0.0157
NP_440545.1_3 Forward -212 -195 7.61033 0.0489
NP_440555.1_1 Forward -219 -200 32.1537 0.0000706
NP_440555.1_2 Forward -196 -177 17.5998 0.213
NP_440555.1_3 Forward -123 -104 20.8447 0.0849
NP_440486.1_6 Forward -293 -274 6.98095 0.278
NP_440459.1_2 Forward -210 -193 15.1818 0.113
NP_442311.1_5 Forward -367 -348 9.14423 0.227
NP_442603.1_7 Forward -208 -194 14.0603 0.0733
NP_440449.1_6 Reverse -191 -209 12.6327 0.114
NP_441833.1_4 Forward -207 -200 15.9687 0.0124
NP_441833.1_4 Reverse -200 -207 15.9687 0.0124
NP_440912.1_3 Forward -164 -145 11.11 0.254
NP_441112.1_8 Reverse -33 -52 3.44104 0.232
NP_442162.1_9 Forward -207 -200 16.2637 0.0124
NP_442162.1_9 Reverse -200 -207 16.2637 0.0124
NP_440671.1_2 Forward -205 -191 18.4858 0.0965
NP_440671.1_4 Forward -214 -200 9.73436 0.172
NP_442140.1_3 Forward -207 -197 12.2714 0.0632
NP_442140.1_3 Reverse -200 -210 6.66654 0.159
NP_442140.1_3 Forward -26 -16 4.40493 0.243
NP_442021.1_3 Reverse -193 -212 2.26107 0.176
NP_440875.1_9 Reverse -229 -239 10.8055 0.196
NP_440875.1_9 Reverse -201 -211 8.37203 0.233
NP_441813.1_5 Reverse -197 -207 8.63316 0.0367
NP_441813.1_5 Forward -210 -200 8.63316 0.0367
NP_440590.1_4 Forward -207 -194 19.4888 0.00651
NP_440590.1_4 Reverse -200 -213 4.54251 0.0601
NP_440590.1_4 Forward -26 -13 -4.50394 0.262
NP_440590.1_4 Reverse -16 -29 -5.68391 0.286
NP_440590.1_4 Forward -68 -55 -5.68391 0.286
NP_440567.1_1 Forward -207 -193 13.3726 0.0213
NP_440567.1_1 Reverse -200 -214 4.03116 0.131
NP_442497.1_10 Reverse -200 -209 17.601 0.00813
NP_442497.1_10 Forward -207 -198 10.4228 0.0087
NP_440821.1_4 Reverse -197 -207 9.41981 0.0286
NP_440821.1_4 Forward -210 -200 2.24165 0.131
NP_440227.1_2 Reverse -33 -49 12.0549 0.271
NP_441239.1_9 Forward -210 -198 11.1504 0.0648
NP_441239.1_9 Reverse -197 -209 3.38223 0.285
NP_442897.1_6 Reverse -116 -134 18.702 0.266
NP_441892.1_1 Reverse -190 -207 5.9387 0.0995
NP_441892.1_1 Forward -217 -200 -5.27103 0.276
NP_442270.1_9 Reverse -188 -207 -7.67036 0.214
NP_440833.1_6 Forward -308 -294 8.75042 0.272
NP_440949.1_7 Reverse -320 -339 13.0766 0.209
NP_440354.1_5 Forward -211 -192 7.86593 0.174
NP_442052.1_8 Reverse -225 -235 14.828 0.253
NP_440546.1_4 Reverse -199 -209 13.5365 0.0459
NP_440546.1_4 Forward -208 -198 10.046 0.109
NP_440462.1_6 Forward -210 -200 10.5014 0.0396
NP_440462.1_6 Forward -71 -61 3.91327 0.224
NP_440462.1_6 Reverse -197 -207 1.35667 0.294
NP_442144.1_1 Reverse -196 -212 15.1032 0.152
NP_440868.1_4 Reverse -195 -207 8.6921 0.0582
NP_440868.1_4 Forward -212 -200 6.1355 0.0878
NP_442499.1_3 Reverse -198 -216 6.60732 0.282
NP_440341.1_1 Forward -273 -254 7.17762 0.214
NP_440696.1_3 Forward -73 -55 -3.91409 0.293
NP_442039.1_4 Forward -207 -200 15.1821 0.0124
NP_442039.1_4 Reverse -200 -207 15.1821 0.0124
NP_441811.1_8 Forward -65 -51 11.111 0.219
NP_441811.1_8 Reverse -193 -207 7.66941 0.241
NP_442679.1_1 Forward -272 -253 -2.26216 0.24
NP_440825.1_7 Forward -207 -197 12.9096 0.152
NP_442837.1_3 Forward -207 -200 15.7721 0.0124
NP_442837.1_3 Reverse -200 -207 15.7721 0.0124
NP_442837.1_3 Reverse -61 -68 8.79057 0.165
NP_442053.1_1 Forward -208 -199 18.3876 0.0007
NP_442053.1_1 Reverse -199 -208 18.3876 0.0007
NP_440505.1_3 Reverse -197 -207 9.22315 0.122
NP_440505.1_3 Forward -210 -200 8.04317 0.147
NP_440505.1_7 Reverse -192 -211 0.0977854 0.259
NP_440351.1_8 Reverse -182 -200 6.60732 0.26
NP_442456.1_4 Reverse -164 -183 14.1583 0.287
NP_441408.2_7 Forward -210 -191 -4.42544 0.281
NP_440914.1_1 Forward -208 -198 17.5935 0.000537
NP_440914.1_1 Reverse -199 -209 16.3248 0.00196
NP_440914.1_1 Reverse -227 -237 8.12715 0.207
NP_441011.1_8 Reverse -200 -209 16.6177 0.00602
NP_441011.1_8 Forward -207 -198 8.25953 0.144
NP_442101.1_10 Forward -216 -197 -8.65367 0.242
NP_442533.1_1 Forward -84 -65 -17.7001 0.293
NP_442533.1_6 Forward -208 -199 17.2076 0.00137
NP_442533.1_6 Reverse -199 -208 17.2076 0.00137
NP_442229.1_1 Reverse -197 -211 7.47213 0.196
NP_441482.1_7 Forward -214 -200 -0.885388 0.0612
NP_439944.1_9 Forward -207 -197 10.5014 0.0887
NP_439944.1_9 Reverse -200 -210 9.12481 0.1
NP_441697.1_5 Forward -163 -144 -9.78835 0.274
NP_440116.1_5 Reverse -196 -213 12.6252 0.09
NP_440115.1_6 Reverse -196 -206 8.33817 0.13
NP_440115.1_6 Forward -211 -201 7.35486 0.147
NP_440007.1_9 Reverse -189 -203 4.03116 0.267
NP_440007.1_9 Forward -212 -198 2.75286 0.277
NP_440608.1_6 Reverse -200 -219 3.63691 0.289
NP_441972.1_5 Reverse -221 -240 -5.01543 0.213
NP_441972.1_5 Forward -207 -188 -5.40875 0.22
NP_441106.1_1 Forward -209 -200 18.486 0.0028
NP_441106.1_1 Reverse -198 -207 9.63616 0.0311
NP_441106.1_1 Reverse -17 -26 2.35967 0.287
NP_441420.1_1 Reverse -241 -260 1.96607 0.169
NP_439903.1_6 Forward -211 -192 3.53858 0.209
NP_442588.1_6 Reverse -107 -126 -0.885524 0.268
NP_441286.1_1 Reverse -198 -210 5.93884 0.0258
NP_441286.1_1 Forward -209 -197 3.48056 0.0467
NP_440670.1_8 Forward -208 -199 18.3876 0.000699
NP_440670.1_8 Reverse -199 -208 18.3876 0.000699
NP_440886.1_7 Forward -209 -199 8.04271 0.0805
NP_440886.1_7 Reverse -198 -208 7.94438 0.0805
NP_442614.1_2 Forward -316 -302 7.86607 0.262
NP_442614.1_2 Forward -208 -194 6.19444 0.291
NP_442072.1_9 Forward -209 -191 -21.712 0.212
NP_442072.1_9 Reverse -198 -216 -22.7936 0.259
NP_442773.2_1 Forward -129 -110 12.6841 0.248
NP_440907.2_8 Reverse -200 -210 15.9091 0.0161
NP_440907.2_8 Forward -207 -197 7.64939 0.117
NP_441626.1_2 Forward -207 -200 15.7721 0.0124
NP_441626.1_2 Reverse -200 -207 15.7721 0.0124
NP_442365.1_7 Forward -206 -187 -1.57384 0.193
NP_442794.1_1 Forward -212 -200 12.527 0.0721
NP_442794.1_1 Reverse -195 -207 12.4287 0.0721
NP_442794.1_1 Reverse -189 -201 3.08724 0.286
NP_442615.1_1 Forward -217 -199 5.72234 0.0374
NP_442615.1_1 Reverse -190 -208 -2.43913 0.144
NP_441962.1_4 Forward -207 -188 -11.8986 0.248
NP_440387.1_1 Reverse -199 -215 16.2831 0.0047
NP_440387.1_1 Forward -208 -192 6.35172 0.0282
NP_440855.1_5 Reverse -191 -210 6.48849 0.285
NP_441431.1_2 Forward -211 -197 13.1753 0.0952
NP_441431.1_2 Reverse -196 -210 7.57046 0.238
NP_441488.1_8 Reverse -194 -208 12.192 0.146
NP_441488.1_8 Forward -213 -199 11.7987 0.146
NP_441993.1_1 Reverse -193 -212 11.1077 0.117
NP_441993.1_1 Forward -208 -189 1.94669 0.267
NP_440114.1_10 Forward -223 -209 6.09611 0.285
NP_442323.1_7 Reverse -194 -213 5.80018 0.202
NP_442323.1_7 Reverse -123 -142 3.04693 0.252
NP_441156.1_1 Forward -272 -253 15.3391 0.154
NP_441510.2_6 Reverse -60 -79 12.7816 0.268
NP_442087.1_2 Forward -52 -33 12.5342 0.289
NP_440293.1_3 Forward -81 -62 -2.75381 0.241
NP_440766.1_4 Reverse -14 -28 2.85119 0.167
NP_441237.1_9 Forward -207 -197 14.828 0.0242
NP_442930.1_1 Forward -41 -31 12.7626 0.239
NP_440457.1_1 Reverse -195 -207 0.137309 0.25
NP_440457.1_1 Forward -212 -200 -0.354346 0.262
NP_440798.1_6 Forward -207 -194 6.60746 0.14
NP_440798.1_6 Reverse -200 -213 1.49425 0.212
NP_440142.1_7 Reverse -200 -219 5.60432 0.287
NP_442509.1_9 Forward -208 -198 8.14104 0.192
NP_442509.1_9 Reverse -199 -209 8.04271 0.192
NP_440554.1_4 Reverse -200 -210 8.82982 0.0646
NP_441885.1_5 Forward -208 -198 20.9245 0.000538
NP_441885.1_5 Reverse -199 -209 11.3864 0.00668
NP_440478.1_4 Forward -212 -193 12.4875 0.234
NP_442341.1_7 Forward -209 -195 9.2427 0.0751
NP_442341.1_7 Reverse -198 -212 8.55439 0.0864
NP_442341.1_7 Reverse -303 -317 3.34284 0.227
NP_442341.1_9 Forward -210 -196 16.9119 0.0319
NP_442341.1_9 Reverse -197 -211 8.45543 0.17
NP_443000.1_7 Forward -210 -200 10.6981 0.0345
NP_443000.1_7 Reverse -197 -207 10.3048 0.0345
NP_441842.1_1 Forward -206 -193 15.555 0.0619
NP_441842.1_10 Reverse -192 -206 9.93102 0.178
NP_440275.1_3 Forward -210 -200 9.02648 0.0563
NP_440275.1_3 Reverse -197 -207 8.04317 0.0602
NP_440275.1_3 Reverse -16 -26 3.61828 0.219
NP_441902.1_3 Reverse -40 -50 13.176 0.23
NP_440149.1_8 Forward -208 -189 -2.65548 0.174
NP_441105.1_3 Reverse -188 -207 3.93269 0.0851
NP_441105.1_3 Forward -219 -200 -5.60541 0.222
NP_440216.1_1 Forward -208 -194 0.491246 0.0284
NP_440216.1_1 Reverse -199 -213 -2.36035 0.0494
NP_440216.1_9 Forward -93 -84 11.7994 0.254
NP_440216.1_9 Reverse -385 -394 7.96454 0.286
NP_440172.1_1 Reverse -199 -209 17.5813 0.00421
NP_440172.1_1 Forward -208 -198 15.0247 0.00945
NP_440249.1_2 Forward -44 -34 14.3359 0.284
NP_442015.1_10 Reverse -195 -208 20.2755 0.00366
NP_442015.1_10 Forward -212 -199 12.2123 0.0372
NP_441226.1_7 Forward -207 -200 14.4934 0.0123
NP_441226.1_7 Reverse -200 -207 14.4934 0.0123
NP_441226.1_7 Forward -201 -194 9.47853 0.147
NP_441111.1_7 Forward -207 -199 18.7023 0.00294
NP_441111.1_7 Reverse -200 -208 18.7023 0.00294
NP_442379.1_10 Reverse -192 -209 -1.53445 0.223
NP_441766.1_2 Forward -208 -199 17.5026 0.00297
NP_441766.1_2 Reverse -199 -208 17.5026 0.00297
NP_442417.1_5 Reverse -199 -213 7.76774 0.176
NP_440416.1_9 Reverse -192 -211 -9.44032 0.131
NP_440416.1_9 Reverse -312 -331 -16.9135 0.226
NP_440261.1_5 Forward -207 -194 -2.53732 0.0924
NP_440261.1_5 Reverse -200 -213 -2.93064 0.0983
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GATTGGTTTACCATGGTGACCAAGTTTAGTTTTCCTGGTAGTAGTCACCAAGATATATCCTGTCAGTATCGGGGGCGTCTCAATGGCGGAGAGTCCCAATACACCTACGTTTTGCAACACAGTCAACTAGGGAGAGTAGAAGGGGAAGGCTGGCTCTCTAACCATGCCATTGTTCAGCGCTATTGGGTCCTAGGCGATCGCCAACGGCAGAGTGGCTTTGAAACCTTTTACCGCTTCAATGATCGTCGTTATTATTTAGCTAGTGGGATGCTCACCGGCCACTCCTTGACCAGTACAATGGAAGCCACCCTGGAAAGACAGGGTTGAGGCTAGGGATCGATATTGATTGCTTGTTGCTCAAAAAATTAACGTCACCGCTCGTCGCTGAGATATTTGCGCT

CDS

ATGACCCCTGACTCCCGTCACCGCCGTCTATTGGCCAATCGCTATCAACTGGTTGAGTTGGTGGGTAGTGGAGCTATGGGTCAAGTCTACCGAGCGGAAGATAAGCTCCTTGGGGGAGTCACCGTCGCAGTCAAATTCCTTTCCCAAGCCTTGCTCAATCCCCGCATGAAGGAACGGTTTGAACGGGAAGCCACTATTTCGGCCCTACTGGGGGAAAAAAGTATCCACATTGTGCGGGTGCGGGATTACGGCCTGGACGAAAAGGAAATTCCCTTCTACGTGATGGAATACCTCCAAGGGGAAAACAATTAG

Protein

MTPDSRHRRLLANRYQLVELVGSGAMGQVYRAEDKLLGGVTVAVKFLSQALLNPRMKERFEREATISALLGEKSIHIVRVRDYGLDEKEIPFYVMEYLQGENN