Your browser is old and dusty. Try Google Chrome!

Details for sll1473

ORF sll1473
Accession NP_442920.1
Symbol
Category a part of phytochrome-like sensor histidine kinase gene (disrupted by insertion of IS)
Definition Hypothetical
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442272.1_2 Forward -47 -28 18.1908 0.15
NP_441098.1_9 Forward -89 -70 17.7974 0.205
NP_442062.1_3 Reverse -20 -39 1.67108 0.226
NP_440304.1_4 Forward -192 -182 2.53664 0.299
NP_440769.1_8 Forward -40 -21 11.5042 0.171
NP_441434.1_1 Forward -44 -30 16.1498 0.186
NP_441738.1_2 Reverse -361 -368 8.1019 0.204
NP_442920.1_1 Forward -72 -53 20.2339 0.11
NP_441716.1_2 Reverse -304 -323 -1.42955 0.289
NP_442111.1_1 Reverse -50 -69 14.5516 0.29
NP_440851.1_5 Reverse -91 -110 13.47 0.25
NP_442530.1_2 Reverse -48 -58 12.9597 0.263
NP_440184.1_1 Reverse -58 -77 6.60859 0.181
NP_441127.1_1 Forward -389 -375 8.84938 0.284
NP_442690.1_1 Reverse -21 -40 -11.4069 0.229
NP_442690.1_1 Forward -323 -304 -16.1268 0.283
NP_442690.1_1 Reverse -40 -59 -17.3068 0.299
NP_440138.1_6 Forward -388 -369 8.4551 0.193
NP_441654.1_7 Reverse -344 -363 11.3715 0.285
NP_441076.1_3 Forward -326 -307 10.815 0.261
NP_441514.1_1 Forward -63 -53 14.6315 0.274
NP_441514.1_4 Reverse -312 -331 17.0656 0.177
NP_442281.1_1 Reverse -382 -396 3.24392 0.238
NP_441079.1_7 Reverse -52 -71 8.06178 0.107
NP_441079.1_7 Reverse -312 -331 -4.62285 0.25
NP_442215.1_2 Forward -296 -280 3.40179 0.0967
NP_441310.1_9 Reverse -114 -133 -2.55715 0.239
NP_443009.1_5 Reverse -6 -17 4.67974 0.234
NP_441198.1_4 Forward -306 -287 10.0292 0.274
NP_441758.1_10 Reverse -200 -219 0.490334 0.203
NP_441826.1_5 Reverse -176 -195 2.3594 0.276
NP_441056.1_1 Reverse -142 -161 -8.26035 0.282
NP_442630.1_5 Reverse -314 -333 12.8808 0.263
NP_442505.1_2 Forward -247 -228 12.0953 0.259
NP_441534.1_5 Forward -213 -194 0.491109 0.293
NP_442397.1_1 Reverse -284 -298 15.6542 0.24
NP_442397.1_1 Forward -107 -93 15.2698 0.257
NP_441819.1_5 Reverse -299 -318 11.7928 0.259
NP_440136.1_1 Reverse -45 -61 18.3473 0.174
NP_442998.1_5 Reverse -96 -106 9.51814 0.238
NP_440899.1_1 Reverse -106 -125 5.57728 0.3
NP_441007.1_10 Reverse -177 -190 1.19926 0.207
NP_441464.1_8 Forward -191 -177 4.91614 0.26
NP_441340.1_9 Reverse -18 -28 7.29115 0.289
NP_442327.1_3 Reverse -22 -41 12.0793 0.182
NP_442327.1_3 Reverse -21 -40 5.68135 0.276
NP_440192.1_9 Forward -195 -176 15.8307 0.285
NP_442294.1_3 Forward -111 -97 12.9786 0.274
NP_441595.1_2 Forward -240 -227 9.80195 0.277
NP_443039.1_7 Reverse -375 -389 5.50552 0.217
NP_439943.1_7 Reverse -354 -373 3.6377 0.29
NP_442339.1_1 Forward -61 -42 14.0599 0.204
NP_442339.1_8 Reverse -207 -224 18.9184 0.217
NP_441877.1_9 Reverse -295 -312 3.97208 0.284
NP_442713.1_5 Reverse -99 -118 3.93269 0.233
NP_442790.1_4 Forward -168 -149 -13.3736 0.26
NP_441689.1_5 Forward -398 -388 12.7626 0.113
NP_440999.1_9 Forward -133 -119 -2.65535 0.273
NP_442033.1_10 Forward -108 -89 -9.73531 0.221
NP_440575.1_8 Reverse -33 -52 -1.57384 0.224
NP_440575.1_8 Reverse -81 -100 -2.65548 0.239
NP_441543.1_2 Forward -336 -327 9.4395 0.0818
NP_442710.1_7 Forward -44 -25 -1.26394 0.221
NP_443062.1_1 Forward -283 -265 10.7886 0.11
NP_442859.1_6 Reverse -92 -111 9.93006 0.163
NP_440673.1_3 Forward -271 -264 5.44732 0.294
NP_442813.1_2 Forward -350 -331 1.57275 0.25
NP_442366.1_3 Forward -369 -351 -1.16082 0.207
NP_442694.1_9 Reverse -89 -108 14.4541 0.187
NP_442515.1_1 Forward -160 -146 -1.37704 0.253
NP_441982.1_6 Reverse -95 -104 12.6763 0.274
NP_441046.1_2 Reverse -323 -342 -1.37718 0.288
NP_442689.1_8 Reverse -44 -61 -6.54933 0.285
NP_442689.1_8 Forward -342 -325 -8.81095 0.298
NP_440431.1_3 Forward -59 -40 -7.17871 0.202
NP_442450.1_3 Reverse -11 -29 6.90155 0.215
NP_441432.1_8 Forward -16 -7 5.3096 0.17
NP_441432.1_9 Reverse -57 -70 10.3436 0.252
NP_440760.1_7 Forward -346 -327 1.57197 0.299
NP_442274.1_3 Forward -123 -104 9.73422 0.297
NP_440459.1_2 Forward -398 -381 13.0185 0.131
NP_440010.1_10 Forward -171 -152 3.44104 0.257
NP_441329.1_1 Forward -223 -204 4.15348 0.3
NP_441329.1_6 Forward -61 -42 0.238307 0.26
NP_442028.1_1 Reverse -35 -48 8.94252 0.269
NP_440590.1_4 Forward -395 -382 9.75405 0.0335
NP_440904.1_10 Forward -119 -101 24.4461 0.00523
NP_441239.1_9 Forward -192 -180 3.38223 0.285
NP_442643.1_7 Reverse -289 -308 7.47261 0.287
NP_441541.1_1 Forward -222 -204 -5.15458 0.293
NP_440412.1_2 Reverse -104 -123 5.80098 0.283
NP_441509.1_1 Reverse -34 -53 11.5042 0.215
NP_440374.1_3 Reverse -304 -322 12.3204 0.272
NP_441084.1_6 Forward -60 -46 9.8289 0.263
NP_442039.1_7 Reverse -93 -103 15.3197 0.211
NP_440505.1_3 Forward -17 -7 6.46988 0.18
NP_440351.1_8 Forward -399 -381 6.01734 0.26
NP_440068.1_1 Reverse -114 -133 4.12936 0.208
NP_442533.1_6 Reverse -181 -190 2.458 0.255
NP_442533.1_6 Reverse -387 -396 1.76968 0.289
NP_441697.1_5 Forward -70 -51 0.238307 0.195
NP_441697.1_5 Reverse -52 -71 -4.15432 0.22
NP_441697.1_5 Reverse -25 -44 -10.9342 0.287
NP_440816.1_5 Forward -165 -146 20.7473 0.268
NP_441106.1_3 Forward -77 -58 18.584 0.0578
NP_441705.1_3 Reverse -103 -122 2.94938 0.228
NP_440886.1_7 Reverse -263 -273 4.01116 0.255
NP_440799.1_10 Reverse -11 -30 11.3075 0.267
NP_442893.1_4 Forward -92 -73 -0.197979 0.252
NP_441836.1_2 Reverse -144 -163 -0.590531 0.213
NP_442324.1_7 Reverse -335 -354 5.66585 0.268
NP_440766.1_5 Reverse -46 -58 8.41973 0.277
NP_441421.1_6 Reverse -18 -35 10.1743 0.28
NP_440457.1_1 Reverse -177 -189 0.137309 0.25
NP_442509.1_9 Reverse -99 -109 6.0761 0.293
NP_442439.1_8 Forward -59 -40 7.17762 0.295
NP_441885.1_5 Reverse -150 -160 -1.78992 0.284
NP_442703.1_9 Reverse -345 -363 4.24738 0.26
NP_441173.1_9 Forward -103 -95 13.2937 0.17
NP_440191.1_1 Forward -189 -170 20.3531 0.0528
NP_442932.1_9 Reverse -331 -350 4.916 0.274
NP_441397.1_3 Reverse -24 -43 16.7149 0.275
NP_442451.1_2 Forward -388 -369 -10.227 0.265
NP_440216.1_9 Reverse -93 -102 7.57121 0.286
NP_440047.1_3 Forward -196 -177 0.196116 0.23
NP_443052.1_9 Forward -189 -170 -6.98204 0.291
NP_442116.1_6 Forward -318 -301 5.87715 0.289
NP_442564.1_10 Forward -128 -114 8.45605 0.296
NP_442046.1_2 Forward -44 -31 17.1535 0.193
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AGAAATGGATCGGCAGTGGTATCAATCAGTCAAGCGATTTTTATGTCCAAGTTTTGAAATTTCTGCTATCAACTTCCAAGATATTTTGTTTAACAATGTTGACGTTGGAGAATATCATTCGATCCTAGTTGGTTGCGGGATTAAATATGAATCAATTGATATTTCAGCTACTTTAGATTTAGTGACCATTATTAAAAAATTGTCTGCTAAGCCGCCGGCCCTACTACTAATTACGGATTGTGCCGACAGTCAGATCACGGTACAAGCTCGCAGTTACCTGCCCCAAATTGACGGCGTTTTTGCCAAGGATCATGATTTAGCTTTATTGTTAAAAGTCATGAAAATTATTGCCAAACAAAAATATTTTAAGTAAGGTTTTTCTACTGGGATTCGCTAATAT

CDS

ATGGGCAAATTTCTAATTCCAATCGAATTTGTTTTTCTGGCGATCGCCATGACCTGTTATTTATGGCACAGACAAAACCAAGAACGCCGCAGGATTGAAATTAGCATCAAGCAACAAACCCAACGGGAACGATTTATTAACCAAATTACCCAACATATCCGCCAATCTTTAAACTTGGAAACGGTTTTAAATACCACCGTCGCTGAAGTTAAAACCCTGTTGCAAGTTGATCGAGTTCTAATTTATCGCATTTGGCAAGATGGCACGGGCAGCGCCATTACGGAATCGGTGAATGCCAATTATCCTAGTATTTTAGGGCGGACCTTTTCCGATGAAGTTTTTCCCGTTGAATACCATCAAGCCTACACCAAAGGTAAAGTACGGGCCATTAATGACATTGACCAGGATGACATAGAGATTTGCCTAGCTGATTTCGTCAAACAATTTGGCGTGAAATCAAAATTAGTAGTGCCCATTCTTCAACATAATCGTGCTTCTTCCCTAGATAATGAATCAGAATTTCCCTATCTTTGGGGGCTGTTAATTACCCATCAATGTGCTTTTACCCGGCCATGGCAACCGTGGGAAGTGGAGTTAATGAAACAGCTAGCCAATCAGGTCGCGATCGCCATCCAACAATCGGAATTATATGAGCAATTACAGCAACTCAATAAAGATTTGGAAAACCGAGTCGAAAAACGCACCCAGCAACTTGCCGCCACCAATCAATCCCTAAGAATGGAAATCAGTGAGCGACAAAAAACGGAAGCCGCTCTCCGCCACACTAACCATACTCTGCAATCCCTGATTGCGGCCTCCCCCAGGGGTATTTTTACCCTTAATTTAGCAGACCAAATTCAGATTTGGAATCCTACAGCAGAACGTATTTTTGGTTGGACAGAAACAGAAATTATTGCCCATCCAGAATTATTAACATCCAACATTTTGCTGGAAGATTATCAGCAATTTAAACAGAAAGTTTTATCAGGCATGGTTTCCCCTAGCCTAGAATTAAAATGTCAAAAAAAAGATGGTAGTTGGATTGAAATTGTCCTTTCCGCTGCTCCCCTATTGGATAGTGAAGAAAATATTGCCGGATTGGTGGCGGTTGTCGCCGATATTACCGAGCAAAAGCGGCAGGCAGAACAAATTCGTTTGCTACAATCCGTTGTGGTTAATACTAATGATGCGGTGGTGATTACGGAAGCGGAGCCCATTGATGATCCCGGGCCGAGAATTCTCTATGTCAATGAAGCATTTACTAAAATCACCGGTTATACTGCTGAAGAAATGCTAGGCAAAACCCCCCGAGTTTTACAGGGACCAAAAACTAGTCGCACTGAATTAGATAGGGTGCGGCAAGCCATTAGTCAATGGCAATCAGTTACCGTTGAAGCAGAAGTGTTGAACGATAGTTATAAAGAGAAAAAAAGCCCTTTAAAATGA

Protein

MGKFLIPIEFVFLAIAMTCYLWHRQNQERRRIEISIKQQTQRERFINQITQHIRQSLNLETVLNTTVAEVKTLLQVDRVLIYRIWQDGTGSAITESVNANYPSILGRTFSDEVFPVEYHQAYTKGKVRAINDIDQDDIEICLADFVKQFGVKSKLVVPILQHNRASSLDNESEFPYLWGLLITHQCAFTRPWQPWEVELMKQLANQVAIAIQQSELYEQLQQLNKDLENRVEKRTQQLAATNQSLRMEISERQKTEAALRHTNHTLQSLIAASPRGIFTLNLADQIQIWNPTAERIFGWTETEIIAHPELLTSNILLEDYQQFKQKVLSGMVSPSLELKCQKKDGSWIEIVLSAAPLLDSEENIAGLVAVVADITEQKRQAEQIRLLQSVVVNTNDAVVITEAEPIDDPGPRILYVNEAFTKITGYTAEEMLGKTPRVLQGPKTSRTELDRVRQAISQWQSVTVEAEVLNDSYKEKKSPLK