Your browser is old and dusty. Try Google Chrome!

Details for sll1360

ORF sll1360
Accession NP_440867.1
Symbol dnaX
Category DNA polymerase III subunit gamma/tau [Contains: Ssp dnaX intein]
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -172 -158 4.42448 0.148
NP_440795.1_7 Forward -245 -238 14.1988 0.0267
NP_440897.1_6 Reverse -251 -270 6.88182 0.0893
NP_441453.1_1 Reverse -230 -248 13.7847 0.0938
NP_441453.1_4 Forward -246 -238 6.80426 0.121
NP_441453.1_4 Forward -203 -195 4.73931 0.252
NP_442151.1_6 Reverse -237 -251 10.3243 0.125
NP_442151.1_6 Forward -173 -159 6.29277 0.24
NP_441818.1_1 Forward -166 -155 8.51463 0.288
NP_441818.1_9 Reverse -84 -103 -11.0136 0.3
NP_440150.1_6 Reverse -11 -30 0.982764 0.295
NP_442173.1_1 Reverse -238 -246 5.72262 0.203
NP_442752.1_4 Forward -363 -356 5.54565 0.194
NP_442752.1_4 Forward -203 -196 5.54565 0.194
NP_442752.1_4 Reverse -14 -21 4.26735 0.293
NP_442752.1_4 Forward -246 -239 4.26735 0.293
NP_443027.1_4 Forward -248 -238 12.2714 0.0797
NP_443027.1_4 Reverse -235 -245 6.37155 0.283
NP_441225.1_4 Forward -103 -84 -12.5869 0.285
NP_440784.1_7 Reverse -238 -245 13.2155 0.0365
NP_440784.1_7 Forward -245 -238 12.1338 0.0604
NP_442909.1_2 Reverse -311 -330 13.9625 0.216
NP_440061.1_9 Forward -25 -11 11.2087 0.116
NP_440061.1_9 Forward -262 -248 8.65209 0.167
NP_441499.1_8 Forward -315 -296 10.5209 0.204
NP_442062.1_8 Forward -246 -236 9.02648 0.069
NP_442062.1_8 Reverse -14 -24 5.19158 0.181
NP_442062.1_8 Forward -363 -353 4.10993 0.232
NP_441859.1_5 Reverse -210 -229 8.75091 0.226
NP_440304.1_4 Reverse -156 -166 5.28991 0.218
NP_442242.1_4 Forward -245 -238 12.0355 0.0521
NP_442242.1_4 Reverse -238 -245 11.5438 0.089
NP_441594.1_6 Forward -306 -287 -0.295539 0.298
NP_440856.1_4 Forward -253 -234 13.1758 0.0346
NP_441083.1_5 Reverse -14 -24 8.23984 0.0429
NP_441083.1_5 Forward -23 -13 0.373358 0.231
NP_441083.1_5 Forward -246 -236 -0.904945 0.283
NP_440209.1_1 Forward -246 -238 8.37755 0.0576
NP_440209.1_1 Forward -23 -15 5.0343 0.194
NP_440447.1_1 Forward -251 -233 19.587 0.104
NP_440447.1_8 Reverse -260 -279 19.9606 0.145
NP_442570.1_3 Forward -175 -156 1.17943 0.198
NP_442570.1_3 Forward -262 -243 -4.81876 0.235
NP_441716.1_1 Forward -23 -9 7.9644 0.153
NP_441716.1_1 Reverse -30 -44 4.32615 0.256
NP_442111.1_4 Reverse -13 -27 4.62115 0.198
NP_442111.1_4 Reverse -236 -250 3.34284 0.248
NP_442111.1_4 Reverse -163 -177 1.96621 0.292
NP_441163.1_1 Forward -367 -350 5.83964 0.267
NP_440906.1_5 Reverse -238 -245 13.3138 0.0268
NP_440906.1_5 Forward -202 -195 8.79057 0.149
NP_440906.1_5 Forward -245 -238 6.13563 0.241
NP_440747.1_10 Forward -249 -237 -2.32097 0.0331
NP_440747.1_10 Reverse -11 -23 -2.32097 0.0331
NP_440747.1_10 Reverse -191 -203 -2.91095 0.0732
NP_440747.1_10 Forward -26 -14 -2.91095 0.0732
NP_442634.1_4 Forward -248 -234 -2.45868 0.152
NP_441265.1_3 Forward -252 -238 -0.295402 0.272
NP_440403.1_4 Reverse -158 -177 -0.39387 0.164
NP_440842.1_6 Reverse -235 -254 11.2084 0.261
NP_443018.1_3 Forward -245 -238 5.15232 0.226
NP_443018.1_3 Reverse -238 -245 5.05399 0.238
NP_441634.1_8 Reverse -246 -260 -0.197071 0.25
NP_441634.1_8 Forward -262 -248 -4.03198 0.295
NP_440376.1_1 Forward -203 -194 5.3096 0.137
NP_440376.1_1 Forward -260 -251 4.52295 0.156
NP_440376.1_1 Forward -50 -41 2.458 0.221
NP_440376.1_1 Reverse -14 -23 0.0980582 0.285
NP_440376.1_1 Forward -246 -237 -0.000272808 0.285
NP_440376.1_1 Reverse -237 -246 -0.000272808 0.285
NP_440376.1_1 Forward -23 -14 -0.000272808 0.285
NP_442687.1_7 Forward -91 -81 5.97822 0.179
NP_442687.1_7 Reverse -236 -246 5.19158 0.217
NP_442687.1_7 Forward -318 -308 4.99491 0.225
NP_442687.1_7 Reverse -250 -260 4.89658 0.23
NP_442191.1_4 Reverse -238 -252 14.1927 0.112
NP_442530.1_2 Reverse -277 -287 13.648 0.226
NP_440642.1_10 Forward -113 -99 2.8506 0.277
NP_442658.1_10 Forward -265 -246 18.3873 0.156
NP_442198.1_3 Forward -272 -253 3.93269 0.285
NP_442782.1_2 Forward -203 -189 2.16287 0.277
NP_441414.1_9 Forward -246 -227 1.86774 0.0705
NP_440607.1_5 Reverse -78 -97 -1.27885 0.296
NP_441958.1_5 Forward -247 -237 2.33998 0.0455
NP_441958.1_5 Reverse -13 -23 1.35667 0.0987
NP_442486.1_6 Forward -102 -83 1.76941 0.266
NP_439905.1_1 Reverse -252 -265 19.3905 0.0174
NP_439905.1_1 Forward -259 -246 8.86907 0.228
NP_440984.1_7 Reverse -246 -260 9.2427 0.129
NP_440984.1_7 Forward -265 -251 8.84938 0.134
NP_441338.2_5 Forward -335 -316 9.3409 0.247
NP_442911.1_2 Reverse -227 -246 6.78429 0.0277
NP_440153.1_5 Reverse -238 -252 5.40779 0.191
NP_442064.1_1 Forward -116 -97 -9.14533 0.259
NP_443055.1_6 Forward -260 -242 1.19838 0.234
NP_441099.1_5 Forward -33 -14 -5.60541 0.152
NP_441099.1_5 Forward -25 -6 -10.7186 0.261
NP_442002.1_9 Reverse -13 -20 14.1004 0.074
NP_442002.1_9 Reverse -157 -164 11.3472 0.185
NP_441654.1_5 Forward -296 -277 14.3296 0.252
NP_440809.1_9 Reverse -228 -246 -6.56903 0.225
NP_442567.1_3 Forward -357 -341 11.5633 0.281
NP_442598.1_2 Forward -66 -57 16.5193 0.252
NP_441294.1_7 Forward -177 -163 8.48272 0.298
NP_441646.1_1 Forward -112 -93 -1.7705 0.294
NP_441646.1_5 Forward -44 -25 15.2408 0.291
NP_442438.1_10 Reverse -349 -363 -0.492064 0.264
NP_442431.1_10 Reverse -78 -96 14.1788 0.0736
NP_442231.1_2 Forward -263 -244 18.1666 0.202
NP_441000.1_6 Reverse -163 -177 0.294584 0.196
NP_441000.1_6 Forward -94 -80 -0.0987402 0.2
NP_440484.1_3 Forward -248 -234 19.9608 0.0912
NP_440147.1_4 Reverse -12 -25 5.82081 0.112
NP_440147.1_4 Forward -319 -306 5.42749 0.125
NP_441550.1_8 Forward -248 -238 10.6976 0.0648
NP_441916.1_7 Forward -23 -13 3.81494 0.202
NP_440465.1_10 Reverse -248 -267 2.55606 0.268
NP_440703.1_9 Reverse -251 -264 8.86849 0.226
NP_441725.1_4 Forward -251 -237 3.34225 0.279
NP_441725.1_5 Forward -245 -235 0.275027 0.192
NP_441725.1_5 Forward -166 -156 0.176696 0.206
NP_439966.1_7 Reverse -235 -245 6.0761 0.195
NP_439966.1_7 Forward -248 -238 4.7978 0.258
NP_442941.1_3 Reverse -238 -248 9.7148 0.0286
NP_442941.1_3 Reverse -15 -25 6.96153 0.0903
NP_442941.1_3 Forward -245 -235 -0.511621 0.261
NP_440289.1_2 Forward -206 -193 7.6891 0.0541
NP_440260.1_8 Forward -263 -245 -6.76569 0.295
NP_442281.1_1 Reverse -9 -23 7.66879 0.0949
NP_442281.1_1 Forward -251 -237 5.50552 0.155
NP_441334.1_7 Reverse -235 -254 -4.52377 0.12
NP_442012.1_1 Forward -369 -350 4.52268 0.165
NP_441556.1_7 Reverse -241 -260 7.4718 0.171
NP_441644.1_6 Forward -15 -5 6.27276 0.163
NP_441644.1_6 Forward -317 -307 4.50281 0.235
NP_441644.1_6 Reverse -14 -24 4.50281 0.235
NP_441644.1_6 Forward -246 -236 4.40448 0.239
NP_440867.1_6 Forward -96 -77 18.9765 0.112
NP_440867.1_10 Forward -261 -242 27.4338 0.00142
NP_440867.1_10 Reverse -242 -261 1.86774 0.291
NP_442215.1_2 Reverse -235 -251 -4.36636 0.232
NP_440929.1_8 Forward -246 -237 7.66954 0.0624
NP_440929.1_8 Reverse -237 -246 7.57121 0.0706
NP_442933.1_10 Forward -23 -14 11.5045 0.042
NP_442933.1_10 Reverse -237 -246 5.3096 0.203
NP_442671.1_2 Reverse -60 -79 4.22167 0.182
NP_441751.2_8 Forward -22 -8 -6.39192 0.265
NP_442554.1_8 Reverse -238 -248 7.74818 0.0846
NP_442554.1_8 Forward -259 -249 5.28991 0.153
NP_442554.1_8 Reverse -252 -262 2.53664 0.268
NP_441762.1_7 Reverse -353 -365 -6.15587 0.276
NP_442142.1_4 Reverse -11 -24 5.13193 0.201
NP_442142.1_4 Forward -249 -236 2.28034 0.295
NP_442292.1_1 Reverse -238 -247 8.06287 0.0554
NP_442292.1_1 Forward -245 -236 -0.68859 0.268
NP_443009.1_5 Forward -247 -236 9.30127 0.0965
NP_443009.1_5 Forward -40 -29 8.61296 0.104
NP_441715.1_4 Reverse -15 -25 7.64985 0.108
NP_441715.1_4 Reverse -238 -248 7.55152 0.108
NP_441715.1_4 Forward -245 -235 7.15819 0.114
NP_440357.1_3 Forward -263 -244 3.93269 0.242
NP_441198.1_4 Reverse -84 -103 8.75091 0.276
NP_441198.1_8 Reverse -156 -166 10.1462 0.296
NP_440379.1_6 Forward -203 -184 3.6377 0.274
NP_441468.1_1 Reverse -238 -245 6.3323 0.202
NP_441468.1_1 Forward -245 -238 6.13563 0.209
NP_441015.1_10 Reverse -246 -265 -9.047 0.278
NP_441673.1_1 Forward -246 -237 1.37636 0.114
NP_441673.1_1 Reverse -14 -23 1.37636 0.114
NP_441673.1_1 Reverse -237 -246 1.1797 0.163
NP_441673.1_1 Forward -23 -14 1.1797 0.163
NP_440672.1_1 Reverse -90 -108 19.3903 0.124
NP_441330.1_1 Forward -251 -232 -13.8652 0.206
NP_442868.1_6 Reverse -192 -202 6.37155 0.114
NP_442868.1_6 Forward -248 -238 0.865012 0.205
NP_442868.1_6 Forward -25 -15 -0.41329 0.295
NP_441612.1_2 Reverse -14 -24 13.0995 0.21
NP_441612.1_2 Reverse -215 -225 7.77478 0.245
NP_441612.1_2 Forward -192 -182 6.4194 0.291
NP_441911.1_10 Forward -386 -367 10.5835 0.226
NP_441911.1_10 Reverse -266 -285 6.82367 0.291
NP_442808.1_1 Forward -204 -194 4.60114 0.195
NP_440145.1_3 Forward -256 -237 -1.67217 0.154
NP_440558.1_2 Forward -264 -245 -4.32711 0.244
NP_440558.1_2 Reverse -154 -173 -5.9004 0.267
NP_440274.1_2 Forward -109 -95 11.5037 0.26
NP_441878.1_6 Reverse -250 -260 10.7964 0.0176
NP_441878.1_6 Forward -261 -251 1.455 0.0979
NP_441878.1_6 Reverse -13 -23 0.766681 0.134
NP_441878.1_6 Forward -318 -308 -0.0199663 0.163
NP_441878.1_6 Reverse -307 -317 -7.19813 0.21
NP_441036.1_3 Forward -203 -184 2.94938 0.168
NP_441036.1_7 Reverse -96 -106 15.8108 0.292
NP_441036.1_8 Reverse -236 -246 7.94484 0.181
NP_442650.1_2 Reverse -90 -104 2.75286 0.246
NP_441557.1_5 Reverse -237 -246 7.57121 0.049
NP_441557.1_5 Forward -246 -237 1.08137 0.0794
NP_441557.1_5 Reverse -14 -23 0.491382 0.144
NP_441557.1_5 Forward -23 -14 0.29472 0.174
NP_441308.1_8 Reverse -235 -245 10.5998 0.22
NP_440101.1_3 Forward -178 -159 0.491109 0.298
NP_441458.1_10 Reverse -374 -393 11.5042 0.108
NP_442183.1_1 Forward -246 -232 5.1128 0.231
NP_441407.1_5 Reverse -184 -203 8.35759 0.158
NP_442166.1_7 Reverse -238 -252 10.816 0.19
NP_441116.1_9 Reverse -157 -171 11.6026 0.276
NP_440276.1_8 Forward -114 -95 5.80098 0.3
NP_441549.1_9 Forward -264 -246 -10.2073 0.273
NP_442347.1_2 Reverse -238 -247 5.60459 0.229
NP_442347.1_2 Forward -22 -13 5.40793 0.23
NP_442347.1_2 Reverse -195 -204 4.52295 0.282
NP_442347.1_2 Reverse -355 -364 4.32629 0.284
NP_442965.1_2 Reverse -261 -280 -7.96535 0.277
NP_441037.1_4 Reverse -249 -259 6.92787 0.237
NP_442594.1_10 Forward -267 -248 8.25844 0.288
NP_441633.1_3 Forward -25 -12 0.805932 0.115
NP_441633.1_3 Forward -262 -249 -3.52063 0.177
NP_441633.1_3 Reverse -235 -248 -4.30728 0.191
NP_440136.1_2 Reverse -238 -245 6.43063 0.154
NP_440136.1_2 Forward -245 -238 6.23397 0.171
NP_440136.1_2 Forward -202 -195 4.26735 0.218
NP_442998.1_5 Forward -362 -352 7.35486 0.295
NP_442998.1_10 Reverse -239 -246 5.93897 0.206
NP_442998.1_10 Forward -21 -14 5.93897 0.206
NP_441799.1_1 Forward -321 -307 8.06211 0.125
NP_441799.1_1 Forward -250 -236 4.12889 0.266
NP_441559.1_8 Forward -171 -157 -3.24533 0.199
NP_441559.1_8 Reverse -313 -327 -4.91696 0.241
NP_441559.1_8 Forward -251 -237 -5.9986 0.271
NP_441559.1_8 Forward -265 -251 -6.19526 0.275
NP_441559.1_8 Forward -44 -30 -6.58858 0.279
NP_440915.1_4 Forward -370 -352 21.6511 0.118
NP_442866.1_1 Reverse -232 -251 -8.94866 0.285
NP_442866.1_1 Reverse -312 -331 -9.73531 0.298
NP_440748.1_4 Reverse -78 -97 18.6815 0.137
NP_440748.1_5 Reverse -296 -315 3.14605 0.21
NP_441939.1_3 Forward -362 -343 5.89931 0.259
NP_442993.1_1 Forward -89 -73 -11.7412 0.257
NP_442386.1_9 Reverse -236 -245 5.0142 0.27
NP_442386.1_9 Forward -204 -195 4.7192 0.289
NP_442386.1_10 Reverse -84 -97 4.64084 0.262
NP_441340.1_5 Forward -245 -238 5.93897 0.198
NP_441340.1_5 Reverse -238 -245 5.84064 0.208
NP_441947.1_4 Forward -214 -195 10.1275 0.3
NP_442484.1_2 Forward -229 -210 7.57094 0.15
NP_442240.1_1 Forward -35 -16 4.81688 0.268
NP_442240.1_2 Reverse -238 -257 -13.3736 0.167
NP_441160.1_1 Reverse -258 -277 -11.4069 0.292
NP_440586.1_1 Forward -90 -71 -4.91709 0.278
NP_440586.1_8 Reverse -15 -22 12.6251 0.0546
NP_440586.1_8 Forward -245 -238 11.1501 0.0845
NP_442251.1_6 Forward -245 -238 13.7071 0.0268
NP_440192.1_4 Forward -263 -244 10.4648 0.237
NP_440969.1_3 Forward -146 -128 13.4897 0.214
NP_440027.1_3 Reverse -251 -269 1.69003 0.299
NP_440027.1_8 Forward -206 -187 4.32522 0.291
NP_443051.1_1 Forward -247 -238 9.83282 0.0203
NP_443051.1_1 Reverse -13 -22 -1.18024 0.297
NP_439937.1_8 Reverse -246 -265 -4.03212 0.276
NP_439937.1_9 Forward -262 -245 -13.3348 0.285
NP_440439.1_1 Forward -366 -353 1.59258 0.148
NP_440439.1_1 Forward -249 -236 0.215946 0.199
NP_440372.1_2 Forward -245 -238 6.62729 0.151
NP_440372.1_2 Reverse -238 -245 6.52896 0.188
NP_441789.1_7 Reverse -299 -318 -2.8529 0.264
NP_441803.1_2 Forward -278 -259 -0.787193 0.286
NP_440139.1_1 Forward -179 -160 1.08032 0.272
NP_440267.1_2 Reverse -9 -23 18.3868 0.0267
NP_442384.1_10 Reverse -237 -250 8.86907 0.0606
NP_442384.1_10 Reverse -14 -27 7.19745 0.0866
NP_442384.1_10 Reverse -308 -321 6.4108 0.102
NP_442384.1_10 Reverse -251 -264 4.93583 0.142
NP_442384.1_10 Forward -309 -296 2.08423 0.237
NP_442384.1_10 Forward -23 -10 1.88757 0.243
NP_442384.1_10 Forward -246 -233 1.19926 0.267
NP_440693.1_8 Reverse -260 -279 11.4058 0.283
NP_442114.1_8 Reverse -49 -63 3.44058 0.295
NP_440163.1_10 Reverse -297 -307 10.5998 0.201
NP_440344.1_10 Forward -210 -193 -11.0726 0.2
NP_440531.1_6 Reverse -243 -262 4.916 0.119
NP_440531.1_6 Forward -268 -249 1.76941 0.169
NP_440562.1_1 Reverse -161 -180 10.2251 0.296
NP_440562.1_3 Reverse -238 -255 12.6252 0.0927
NP_441965.1_10 Reverse -248 -264 2.61514 0.285
NP_440297.1_9 Forward -259 -249 -0.0199663 0.282
NP_440297.1_9 Forward -245 -235 -0.118297 0.282
NP_442280.1_10 Forward -114 -96 15.5841 0.109
NP_440999.1_9 Forward -94 -80 6.98109 0.0925
NP_440999.1_9 Reverse -233 -247 -0.295402 0.203
NP_440888.1_2 Forward -111 -97 7.47213 0.194
NP_442892.1_9 Forward -72 -58 11.4053 0.296
NP_439969.1_3 Forward -262 -243 -2.0655 0.294
NP_442948.1_2 Reverse -80 -99 2.75272 0.3
NP_442033.1_10 Reverse -315 -334 -11.8003 0.258
NP_440575.1_8 Forward -188 -169 -0.000545616 0.185
NP_441543.1_2 Reverse -15 -24 11.9961 0.047
NP_441543.1_2 Reverse -195 -204 7.27622 0.13
NP_441543.1_2 Reverse -238 -247 6.09625 0.153
NP_441543.1_2 Forward -245 -236 5.89959 0.169
NP_442845.1_8 Reverse -155 -174 12.5858 0.291
NP_441551.1_5 Forward -264 -248 7.82599 0.241
NP_441469.1_8 Reverse -236 -245 7.07956 0.227
NP_442315.1_4 Forward -125 -107 10.6381 0.198
NP_443064.1_6 Forward -39 -29 10.5308 0.148
NP_442578.1_7 Reverse -15 -22 12.6255 0.0418
NP_442578.1_7 Forward -245 -238 12.5271 0.0544
NP_440710.1_1 Forward -31 -13 -6.56903 0.225
NP_441462.1_2 Reverse -237 -247 0.57002 0.144
NP_441462.1_2 Forward -23 -13 0.471689 0.148
NP_441462.1_2 Forward -317 -307 -0.806614 0.254
NP_441621.1_7 Reverse -235 -249 -4.81863 0.246
NP_441621.1_10 Reverse -245 -264 10.2259 0.231
NP_443062.1_1 Forward -309 -291 7.76586 0.168
NP_441601.1_4 Forward -97 -78 9.3409 0.155
NP_440519.1_6 Forward -116 -102 11.3077 0.29
NP_442204.1_1 Forward -250 -239 11.3667 0.0565
NP_442204.1_5 Reverse -241 -260 1.57275 0.232
NP_441560.1_3 Reverse -252 -270 17.2271 0.159
NP_441560.1_5 Reverse -1 -20 16.8141 0.204
NP_441560.1_8 Reverse -69 -88 11.7075 0.287
NP_440516.1_8 Forward -246 -237 -0.196935 0.185
NP_440516.1_8 Forward -203 -194 -0.491928 0.262
NP_440516.1_8 Reverse -300 -309 -0.590259 0.283
NP_442428.1_5 Reverse -238 -245 13.1171 0.038
NP_442428.1_5 Forward -245 -238 6.23397 0.201
NP_442779.1_5 Forward -322 -303 18.3873 0.156
NP_440673.1_3 Reverse -239 -246 10.1672 0.149
NP_440673.1_3 Forward -21 -14 10.1672 0.149
NP_441052.1_2 Reverse -14 -24 13.5497 0.0285
NP_441052.1_2 Reverse -194 -204 5.97822 0.0968
NP_441052.1_2 Reverse -237 -247 -0.41329 0.277
NP_442219.1_9 Reverse -238 -247 5.01461 0.193
NP_440436.1_4 Reverse -195 -204 5.60418 0.188
NP_440314.1_9 Forward -49 -30 4.32602 0.0805
NP_440314.1_9 Forward -22 -3 -9.53865 0.269
NP_441719.1_4 Forward -245 -238 6.62729 0.151
NP_441719.1_4 Reverse -238 -245 6.52896 0.188
NP_441719.1_4 Reverse -15 -22 3.77569 0.285
NP_442813.1_4 Forward -113 -94 -7.37537 0.299
NP_442366.1_3 Reverse -130 -148 -3.91409 0.26
NP_442366.1_5 Forward -320 -310 12.6642 0.112
NP_440296.1_4 Reverse -366 -385 15.6292 0.286
NP_440296.1_10 Reverse -248 -267 -12.3902 0.269
NP_441115.1_4 Forward -261 -243 10.6381 0.17
NP_441115.1_4 Forward -247 -229 8.3765 0.25
NP_441851.1_10 Reverse -236 -246 5.09324 0.227
NP_441851.1_10 Reverse -13 -23 4.20827 0.282
NP_442814.1_10 Forward -260 -241 2.65439 0.29
NP_441668.1_4 Forward -327 -308 -2.95047 0.299
NP_442515.1_1 Forward -247 -233 2.45787 0.135
NP_442515.1_1 Forward -318 -304 1.76955 0.149
NP_442515.1_1 Reverse -13 -27 0.786239 0.18
NP_441349.1_10 Reverse -184 -203 -4.13045 0.161
NP_441409.1_6 Reverse -231 -250 -12.5869 0.229
NP_442843.1_1 Forward -196 -177 -10.9153 0.282
NP_442843.1_1 Forward -371 -352 -11.6036 0.291
NP_440474.1_8 Forward -245 -231 12.8803 0.0782
NP_440588.1_2 Forward -102 -83 -1.57384 0.155
NP_440588.1_2 Forward -255 -236 -3.73712 0.195
NP_440588.1_2 Forward -269 -250 -5.01543 0.236
NP_440588.1_2 Reverse -185 -204 -6.1954 0.273
NP_442006.1_2 Reverse -251 -268 -15.7924 0.228
NP_441003.1_9 Forward -114 -95 5.11266 0.268
NP_441570.1_1 Reverse -14 -32 -15.5171 0.231
NP_441570.1_1 Reverse -158 -176 -17.5821 0.283
NP_441078.1_4 Reverse -194 -203 5.70292 0.111
NP_441078.1_4 Reverse -14 -23 0.393051 0.205
NP_441078.1_4 Forward -246 -237 0.393051 0.205
NP_441078.1_4 Reverse -237 -246 -0.000272808 0.205
NP_441078.1_4 Forward -23 -14 -0.000272808 0.205
NP_441078.1_4 Reverse -251 -260 -1.37691 0.254
NP_441078.1_4 Forward -260 -251 -1.47524 0.266
NP_441078.1_4 Reverse -308 -317 -1.86856 0.272
NP_440539.1_9 Reverse -253 -272 -0.983855 0.286
NP_442348.1_2 Forward -261 -252 6.68623 0.299
NP_442443.1_4 Reverse -52 -62 16.1058 0.155
NP_441432.1_8 Forward -247 -238 13.7661 0.0281
NP_441432.1_8 Reverse -101 -110 2.85133 0.281
NP_442815.1_2 Reverse -91 -109 17.0304 0.0672
NP_441057.1_3 Forward -268 -249 -11.7019 0.24
NP_441072.1_2 Forward -367 -348 10.6192 0.199
NP_442489.1_2 Reverse -232 -251 1.76941 0.285
NP_442489.1_7 Forward -23 -14 7.47288 0.0613
NP_442489.1_7 Forward -246 -237 0.688044 0.152
NP_442489.1_7 Reverse -14 -23 0.688044 0.152
NP_442489.1_7 Reverse -237 -246 0.491382 0.178
NP_442489.1_7 Reverse -308 -317 -1.37691 0.195
NP_442489.1_7 Reverse -251 -260 -1.37691 0.195
NP_442489.1_7 Forward -260 -251 -1.47524 0.203
NP_440559.1_1 Reverse -15 -24 4.62128 0.24
NP_441659.2_8 Forward -317 -307 6.17489 0.084
NP_441659.2_8 Reverse -237 -247 1.55333 0.238
NP_441659.2_8 Forward -23 -13 -0.118297 0.287
NP_440426.1_7 Reverse -4 -23 0.196116 0.264
NP_442913.1_10 Reverse -299 -318 -2.55715 0.187
NP_441040.1_2 Forward -268 -249 0.294447 0.126
NP_441040.1_2 Forward -269 -250 -7.17871 0.208
NP_442346.1_5 Forward -247 -237 11.6814 0.0606
NP_442346.1_5 Forward -318 -308 9.61647 0.118
NP_442346.1_5 Reverse -250 -260 6.66654 0.195
NP_442346.1_5 Reverse -13 -23 5.48657 0.243
NP_442346.1_10 Forward -271 -252 5.70265 0.168
NP_440545.1_3 Reverse -247 -264 1.71047 0.114
NP_440545.1_3 Forward -250 -233 -6.15601 0.27
NP_442551.1_4 Reverse -249 -264 -2.57671 0.271
NP_441585.1_5 Reverse -344 -363 5.60352 0.211
NP_440449.1_6 Reverse -243 -261 8.25583 0.203
NP_441948.1_4 Forward -210 -192 -4.40575 0.228
NP_441833.1_4 Reverse -238 -245 6.3323 0.134
NP_441833.1_4 Forward -245 -238 6.23397 0.163
NP_441329.1_6 Reverse -206 -225 5.58586 0.191
NP_442162.1_9 Forward -245 -238 6.52896 0.178
NP_442162.1_9 Reverse -238 -245 6.43063 0.208
NP_440875.1_9 Reverse -239 -249 12.4602 0.117
NP_441813.1_5 Forward -248 -238 8.4365 0.0432
NP_441813.1_5 Reverse -235 -245 6.56821 0.0875
NP_440590.1_4 Reverse -238 -251 -4.89726 0.269
NP_442497.1_10 Reverse -238 -247 7.76787 0.0731
NP_442497.1_10 Forward -22 -13 0.196389 0.208
NP_442497.1_10 Forward -245 -236 -1.18024 0.256
NP_440821.1_4 Reverse -235 -245 8.82982 0.0395
NP_440821.1_4 Forward -205 -195 6.17489 0.0954
NP_441239.1_9 Forward -262 -250 8.79043 0.122
NP_441239.1_9 Reverse -249 -261 7.70879 0.15
NP_441239.1_9 Forward -311 -299 3.87389 0.272
NP_441239.1_9 Reverse -235 -247 3.67722 0.279
NP_441951.1_9 Forward -268 -249 2.0644 0.254
NP_442568.1_5 Reverse -264 -283 11.8975 0.215
NP_442568.1_8 Reverse -50 -64 8.16106 0.292
NP_442643.1_1 Reverse -231 -250 -4.32711 0.231
NP_440354.1_5 Forward -114 -95 3.83436 0.236
NP_441617.1_6 Forward -225 -206 -1.27885 0.256
NP_442052.1_8 Reverse -249 -259 11.8781 0.297
NP_442809.1_6 Forward -203 -184 2.45773 0.265
NP_441230.1_5 Forward -20 -1 0.294447 0.271
NP_440462.1_6 Forward -248 -238 9.02648 0.0498
NP_440462.1_6 Forward -205 -195 3.91327 0.224
NP_440462.1_6 Forward -365 -355 3.22496 0.255
NP_442340.1_3 Reverse -253 -272 -7.96535 0.241
NP_442611.1_1 Reverse -237 -256 9.24257 0.12
NP_442144.1_1 Reverse -234 -250 11.9566 0.28
NP_440868.1_1 Reverse -88 -107 20.2556 0.077
NP_441474.1_1 Forward -319 -300 2.06362 0.247
NP_440696.1_3 Forward -270 -252 1.10079 0.22
NP_442696.1_6 Forward -264 -245 -11.8986 0.244
NP_442837.1_3 Reverse -238 -245 13.5105 0.0268
NP_442837.1_3 Forward -22 -15 9.87221 0.106
NP_442837.1_3 Forward -245 -238 6.13563 0.25
NP_442053.1_1 Forward -23 -14 6.5879 0.124
NP_442053.1_1 Forward -203 -194 4.52295 0.242
NP_440505.1_3 Forward -205 -195 11.5831 0.0735
NP_440505.1_3 Forward -248 -238 7.55152 0.151
NP_440505.1_7 Forward -264 -245 6.4893 0.165
NP_441408.2_7 Reverse -94 -113 -3.44213 0.272
NP_440914.1_1 Reverse -14 -24 6.07773 0.297
NP_441011.1_8 Reverse -238 -247 13.8644 0.0295
NP_441011.1_8 Reverse -195 -204 10.6195 0.101
NP_442101.1_10 Reverse -300 -319 2.75272 0.0714
NP_442101.1_10 Forward -317 -298 -6.88371 0.205
NP_442101.1_10 Forward -254 -235 -8.65367 0.242
NP_442533.1_6 Reverse -251 -260 7.27622 0.0928
NP_442533.1_6 Forward -260 -251 7.17789 0.0948
NP_442533.1_6 Forward -317 -308 5.60459 0.137
NP_442533.1_6 Forward -246 -237 5.3096 0.145
NP_442533.1_6 Reverse -14 -23 4.91628 0.165
NP_442533.1_6 Reverse -308 -317 3.7363 0.204
NP_442541.1_3 Reverse -241 -260 3.83436 0.29
NP_442541.1_10 Reverse -251 -265 3.8339 0.252
NP_442232.1_3 Forward -367 -348 -15.4385 0.291
NP_441219.1_6 Reverse -250 -268 9.75391 0.273
NP_441482.1_7 Forward -252 -238 -2.85201 0.1
NP_440816.1_2 Reverse -205 -224 7.79033 0.26
NP_441028.1_6 Forward -162 -152 8.43603 0.216
NP_441028.1_6 Forward -256 -246 6.37109 0.23
NP_442202.1_10 Reverse -250 -264 16.4209 0.106
NP_440116.1_8 Reverse -238 -257 -2.55715 0.135
NP_441527.1_4 Reverse -52 -71 -6.35064 0.217
NP_441527.1_4 Reverse -49 -68 -10.0748 0.264
NP_440115.1_6 Reverse -11 -21 13.4514 0.0733
NP_440115.1_6 Forward -249 -239 11.1898 0.115
NP_440007.1_9 Forward -250 -236 2.85119 0.277
NP_439965.1_1 Forward -176 -157 -10.4236 0.3
NP_441106.1_1 Forward -247 -238 8.75118 0.0469
NP_442928.1_6 Forward -23 -10 18.1122 0.247
NP_441286.1_1 Forward -24 -12 -4.18925 0.152
NP_440670.1_8 Forward -246 -237 6.78456 0.099
NP_440670.1_8 Reverse -237 -246 5.3096 0.167
NP_441930.1_2 Forward -167 -157 12.0747 0.266
NP_440886.1_7 Forward -318 -308 6.17443 0.141
NP_440886.1_7 Forward -94 -84 6.17443 0.141
NP_440886.1_7 Reverse -299 -309 5.97777 0.151
NP_440886.1_7 Reverse -193 -203 4.69947 0.22
NP_442614.1_2 Forward -203 -189 6.88276 0.28
NP_439995.1_10 Forward -262 -243 5.11266 0.296
NP_442072.1_9 Forward -364 -346 -23.187 0.284
NP_440907.2_8 Reverse -355 -365 3.8145 0.297
NP_440841.1_4 Reverse -4 -23 -7.86702 0.249
NP_441463.1_3 Reverse -227 -246 -7.4737 0.258
NP_441463.1_6 Forward -169 -155 6.3193 0.274
NP_441626.1_2 Forward -245 -238 6.0373 0.212
NP_441626.1_2 Reverse -238 -245 5.93897 0.231
NP_440107.1_5 Forward -40 -21 -7.27704 0.281
NP_441488.1_8 Forward -251 -237 16.1252 0.146
NP_441836.1_2 Reverse -231 -250 -5.31042 0.277
NP_441993.1_1 Forward -260 -241 5.16278 0.207
NP_440143.1_1 Reverse -93 -112 17.2074 0.205
NP_440814.1_8 Reverse -90 -109 0.294447 0.269
NP_440114.1_10 Forward -167 -153 5.99778 0.289
NP_442323.1_7 Forward -251 -232 4.62021 0.215
NP_441510.2_9 Reverse -15 -34 8.35759 0.165
NP_439988.1_7 Reverse -166 -180 14.9452 0.292
NP_439910.1_2 Reverse -229 -246 -3.40274 0.0452
NP_442867.1_8 Forward -268 -249 5.40766 0.276
NP_440457.1_1 Reverse -10 -22 0.432302 0.25
NP_440213.1_5 Forward -116 -97 8.55425 0.275
NP_440987.1_6 Forward -292 -273 10.5334 0.262
NP_440801.1_10 Reverse -244 -263 4.32602 0.291
NP_441332.1_6 Forward -94 -84 16.9714 0.0994
NP_440473.1_1 Forward -249 -230 11.3538 0.276
NP_442509.1_9 Forward -39 -29 11.9759 0.107
NP_442509.1_9 Forward -23 -13 8.63269 0.192
NP_441253.1_1 Forward -315 -296 5.211 0.264
NP_440554.1_4 Reverse -238 -248 8.33817 0.0773
NP_440554.1_4 Forward -245 -235 6.17489 0.126
NP_441885.1_5 Reverse -14 -24 2.04498 0.0868
NP_440423.1_6 Reverse -6 -25 -15.1435 0.229
NP_443000.1_7 Forward -248 -238 17.4829 0.00719
NP_443000.1_7 Forward -25 -15 7.25653 0.0927
NP_443000.1_8 Forward -279 -260 12.6841 0.296
NP_440275.1_3 Forward -248 -238 6.37155 0.111
NP_441397.1_8 Forward -194 -181 16.5819 0.142
NP_442451.1_2 Forward -268 -249 -6.68705 0.232
NP_442495.1_4 Reverse -241 -251 16.303 0.0771
NP_440216.1_1 Reverse -237 -251 -2.55701 0.0521
NP_440216.1_1 Forward -23 -9 -3.93365 0.0918
NP_440216.1_1 Forward -317 -303 -4.4253 0.111
NP_440216.1_1 Reverse -251 -265 -10.6202 0.145
NP_440216.1_1 Reverse -14 -28 -11.1118 0.163
NP_440216.1_1 Forward -203 -189 -12.0951 0.24
NP_440172.1_1 Reverse -14 -24 2.43831 0.279
NP_440167.1_3 Reverse -86 -105 9.53756 0.251
NP_442015.1_3 Forward -319 -300 20.0581 0.155
NP_442015.1_10 Forward -250 -237 0.904263 0.216
NP_442015.1_10 Reverse -233 -246 0.412608 0.227
NP_442015.1_10 Forward -30 -17 0.117615 0.241
NP_442015.1_10 Reverse -10 -23 -0.0790467 0.25
NP_441111.1_7 Reverse -238 -246 8.86921 0.0589
NP_440244.1_1 Reverse -93 -112 -9.24366 0.287
NP_441766.1_2 Reverse -237 -246 6.39124 0.0993
NP_442507.1_4 Reverse -236 -255 22.4189 0.0443
NP_440416.1_9 Forward -34 -15 -18.6834 0.262
NP_440416.1_9 Forward -30 -11 -18.9784 0.267
NP_440416.1_9 Forward -106 -87 -19.7651 0.278
NP_443052.1_8 Reverse -227 -246 -11.0136 0.221
NP_441135.1_4 Forward -210 -191 6.4893 0.284
NP_440261.1_5 Forward -259 -246 5.03416 0.0478
NP_440261.1_5 Reverse -238 -251 -3.12731 0.115
NP_440261.1_5 Reverse -252 -265 -6.17557 0.196
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CAATCCGCTTCGACAGGAAATACTAAACCAAAATGGCGGGGATAGATGCCCGGTTGTTTTACTAAAGGTTCCAGGGTAATGTGGGCCACCACCTGATGGCCGTAGAAATCTAGAATTATTGCCTTATCGGTTTCTCTGCCGGCCTTGGCCCCCAGGCGATCACAGTAAAATTCCTTAGTTTTCGCAATATCATTAACGGGGATAGCGAGGTGAAAAATAACGGGGCCTGTCATCGGAATTGCCCTCTAGTCTTACAAATCAACACTGACCCTTTCATTCTAAGCGTCTTACCCTTTGCCTTTAGCACCCCCGTCACCGGCTGTTAACTTGACCTCTTTTTTTTGCATTTTGGAGTTAGGCTGAGAATCCCCCTGTCTGTTGATCGCCCGGTTACCTTGCC

CDS

ATGGCCTACGAACCTCTGCACCATAAATATCGCCCCCAGACCTTTGCAGATTTGGTGGGCCAAACGGCGATCGCCGCCACATTGAGCAATGCCATTGAACAGGAGCGCATCGTACCTGCTTACCTATTTACGGGCCCCAGGGGAACGGGAAAAACTTCTTCAGCCCGAATTTTAGCCAAATCCTTAAACTGCATCGCTGGCGATCGGCCTACTGCCACTCCCTGCGGCCAATGTGCCACCTGTCGGGCTATTACTAACGGTTCAGCTTTAGACGTAATTGAAATTGATGCGGCCAGTAATACAGGGGTAGATAATATCCGAGAAATTATTGAACGGGCTCAATTTGCCCCAGTACAGTGCAGATATAAAGTATATGTGATCGATGAATGCTTAACGGGGGACTCACAAGTTTTGACCCGCAATGGCTTAATGTCCATTGACAATCCCCAAATAAAAGGGCGAGAAGTTCTGAGCTACAACGAAACTCTACAGCAATGGGAATATAAAAAAGTTTTAAGATGGCTTGACAGAGGCGAAAAGCAAACATTGTCTATTAAGACAAAAAATTCTACAGTACGGTGTACGGCTAACCATTTAATCAGAACTGAACAAGGATGGACGAGAGCGGAAAACATCACTCCCGGAATGAAGATACTATCCCCTGCGAGTGTGGATGTGGACAATTTATCGCAAAGTACGGCACTGACCGCAAGCTTAGGCGGTTTGTCCGGGGCCATCAACTACGAGGCAATCAATACGGACAAAAAAAATACGACCTTATCTCTATCCTTGAAGAAGCAGAAGCCACAAGACCCTTTTGTCAATGCGGATGTGGCGAAAAACTTGATATTCCAGCATTTTTGCAGTGCAAAGGAAGAGAAATTAAAAGTATCCAATCCCATTGGCGAAGACATCCCTACAAAAAAAGCCACGGACTTTGGGATCTCAGAACAGAAAAAATTACATCAGGGTCAGAACCGTTGGGAGCAGAAATTCTCGGTCTTATCTACGGAACCTTGCTTGGGGATGGAAGTATTGACTATCCCAACCCACATAGCCGATTCCCCCGCTTGCGATGGACCCACGGCACCAAGCAGTCAGAATGGATGGAATATAAAGCGGCAAGACTGGGATGTCTGTCACCCAAAATACGATTCACAGCCAATAAAGGCTATGGGGAAAGTTCCATCTGCTGTCAAACCCGTTGTTCCCCAAACCTTATTGATGTTTTCAGCACAGTCAAACCTGGAGGTAAAAGAAAACAAGTTTCTTCGGAATGGCTCTCGCATATCACTGAAGAAGGAATGGCTTGGTGGTACATGGACGACGGTTCCCTCTCTATTTCCGAATCTGGGAGTCCATCAATTCAGTTACACACAGAGGGCTTTTTCCCGGAAGAAAATCAACTTATTGCTGAATGGCTTACCGATAGAGGATATCCCACCAGTGCAAAATCCTATCGCAGAAGCATTAACAGCAAAACCTATTACTACACAAAAATGGGAGCAGTGGCCACCCGCAAGTGGTTATCGGACTTGGAAATCTATTCCATCCCCGCAATGGCATACAAATTTCGAGGAAGTTGAGTCCGTCACTAAGGGTCAAGTGGAAAAAGTTTATGACCTGGAGGTGGAAGATAATCACAATTTTGTTGCCAATGGCTTACTAGTCCATAACTGTCATATGTTGAGCACGGCCGCATTCAATGCCCTGCTAAAAACCTTGGAAGAGCCACCGGAGCGGGTTGTTTTTGTCCTCGCTACCACCGATCCCCAGCGGGTTTTACCCACCATTATTTCCCGGTGTCAGCGGTTTGATTATCGCCGCATTCCTTTGCAGGCCATGGTGGACCATCTCCGTTATATTGCTGGGCGAGAAAATATTAATATTGACCAACCAGCTTTGACCCTAGTGGCCCAAATTGCCAATGGTGGTTTACGGGATGCGGAAAGTTTACTCGATCAATTAAGTCTGCTCCCCGACCTGATTACCCCCGATAAAGTTTGGGACCTCGTGGGGGCGGTGCCGGAACAGGATTTGTTAGCCCTCCTAGAGGCGATCGCCAGTGACGATGCAGAAACCCTATTGGCTACCTGTCGGCAGATTTTGAACCGGGGGCGGGAACCCTTGGTGGTATTGCAAAATTTAGCCAGTTTTTATTTGAATTTACTTATTGCCCAAACAGCTCCCCAACGCTCAGATTTGGTGGCGGTGACGGCGGAAACCTGGCAAGCCCTGTGTGACACGGCGCCCCAATGGCAAAGGGGAGTGATTTTGCAAGGACAACAAAAACTTAAGGAAAGTGAAATCCAAATTCGTAACACTACCCAGCCCCGACTTTGGCTAGAGGTGACCCTGTTGGGGCTGTTGCCATCCGCCTGTGGGTTGGACACTGGGGCAGTTAGTCAAACGGCAGTTAGAACACCTGTGGCTCAACCAATAACTCCGCCAAAGCCCAGTAATGTGGTGACTTTCCCTGGTGGCTCACACAACCATCTAACCGTGGTGGATTCTCCTACAATGATTCCTGTTTCTGAACCTATTGTTCTAGAAGAGAAGCTAGAAGCAGATGTAGAGCCATCCAGCTTTGAGCCGAGCAACGCCCATTGGGATCTGACCCAGTTATGGTCGGAAACGTTAAACAATCTAGGGGCGCTCAGTCAATCTTTATTTAAATCCTTTGGTTCTTTGATCAATTTGGTGGGGAATAATGCCACCGTCAGTGTTACCACCCAACAACTGCTTAAAATTGCGGCGGGCAAAAAGGATGAATTGGAAGCGGCCCTAGGGCAAGCCTGTGGCCAATCGGTGAAAGTGAATTTGGTGGTGGGTAAGCCATCGACCCCGGAAACTACTCCGGTTAACAGCGCTCCTCCCCCTAGCCATAGTAAGCCGCCAGCCTTTGCTCCAGAGCCAAGCCCTCCCCCCACCGCAGCGGTTAATGCTAATCCGGCTCCCACTGTGCCTCCTTCTCCCCCGGCGATCGCCAGGGGCCCCGCTACATCGGAAATAAAACCTTCCCCCCGACGGGAATCAAATAATTTCTCTAATCCTTCTCGGCCCAAACCAAAACCGGCTCCAGCCATGGAAGAGCCGCCTCCGACAGATATTGGTGACAGTGCCACCCGCAAGGCGATCGAGCAGTTTGCCAAAAATTTTGACGGGGAAATTGTGGCATCCGATGCGGCTCCCAAACAGGAATCGGATAATGGCGATGATTTATCTACGGAACCAACGGCGGAACTTGGTCAGCAACCCATGGATCACAATGGACATCTGCAAATTAACCAACCCACCGTCCTGAACCGACCGGCGATCGCCCCGGAGGAAGAAGAAGATCTACCTTTTTAG

Protein

MAYEPLHHKYRPQTFADLVGQTAIAATLSNAIEQERIVPAYLFTGPRGTGKTSSARILAKSLNCIAGDRPTATPCGQCATCRAITNGSALDVIEIDAASNTGVDNIREIIERAQFAPVQCRYKVYVIDECLTGDSQVLTRNGLMSIDNPQIKGREVLSYNETLQQWEYKKVLRWLDRGEKQTLSIKTKNSTVRCTANHLIRTEQGWTRAENITPGMKILSPASVDVDNLSQSTALTASLGGLSGAINYEAINTDKKNTTLSLSLKKQKPQDPFVNADVAKNLIFQHFCSAKEEKLKVSNPIGEDIPTKKATDFGISEQKKLHQGQNRWEQKFSVLSTEPCLGMEVLTIPTHIADSPACDGPTAPSSQNGWNIKRQDWDVCHPKYDSQPIKAMGKVPSAVKPVVPQTLLMFSAQSNLEVKENKFLRNGSRISLKKEWLGGTWTTVPSLFPNLGVHQFSYTQRAFSRKKINLLLNGLPIEDIPPVQNPIAEALTAKPITTQKWEQWPPASGYRTWKSIPSPQWHTNFEEVESVTKGQVEKVYDLEVEDNHNFVANGLLVHNCHMLSTAAFNALLKTLEEPPERVVFVLATTDPQRVLPTIISRCQRFDYRRIPLQAMVDHLRYIAGRENINIDQPALTLVAQIANGGLRDAESLLDQLSLLPDLITPDKVWDLVGAVPEQDLLALLEAIASDDAETLLATCRQILNRGREPLVVLQNLASFYLNLLIAQTAPQRSDLVAVTAETWQALCDTAPQWQRGVILQGQQKLKESEIQIRNTTQPRLWLEVTLLGLLPSACGLDTGAVSQTAVRTPVAQPITPPKPSNVVTFPGGSHNHLTVVDSPTMIPVSEPIVLEEKLEADVEPSSFEPSNAHWDLTQLWSETLNNLGALSQSLFKSFGSLINLVGNNATVSVTTQQLLKIAAGKKDELEAALGQACGQSVKVNLVVGKPSTPETTPVNSAPPPSHSKPPAFAPEPSPPPTAAVNANPAPTVPPSPPAIARGPATSEIKPSPRRESNNFSNPSRPKPKPAPAMEEPPPTDIGDSATRKAIEQFAKNFDGEIVASDAAPKQESDNGDDLSTEPTAELGQQPMDHNGHLQINQPTVLNRPAIAPEEEEDLPF