Your browser is old and dusty. Try Google Chrome!

Details for sll1290

ORF sll1290
Accession NP_440523.1
Symbol
Category Degradation of RNA
Definition probable ribonuclease II
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -322 -336 14.8476 0.12
NP_441061.1_2 Forward -330 -316 14.7492 0.0392
NP_440795.1_7 Forward -330 -323 14.6904 0.0123
NP_440795.1_7 Reverse -323 -330 14.6904 0.0123
NP_441418.1_6 Reverse -322 -341 -28.8115 0.211
NP_441418.1_6 Forward -331 -312 -29.0082 0.215
NP_441418.1_6 Forward -190 -171 -29.2048 0.219
NP_441480.1_1 Reverse -50 -69 -0.885524 0.287
NP_442291.1_5 Reverse -321 -337 -1.80975 0.202
NP_441453.1_4 Reverse -322 -330 16.539 0.00633
NP_441453.1_4 Forward -331 -323 16.539 0.00633
NP_441453.1_7 Reverse -268 -275 12.9205 0.23
NP_441453.1_7 Reverse -60 -67 11.6422 0.298
NP_441623.1_1 Reverse -253 -271 2.47742 0.206
NP_441623.1_1 Reverse -45 -63 -4.8974 0.28
NP_442151.1_6 Forward -331 -317 16.8142 0.0138
NP_441818.1_9 Forward -190 -171 -7.76869 0.273
NP_440226.1_1 Reverse -322 -341 10.1275 0.0654
NP_440259.1_4 Reverse -374 -388 9.31072 0.278
NP_442744.1_8 Forward -331 -312 -4.81876 0.297
NP_442655.1_2 Forward -384 -365 4.03102 0.23
NP_442173.1_1 Forward -330 -322 15.4574 0.00633
NP_442173.1_1 Reverse -323 -331 15.4574 0.00633
NP_442752.1_4 Forward -331 -324 13.8055 0.0199
NP_442752.1_4 Reverse -322 -329 13.8055 0.0199
NP_443027.1_4 Forward -333 -323 13.2547 0.0521
NP_441745.1_3 Forward -266 -247 17.4032 0.201
NP_441745.1_3 Reverse -151 -170 14.4533 0.253
NP_442975.1_10 Forward -335 -321 4.22722 0.245
NP_442975.1_10 Reverse -318 -332 2.65393 0.269
NP_441225.1_1 Reverse -324 -343 -3.44213 0.191
NP_440784.1_7 Forward -330 -323 15.9687 0.0123
NP_440784.1_7 Reverse -323 -330 15.9687 0.0123
NP_440784.1_7 Reverse -170 -177 6.43063 0.218
NP_442909.1_7 Forward -330 -316 11.4053 0.131
NP_442000.2_6 Forward -189 -170 15.3391 0.241
NP_440061.1_9 Reverse -320 -334 11.5037 0.109
NP_440061.1_9 Forward -333 -319 10.5204 0.124
NP_441054.1_2 Reverse -130 -149 9.93088 0.284
NP_442062.1_8 Forward -331 -321 17.3846 0.00193
NP_442062.1_8 Reverse -322 -332 10.3048 0.0493
NP_442974.1_2 Forward -309 -291 25.5852 0.00669
NP_441859.1_3 Forward -109 -90 6.98015 0.168
NP_440304.1_4 Forward -333 -323 10.8948 0.051
NP_440304.1_4 Reverse -229 -239 4.3066 0.271
NP_440304.1_4 Reverse -258 -268 2.7333 0.299
NP_440304.1_4 Reverse -320 -330 1.84832 0.299
NP_442242.1_4 Forward -330 -323 14.3954 0.0124
NP_442242.1_4 Reverse -323 -330 14.3954 0.0124
NP_440044.1_8 Forward -330 -311 -2.45882 0.264
NP_441035.1_3 Forward -272 -253 -0.39387 0.289
NP_442602.1_3 Reverse -251 -270 0.982764 0.197
NP_441208.1_9 Reverse -319 -333 16.5192 0.0647
NP_442196.1_10 Forward -77 -58 15.5357 0.149
NP_442110.1_7 Forward -331 -317 10.3243 0.0684
NP_442110.1_7 Reverse -322 -336 3.44117 0.21
NP_441925.1_4 Forward -314 -295 -13.5709 0.257
NP_441083.1_3 Forward -259 -249 13.6475 0.205
NP_441083.1_5 Forward -331 -321 20.3345 0.00053
NP_441083.1_5 Reverse -322 -332 11.2881 0.0159
NP_441738.1_2 Forward -329 -322 15.28 0.0102
NP_441738.1_2 Reverse -324 -331 15.28 0.0102
NP_441558.1_5 Forward -333 -314 14.9458 0.046
NP_441645.1_8 Forward -198 -179 11.2092 0.298
NP_440209.1_1 Reverse -322 -330 18.1123 0.00295
NP_440209.1_1 Forward -331 -323 18.1123 0.00295
NP_442136.1_4 Reverse -324 -343 9.7334 0.288
NP_442889.1_8 Forward -334 -320 11.307 0.0733
NP_440056.1_1 Forward -336 -317 8.06259 0.297
NP_441713.1_1 Reverse -316 -335 -9.73531 0.185
NP_441713.1_2 Forward -151 -132 15.6341 0.291
NP_440178.1_7 Reverse -321 -340 -10.227 0.0742
NP_441792.1_5 Forward -336 -320 12.6449 0.19
NP_441716.1_1 Reverse -231 -245 9.43936 0.116
NP_441716.1_1 Reverse -322 -336 7.86607 0.156
NP_441716.1_1 Forward -331 -317 3.8345 0.259
NP_442111.1_4 Reverse -321 -335 22.6157 0.000842
NP_442111.1_4 Forward -332 -318 9.34103 0.0609
NP_441624.1_7 Reverse -6 -20 8.25939 0.24
NP_440906.1_5 Forward -330 -323 15.8704 0.0124
NP_440906.1_5 Reverse -323 -330 15.8704 0.0124
NP_442801.1_1 Forward -101 -82 16.6562 0.293
NP_440747.1_10 Reverse -319 -331 24.7201 0.00036
NP_440747.1_10 Forward -334 -322 17.1486 0.000663
NP_440747.1_10 Reverse -330 -342 -12.3507 0.27
NP_441486.1_1 Reverse -319 -333 -2.45868 0.175
NP_441486.1_1 Forward -334 -320 -2.55701 0.175
NP_442634.1_4 Forward -333 -319 7.86607 0.0479
NP_442634.1_4 Reverse -320 -334 -1.27871 0.149
NP_440057.1_8 Forward -279 -260 15.3391 0.232
NP_441014.1_5 Reverse -317 -335 9.85225 0.272
NP_441014.1_8 Reverse -202 -221 -9.73531 0.299
NP_441014.1_10 Forward -363 -344 1.37531 0.229
NP_441014.1_10 Reverse -198 -217 -2.06626 0.27
NP_442848.1_1 Forward -337 -323 -0.885388 0.263
NP_442848.1_1 Reverse -316 -330 -1.5737 0.263
NP_443018.1_3 Forward -330 -323 14.8871 0.0123
NP_443018.1_3 Reverse -323 -330 14.8871 0.0123
NP_443018.1_3 Forward -189 -182 10.2655 0.107
NP_441634.1_8 Reverse -293 -307 -3.147 0.295
NP_441634.1_9 Forward -233 -214 13.175 0.191
NP_441634.1_9 Forward -143 -124 13.0766 0.191
NP_440376.1_1 Forward -331 -322 19.4693 0.000692
NP_440376.1_1 Reverse -322 -331 19.4693 0.000692
NP_440376.1_1 Reverse -231 -240 4.0313 0.182
NP_441588.1_4 Forward -329 -319 9.02648 0.14
NP_442687.1_7 Forward -332 -322 9.02648 0.0994
NP_442687.1_7 Reverse -321 -331 8.92815 0.0994
NP_442687.1_7 Reverse -230 -240 5.09324 0.221
NP_442485.1_3 Forward -174 -155 -3.44213 0.274
NP_441422.1_7 Forward -333 -316 7.217 0.0992
NP_442296.1_9 Reverse -316 -335 -2.36049 0.224
NP_442658.1_1 Forward -333 -323 14.2375 0.0237
NP_442658.1_1 Forward -17 -7 8.3377 0.199
NP_442658.1_1 Reverse -320 -330 6.76441 0.214
NP_440141.1_8 Reverse -199 -218 5.211 0.277
NP_442782.1_2 Reverse -322 -336 1.47456 0.281
NP_442782.1_2 Forward -228 -214 0.589577 0.288
NP_441414.1_9 Reverse -322 -341 -4.13045 0.148
NP_441414.1_9 Forward -331 -312 -10.227 0.279
NP_441478.1_10 Reverse -47 -65 4.14829 0.289
NP_442937.1_5 Reverse -317 -336 10.6192 0.157
NP_441958.1_5 Forward -332 -322 21.2195 0.000805
NP_441958.1_5 Reverse -321 -331 12.2714 0.00183
NP_442836.1_10 Forward -374 -364 9.32148 0.277
NP_440203.1_5 Forward -328 -318 14.2375 0.0886
NP_439905.1_1 Forward -177 -164 13.884 0.15
NP_439905.1_1 Forward -398 -385 7.98409 0.239
NP_443001.1_7 Reverse -31 -50 3.24438 0.279
NP_439990.1_5 Reverse -317 -330 11.3273 0.128
NP_439990.1_5 Forward -336 -323 10.7374 0.128
NP_442376.1_2 Reverse -317 -336 -3.54046 0.202
NP_442911.1_2 Reverse -312 -331 6.09597 0.03
NP_442911.1_2 Forward -341 -322 4.22769 0.0392
NP_440153.1_5 Reverse -323 -337 10.7177 0.0916
NP_440153.1_8 Forward -310 -297 -3.12731 0.285
NP_442119.1_6 Reverse -320 -339 12.3892 0.12
NP_442536.1_7 Reverse -316 -335 8.25926 0.273
NP_443055.1_3 Forward -340 -321 15.3242 0.101
NP_440993.1_2 Reverse -352 -368 3.00846 0.262
NP_440993.1_2 Forward -336 -320 1.63183 0.279
NP_440602.1_2 Reverse -317 -336 3.93269 0.263
NP_441099.1_5 Forward -341 -322 1.37609 0.0661
NP_441099.1_5 Reverse -312 -331 -8.35868 0.193
NP_442002.1_9 Reverse -214 -221 12.2322 0.185
NP_441424.1_7 Reverse -180 -199 9.83255 0.291
NP_441646.1_1 Reverse -315 -334 7.96426 0.152
NP_442438.1_10 Reverse -317 -331 10.0294 0.0581
NP_442431.1_7 Reverse -367 -386 6.29264 0.27
NP_440377.1_1 Forward -385 -368 11.7569 0.271
NP_440484.1_1 Forward -392 -373 9.93006 0.244
NP_440484.1_1 Forward -75 -56 8.84842 0.285
NP_440484.1_3 Forward -333 -319 10.7177 0.242
NP_441674.1_10 Reverse -50 -68 8.08229 0.2
NP_440147.1_4 Reverse -320 -333 18.4072 0.00407
NP_440147.1_4 Forward -333 -320 10.344 0.0355
NP_440147.1_4 Reverse -167 -180 0.805932 0.244
NP_441175.1_7 Reverse -322 -341 18.9773 0.0482
NP_441550.1_8 Forward -333 -323 15.8108 0.0132
NP_441550.1_8 Reverse -320 -330 14.6309 0.0132
NP_441550.1_8 Reverse -303 -313 6.17443 0.214
NP_441916.1_7 Reverse -322 -332 18.9579 0.00144
NP_441916.1_7 Forward -331 -321 10.3048 0.0261
NP_441916.1_7 Reverse -181 -191 3.81494 0.202
NP_441916.1_10 Forward -339 -320 6.39097 0.206
NP_440206.1_4 Forward -341 -322 5.11187 0.252
NP_441041.1_4 Reverse -322 -341 0.196116 0.0899
NP_441041.1_4 Forward -331 -312 -0.787193 0.0974
NP_441041.1_4 Reverse -316 -335 -10.3253 0.231
NP_441041.1_4 Reverse -310 -329 -11.8003 0.252
NP_441041.1_7 Forward -334 -322 13.3454 0.0485
NP_441041.1_7 Forward -272 -260 9.74986 0.108
NP_441041.1_7 Reverse -319 -331 8.58373 0.133
NP_440569.1_10 Reverse -367 -386 8.45061 0.231
NP_443063.1_7 Forward -109 -93 13.0382 0.144
NP_442004.1_6 Forward -331 -317 15.5359 0.0577
NP_440703.1_9 Forward -324 -311 9.95012 0.212
NP_440703.1_9 Forward -148 -135 7.68852 0.254
NP_441725.1_4 Forward -336 -322 22.7134 0.00544
NP_441725.1_4 Reverse -317 -331 2.8506 0.279
NP_441725.1_5 Forward -330 -320 2.04498 0.115
NP_441725.1_5 Reverse -323 -333 1.94665 0.115
NP_439966.1_7 Forward -333 -323 14.3359 0.0203
NP_439966.1_7 Reverse -320 -330 7.25606 0.15
NP_442941.1_3 Reverse -323 -333 19.2529 0.00262
NP_442941.1_3 Forward -330 -320 11.0914 0.0116
NP_440289.1_2 Forward -334 -321 3.16588 0.0811
NP_440983.1_5 Forward -331 -312 -2.65548 0.231
NP_440983.1_9 Forward -340 -321 0.982764 0.292
NP_440260.1_8 Reverse -313 -331 4.83737 0.154
NP_442281.1_1 Forward -336 -322 17.2068 0.00633
NP_442281.1_1 Reverse -317 -331 16.3219 0.00832
NP_442281.1_1 Forward -20 -6 2.94893 0.249
NP_442012.1_1 Forward -337 -318 5.211 0.153
NP_441556.1_4 Forward -340 -321 10.2943 0.284
NP_441556.1_10 Reverse -317 -331 14.2126 0.178
NP_440498.1_1 Forward -340 -322 -2.14413 0.235
NP_442982.1_5 Forward -341 -322 5.99764 0.156
NP_441644.1_6 Reverse -322 -332 19.0557 0.000803
NP_441644.1_6 Forward -331 -321 17.3841 0.00127
NP_441644.1_6 Reverse -181 -191 4.30615 0.242
NP_441644.1_6 Forward -325 -315 3.51951 0.277
NP_442215.1_2 Reverse -320 -336 -0.728113 0.171
NP_442215.1_2 Forward -333 -317 -2.20308 0.193
NP_442215.1_2 Forward -285 -269 -4.66135 0.237
NP_442215.1_2 Forward -199 -183 -6.82463 0.28
NP_442177.1_5 Reverse -313 -327 11.3077 0.22
NP_442029.1_6 Reverse -317 -336 11.7992 0.157
NP_440253.1_2 Reverse -322 -340 -3.22577 0.287
NP_440929.1_8 Forward -331 -322 19.2726 0.000701
NP_440929.1_8 Reverse -322 -331 19.2726 0.000701
NP_442933.1_10 Forward -331 -322 17.601 0.00325
NP_442933.1_10 Reverse -322 -331 17.601 0.00325
NP_442933.1_10 Forward -178 -169 8.75118 0.0688
NP_441751.2_8 Forward -330 -316 7.57108 0.0339
NP_441751.2_8 Reverse -323 -337 6.48943 0.0354
NP_441751.2_8 Reverse -182 -196 1.67122 0.101
NP_442554.1_8 Reverse -323 -333 17.2863 0.00543
NP_442554.1_8 Forward -330 -320 15.3197 0.00882
NP_442554.1_8 Reverse -182 -192 5.28991 0.153
NP_442554.1_8 Forward -324 -314 4.79825 0.173
NP_441762.1_7 Forward -332 -320 0.530633 0.0747
NP_441762.1_7 Reverse -321 -333 -6.84419 0.284
NP_442142.1_4 Forward -334 -321 12.9 0.0406
NP_442142.1_4 Reverse -319 -332 12.8017 0.0409
NP_442292.1_1 Forward -330 -321 18.486 0.00229
NP_442292.1_1 Reverse -323 -332 17.5026 0.00435
NP_440895.1_6 Reverse -316 -329 18.8988 0.039
NP_441711.1_2 Reverse -189 -208 18.1898 0.0984
NP_441523.1_6 Forward -335 -316 19.9606 0.0806
NP_443009.1_5 Reverse -321 -332 14.5128 0.02
NP_443009.1_5 Forward -332 -321 10.1862 0.0792
NP_441715.1_4 Reverse -323 -333 16.7946 0.0106
NP_441715.1_4 Forward -330 -320 7.94484 0.107
NP_441715.1_4 Reverse -170 -180 4.3066 0.29
NP_440464.1_10 Forward -330 -320 13.0082 0.169
NP_441468.1_1 Forward -330 -323 15.8704 0.0124
NP_441468.1_1 Reverse -323 -330 15.8704 0.0124
NP_441618.1_9 Forward -169 -150 18.6086 0.196
NP_441020.2_6 Reverse -320 -337 10.5603 0.141
NP_441020.2_7 Forward -324 -305 7.76679 0.269
NP_441015.1_10 Reverse -317 -336 -3.73712 0.191
NP_441015.1_10 Reverse -286 -305 -7.67036 0.27
NP_441015.1_10 Forward -336 -317 -7.86702 0.272
NP_441015.1_10 Forward -330 -311 -11.2103 0.292
NP_441673.1_1 Forward -331 -322 20.8459 0.000698
NP_441673.1_1 Reverse -322 -331 20.8459 0.000698
NP_441673.1_1 Forward -240 -231 -8.06341 0.254
NP_441956.1_9 Reverse -315 -334 14.9458 0.166
NP_441956.1_9 Forward -338 -319 6.09597 0.274
NP_441956.1_9 Forward -332 -313 4.916 0.276
NP_440265.1_8 Forward -48 -30 17.4237 0.16
NP_441826.1_2 Reverse -316 -330 6.88276 0.0899
NP_441826.1_2 Forward -337 -323 2.75286 0.12
NP_441826.1_2 Forward -240 -226 1.67122 0.144
NP_441330.1_1 Forward -336 -317 5.11266 0.0304
NP_442868.1_6 Forward -333 -323 10.4031 0.038
NP_442868.1_6 Reverse -320 -330 9.81313 0.038
NP_442719.1_2 Reverse -253 -271 -2.83317 0.192
NP_441056.1_1 Forward -331 -312 -2.55715 0.211
NP_441056.1_1 Reverse -322 -341 -6.29373 0.27
NP_441612.1_2 Forward -331 -321 8.54929 0.21
NP_442808.1_1 Forward -343 -333 11.7793 0.0481
NP_442808.1_1 Forward -332 -322 8.73102 0.0481
NP_442808.1_1 Reverse -321 -331 8.63269 0.0481
NP_442808.1_1 Forward -305 -295 0.864583 0.3
NP_440145.1_3 Forward -341 -322 21.2389 0.00768
NP_440145.1_3 Reverse -312 -331 2.85105 0.112
NP_441906.1_2 Forward -344 -325 1.96529 0.286
NP_442542.1_2 Forward -271 -258 7.88576 0.168
NP_442050.1_5 Forward -333 -323 15.9091 0.0091
NP_442050.1_5 Reverse -320 -330 7.64939 0.243
NP_440558.1_2 Forward -340 -321 13.1758 0.072
NP_440558.1_2 Forward -328 -309 -3.54046 0.236
NP_440558.1_2 Reverse -313 -332 -7.27704 0.291
NP_440558.1_2 Reverse -222 -241 -7.4737 0.294
NP_442789.1_4 Reverse -232 -251 -8.16202 0.299
NP_440274.1_1 Forward -194 -175 17.6007 0.24
NP_441878.1_6 Forward -332 -322 10.5014 0.0176
NP_441878.1_6 Reverse -321 -331 10.4031 0.0176
NP_441878.1_6 Reverse -180 -190 0.668351 0.139
NP_441878.1_6 Reverse -230 -240 -7.39479 0.222
NP_441036.1_8 Forward -332 -322 15.713 0.00724
NP_441036.1_8 Reverse -321 -331 8.33817 0.174
NP_442650.1_2 Forward -331 -317 17.9942 0.0526
NP_441557.1_5 Forward -331 -322 19.9609 0.000699
NP_441557.1_5 Reverse -322 -331 19.9609 0.000699
NP_440101.1_3 Forward -336 -317 1.57275 0.27
NP_440101.1_10 Reverse -316 -335 8.94757 0.171
NP_441458.1_10 Reverse -313 -332 1.0811 0.298
NP_442183.1_1 Reverse -322 -336 9.43936 0.098
NP_442183.1_1 Forward -331 -317 5.21113 0.226
NP_442397.1_9 Forward -331 -312 7.96426 0.246
NP_442397.1_9 Reverse -309 -328 1.47442 0.283
NP_441459.1_8 Reverse -224 -237 12.0157 0.286
NP_441574.1_1 Forward -190 -171 -3.73712 0.243
NP_440276.1_8 Reverse -56 -75 10.6192 0.232
NP_440540.1_8 Reverse -182 -201 9.43923 0.249
NP_442347.1_2 Forward -330 -321 12.4878 0.056
NP_442347.1_2 Forward -281 -272 8.06287 0.116
NP_442347.1_2 Reverse -323 -332 3.34298 0.284
NP_442645.1_2 Forward -339 -320 -3.44213 0.0487
NP_442645.1_2 Reverse -314 -333 -6.1954 0.0829
NP_442645.1_2 Forward -333 -314 -18.8801 0.28
NP_441037.1_4 Reverse -320 -330 7.9999 0.237
NP_441037.1_4 Forward -333 -323 7.22024 0.237
NP_442594.1_7 Reverse -311 -330 6.39016 0.207
NP_442594.1_10 Forward -291 -272 7.66846 0.29
NP_441633.1_3 Reverse -320 -333 1.10092 0.109
NP_441633.1_3 Forward -333 -320 -3.71729 0.177
NP_440136.1_2 Forward -330 -323 15.9687 0.0123
NP_440136.1_2 Reverse -323 -330 15.9687 0.0123
NP_442590.1_10 Forward -178 -159 8.45592 0.208
NP_442590.1_10 Reverse -133 -152 6.19431 0.249
NP_442998.1_10 Forward -329 -322 15.5754 0.0102
NP_442998.1_10 Reverse -324 -331 15.5754 0.0102
NP_440899.1_2 Forward -342 -323 13.5683 0.103
NP_440299.1_1 Reverse -318 -331 22.3398 0.000547
NP_440299.1_1 Forward -335 -322 11.1301 0.0518
NP_440299.1_1 Reverse -227 -240 2.57534 0.284
NP_441799.1_1 Reverse -318 -332 9.83206 0.0838
NP_441799.1_1 Forward -335 -321 7.76712 0.133
NP_441799.1_1 Reverse -312 -326 4.62054 0.242
NP_441007.1_10 Reverse -317 -330 1.29759 0.203
NP_441007.1_10 Forward -336 -323 1.00259 0.209
NP_442334.1_2 Reverse -312 -329 -7.04099 0.283
NP_442201.1_10 Reverse -311 -330 -12.8819 0.27
NP_440256.1_1 Reverse -319 -338 8.06259 0.0239
NP_441512.1_4 Forward -335 -316 10.9142 0.237
NP_441559.1_8 Forward -336 -322 11.0127 0.0574
NP_441559.1_8 Forward -173 -159 -5.01529 0.245
NP_441559.1_8 Reverse -327 -341 -5.90027 0.271
NP_441559.1_8 Reverse -317 -331 -6.78525 0.279
NP_440915.1_6 Reverse -318 -332 12.7826 0.0206
NP_440915.1_6 Forward -335 -321 10.6193 0.0301
NP_442785.1_7 Forward -333 -319 10.7177 0.228
NP_441464.1_1 Forward -335 -316 8.25926 0.261
NP_440026.1_4 Forward -193 -174 8.75091 0.261
NP_441939.1_3 Reverse -323 -342 5.30933 0.28
NP_441199.1_6 Forward -335 -316 -0.590531 0.276
NP_441494.1_4 Reverse -290 -308 11.3272 0.289
NP_442386.1_5 Forward -390 -371 8.25844 0.183
NP_442386.1_9 Reverse -321 -330 13.8639 0.0289
NP_442386.1_9 Forward -326 -317 10.2257 0.136
NP_442386.1_9 Forward -332 -323 6.39082 0.219
NP_440570.1_5 Forward -335 -316 -3.3438 0.289
NP_442054.1_4 Reverse -118 -137 7.47261 0.299
NP_441340.1_5 Forward -330 -323 15.6737 0.0124
NP_441340.1_5 Reverse -323 -330 15.6737 0.0124
NP_440168.1_8 Forward -337 -318 8.35759 0.179
NP_442240.1_2 Reverse -323 -342 8.35759 0.0183
NP_440586.1_1 Reverse -306 -325 -3.04881 0.263
NP_440586.1_8 Forward -330 -323 13.2151 0.026
NP_440586.1_8 Reverse -323 -330 13.2151 0.026
NP_440586.1_8 Forward -189 -182 9.08521 0.178
NP_442251.1_6 Forward -330 -323 15.2804 0.0124
NP_442251.1_6 Reverse -323 -330 15.2804 0.0124
NP_440684.1_9 Reverse -316 -330 15.4376 0.0981
NP_441262.1_3 Reverse -322 -329 14.7888 0.0223
NP_441262.1_3 Forward -331 -324 14.7888 0.0223
NP_440027.1_3 Forward -341 -323 9.94979 0.179
NP_440027.1_3 Reverse -159 -177 9.6548 0.184
NP_443051.1_1 Forward -332 -323 19.5676 0.00335
NP_443051.1_1 Reverse -321 -330 10.4228 0.00754
NP_440451.1_10 Forward -330 -311 8.06178 0.273
NP_441665.1_2 Reverse -255 -274 19.9606 0.0506
NP_440408.1_7 Reverse -219 -238 7.66927 0.284
NP_440439.1_1 Forward -334 -321 10.934 0.0339
NP_440439.1_1 Reverse -319 -332 0.0192843 0.203
NP_439943.1_2 Forward -278 -259 12.1925 0.251
NP_439943.1_7 Reverse -317 -336 15.2408 0.0929
NP_439943.1_7 Forward -233 -214 2.94938 0.29
NP_440372.1_2 Forward -330 -323 16.3621 0.0124
NP_440372.1_2 Reverse -323 -330 16.3621 0.0124
NP_440991.1_9 Forward -376 -357 12.6841 0.286
NP_440316.1_10 Reverse -315 -325 8.04317 0.24
NP_441803.1_2 Forward -336 -317 3.04771 0.197
NP_439977.1_5 Forward -337 -318 -0.4922 0.227
NP_439977.1_7 Forward -342 -323 12.9783 0.262
NP_441572.1_7 Forward -337 -318 -4.91709 0.245
NP_440267.1_2 Forward -336 -322 12.487 0.125
NP_442384.1_10 Reverse -322 -335 18.8988 0.00338
NP_442384.1_10 Forward -331 -318 17.4239 0.00585
NP_442384.1_10 Forward -178 -165 7.00078 0.0899
NP_442384.1_10 Forward -342 -329 2.08423 0.237
NP_441877.1_7 Forward -336 -317 14.1583 0.0834
NP_441018.1_7 Reverse -61 -80 8.94757 0.239
NP_441018.1_7 Reverse -318 -337 8.06259 0.256
NP_441018.1_7 Reverse -312 -331 7.86593 0.263
NP_442790.1_4 Reverse -313 -332 -6.49039 0.144
NP_442790.1_4 Reverse -199 -218 -10.7186 0.217
NP_442262.1_10 Forward -330 -323 14.1988 0.0123
NP_442262.1_10 Reverse -323 -330 14.1988 0.0123
NP_442262.1_10 Forward -189 -182 9.18389 0.211
NP_441689.1_5 Forward -333 -323 8.3377 0.132
NP_441689.1_5 Reverse -320 -330 5.78111 0.197
NP_440344.1_10 Reverse -224 -241 -9.3026 0.143
NP_440282.1_3 Reverse -311 -330 0.294447 0.281
NP_441965.1_3 Reverse -312 -331 6.09597 0.149
NP_441965.1_10 Forward -181 -165 6.45005 0.174
NP_441965.1_10 Reverse -165 -181 3.99177 0.252
NP_441965.1_10 Forward -334 -318 3.79511 0.253
NP_440297.1_9 Forward -189 -179 0.766681 0.282
NP_440297.1_9 Forward -330 -320 -0.118297 0.282
NP_440297.1_9 Reverse -323 -333 -0.216628 0.282
NP_442280.1_10 Reverse -306 -324 5.06482 0.291
NP_441592.1_4 Forward -331 -312 -3.04881 0.274
NP_440894.1_10 Reverse -47 -66 4.81767 0.243
NP_440999.1_9 Forward -335 -321 10.226 0.0548
NP_440999.1_9 Reverse -318 -332 0.687908 0.177
NP_440888.1_2 Reverse -322 -336 13.2736 0.0307
NP_440888.1_2 Forward -331 -317 8.94708 0.142
NP_440600.1_4 Forward -339 -321 -6.56903 0.285
NP_440052.1_5 Reverse -220 -239 -5.99873 0.299
NP_442033.1_10 Reverse -320 -339 -10.1286 0.228
NP_441543.1_2 Forward -330 -321 16.9127 0.00359
NP_441543.1_2 Reverse -323 -332 15.9293 0.00518
NP_442845.1_2 Reverse -316 -330 16.8142 0.0608
NP_442845.1_2 Forward -331 -317 6.98109 0.199
NP_440208.1_1 Forward -265 -246 -10.227 0.257
NP_441304.1_10 Forward -272 -263 14.7494 0.164
NP_441469.1_8 Forward -332 -323 6.5879 0.227
NP_441469.1_8 Reverse -321 -330 6.48957 0.227
NP_443064.1_6 Forward -331 -321 12.5669 0.0796
NP_443064.1_6 Reverse -322 -332 10.8217 0.13
NP_442578.1_7 Forward -330 -323 14.5921 0.026
NP_442578.1_7 Reverse -323 -330 14.5921 0.026
NP_440710.1_1 Forward -339 -321 -3.91409 0.208
NP_441462.1_2 Reverse -322 -332 20.2362 0.000805
NP_441462.1_2 Forward -331 -321 11.5831 0.00406
NP_441621.1_7 Reverse -320 -334 -5.21195 0.248
NP_443062.1_1 Reverse -322 -340 19.7593 0.0208
NP_443062.1_1 Reverse -181 -199 14.6889 0.0444
NP_443062.1_1 Forward -331 -313 10.3011 0.12
NP_443062.1_6 Reverse -91 -110 2.45773 0.255
NP_440277.1_2 Forward -278 -259 8.94757 0.251
NP_442204.1_1 Forward -335 -324 21.1015 0.0035
NP_442204.1_1 Reverse -318 -329 8.7118 0.0852
NP_442204.1_2 Forward -328 -309 10.4225 0.223
NP_442204.1_5 Reverse -312 -331 -0.590531 0.293
NP_440516.1_2 Forward -337 -319 0.117479 0.236
NP_440516.1_8 Forward -331 -322 16.9127 0.00442
NP_440516.1_8 Reverse -322 -331 16.9127 0.00442
NP_442428.1_5 Forward -330 -323 15.8704 0.0124
NP_442428.1_5 Reverse -323 -330 15.8704 0.0124
NP_442859.1_2 Reverse -323 -342 8.25926 0.199
NP_440618.1_1 Forward -155 -136 7.07928 0.0801
NP_442120.1_10 Reverse -316 -335 -14.5535 0.288
NP_441867.1_2 Reverse -222 -241 -20.3551 0.291
NP_440673.1_3 Forward -329 -322 12.4288 0.0426
NP_440673.1_3 Reverse -324 -331 12.4288 0.0426
NP_440673.1_3 Reverse -221 -228 10.5605 0.123
NP_440673.1_3 Reverse -101 -108 6.72562 0.277
NP_440865.1_9 Reverse -316 -335 -5.80207 0.217
NP_441052.1_2 Forward -331 -321 19.9412 0.00106
NP_441052.1_2 Reverse -322 -332 10.4031 0.0285
NP_442219.1_9 Forward -330 -321 17.7976 0.00718
NP_442219.1_9 Reverse -323 -332 8.25953 0.0681
NP_440436.1_4 Forward -330 -321 17.2072 0.00233
NP_440436.1_4 Reverse -323 -332 9.24241 0.0871
NP_440436.1_4 Reverse -220 -229 6.48915 0.157
NP_441884.1_8 Reverse -321 -340 -8.16202 0.261
NP_442864.1_2 Forward -330 -311 10.9142 0.255
NP_442864.1_3 Reverse -316 -335 10.9142 0.184
NP_440314.1_9 Reverse -323 -342 0.491109 0.0952
NP_440314.1_9 Forward -330 -311 -3.93378 0.196
NP_440314.1_9 Reverse -358 -377 -10.0303 0.282
NP_441719.1_4 Forward -330 -323 16.3621 0.0124
NP_441719.1_4 Reverse -323 -330 16.3621 0.0124
NP_441004.1_1 Reverse -316 -335 -6.68705 0.19
NP_441004.1_2 Reverse -56 -75 -3.14714 0.273
NP_442366.1_3 Forward -332 -314 14.0805 0.0235
NP_442366.1_5 Reverse -319 -329 14.0409 0.0497
NP_440296.1_10 Forward -271 -252 -12.6852 0.269
NP_442694.1_4 Reverse -139 -148 13.5694 0.225
NP_442206.1_10 Reverse -322 -337 11.288 0.108
NP_442854.1_6 Forward -331 -312 5.60432 0.249
NP_440328.1_4 Reverse -316 -335 7.17762 0.124
NP_443054.1_2 Reverse -258 -272 10.226 0.0761
NP_443054.1_2 Forward -333 -319 -0.393733 0.294
NP_441851.1_9 Forward -255 -236 8.65258 0.261
NP_441851.1_10 Reverse -321 -331 15.8113 0.00552
NP_441851.1_10 Forward -332 -322 8.53483 0.114
NP_441545.1_2 Forward -297 -278 -1.86883 0.25
NP_442856.1_7 Reverse -313 -332 -3.44213 0.243
NP_442856.1_7 Reverse -160 -179 -6.58872 0.299
NP_441668.1_4 Reverse -312 -331 11.7992 0.0851
NP_441668.1_4 Forward -341 -322 -1.86883 0.283
NP_442515.1_1 Reverse -230 -244 -2.55701 0.277
NP_442515.1_1 Reverse -321 -335 -4.62196 0.298
NP_440593.1_3 Forward -207 -188 -5.9004 0.268
NP_440593.1_3 Forward -336 -317 -7.4737 0.295
NP_442709.1_3 Reverse -315 -334 17.2074 0.0303
NP_441349.1_10 Reverse -312 -331 8.94757 0.0254
NP_441349.1_10 Reverse -152 -171 -8.45701 0.275
NP_441409.1_6 Reverse -316 -335 -8.65367 0.172
NP_440432.1_9 Reverse -323 -338 3.32315 0.0935
NP_440396.1_2 Reverse -234 -252 20.9636 0.0433
NP_441477.1_5 Reverse -245 -264 21.9273 0.0814
NP_441477.1_10 Reverse -315 -333 4.54237 0.201
NP_440431.1_3 Reverse -218 -237 2.55606 0.0952
NP_442450.1_5 Reverse -320 -330 7.55152 0.13
NP_440588.1_2 Reverse -313 -332 -0.4922 0.15
NP_442006.1_2 Forward -277 -260 -7.13932 0.169
NP_443047.1_7 Forward -268 -249 3.93269 0.277
NP_442243.1_1 Forward -337 -319 1.78836 0.21
NP_442243.1_1 Reverse -267 -285 1.39504 0.216
NP_441570.1_1 Reverse -322 -340 0.805796 0.0361
NP_441570.1_1 Forward -331 -313 -10.5023 0.171
NP_441570.1_1 Reverse -316 -334 -16.8938 0.257
NP_440078.1_10 Forward -331 -312 16.8141 0.121
NP_441078.1_4 Forward -331 -322 19.6659 0.0007
NP_441078.1_4 Reverse -322 -331 19.6659 0.0007
NP_442729.1_7 Reverse -63 -81 13.0972 0.183
NP_440539.1_9 Forward -180 -161 -6.49039 0.286
NP_441663.1_8 Forward -337 -318 5.40766 0.146
NP_441091.1_5 Forward -335 -316 13.9625 0.115
NP_440526.1_3 Forward -330 -319 8.02298 0.126
NP_441432.1_8 Reverse -321 -330 16.8143 0.00595
NP_441432.1_8 Forward -332 -323 16.8143 0.00595
NP_441432.1_8 Reverse -315 -324 3.44131 0.245
NP_441432.1_8 Forward -10 -1 2.65466 0.292
NP_442320.1_8 Reverse -316 -330 -2.26202 0.0871
NP_441732.1_2 Forward -335 -319 3.00846 0.0141
NP_441732.1_2 Reverse -318 -334 -7.51295 0.0859
NP_440497.1_2 Reverse -323 -342 7.17762 0.242
NP_440760.1_1 Reverse -322 -341 7.86593 0.0115
NP_440760.1_1 Forward -331 -312 2.75272 0.0217
NP_442797.1_1 Forward -317 -298 -0.983855 0.233
NP_440131.1_4 Reverse -315 -334 5.11266 0.275
NP_440913.1_1 Reverse -320 -338 5.62401 0.237
NP_440913.1_1 Forward -230 -212 3.65739 0.295
NP_441072.1_2 Reverse -311 -330 5.30933 0.3
NP_442489.1_7 Forward -331 -322 20.1576 0.000695
NP_442489.1_7 Reverse -322 -331 20.1576 0.000695
NP_442489.1_7 Reverse -231 -240 -1.77023 0.247
NP_442079.1_7 Reverse -323 -342 4.22769 0.195
NP_440559.1_1 Forward -330 -321 17.4043 0.00658
NP_440559.1_1 Reverse -323 -332 8.65285 0.0586
NP_441659.2_8 Reverse -322 -332 20.9245 0.000805
NP_441659.2_8 Forward -331 -321 18.1713 0.00133
NP_441659.2_8 Reverse -231 -241 2.04498 0.215
NP_440426.1_7 Forward -118 -99 6.09597 0.207
NP_442913.1_10 Forward -340 -321 10.5209 0.0421
NP_442913.1_10 Reverse -313 -332 -4.6221 0.242
NP_442008.1_2 Forward -334 -315 2.94938 0.27
NP_440708.1_6 Forward -232 -213 -8.06369 0.255
NP_442776.1_1 Forward -342 -323 10.6192 0.167
NP_442776.1_8 Forward -338 -319 12.88 0.273
NP_442346.1_2 Forward -342 -323 3.83436 0.293
NP_442346.1_2 Reverse -311 -330 3.53937 0.293
NP_442346.1_5 Reverse -321 -331 16.6963 0.00248
NP_442346.1_5 Forward -332 -322 16.303 0.00248
NP_442346.1_5 Forward -229 -219 9.12481 0.118
NP_442346.1_5 Forward -191 -181 4.69992 0.276
NP_440545.1_3 Reverse -318 -335 20.885 0.00658
NP_440545.1_3 Forward -335 -318 0.432165 0.139
NP_440831.1_1 Forward -196 -177 9.14423 0.29
NP_440459.1_2 Reverse -307 -324 10.5603 0.196
NP_440459.1_2 Forward -333 -316 9.47861 0.227
NP_441653.1_2 Forward -342 -323 5.07576 0.248
NP_440010.1_4 Forward -341 -322 3.63691 0.22
NP_440010.1_4 Forward -335 -316 2.06362 0.227
NP_441943.1_8 Forward -279 -260 -13.5702 0.28
NP_442311.1_5 Forward -391 -372 12.8808 0.201
NP_442603.1_7 Reverse -322 -336 7.27547 0.211
NP_441888.1_7 Forward -336 -322 13.3726 0.0743
NP_441833.1_4 Forward -330 -323 15.9687 0.0124
NP_441833.1_4 Reverse -323 -330 15.9687 0.0124
NP_442162.1_9 Forward -330 -323 16.2637 0.0124
NP_442162.1_9 Reverse -323 -330 16.2637 0.0124
NP_440671.1_4 Reverse -316 -330 12.586 0.105
NP_440671.1_4 Forward -337 -323 9.14437 0.184
NP_440671.1_5 Forward -305 -291 15.2402 0.228
NP_441341.1_7 Forward -392 -373 12.5858 0.283
NP_441915.1_4 Forward -173 -154 5.11187 0.3
NP_442199.1_7 Forward -393 -374 1.47364 0.271
NP_442140.1_3 Forward -330 -320 12.2714 0.0632
NP_442140.1_3 Reverse -323 -333 4.69992 0.238
NP_442021.1_3 Reverse -316 -335 5.211 0.126
NP_440875.1_9 Reverse -324 -334 16.5483 0.0145
NP_440875.1_9 Reverse -183 -193 11.9735 0.143
NP_441813.1_5 Forward -333 -323 18.1713 0.00743
NP_441813.1_5 Reverse -320 -330 8.63316 0.0367
NP_440590.1_4 Forward -330 -317 10.934 0.0235
NP_440590.1_4 Reverse -323 -336 -2.63565 0.247
NP_440567.1_1 Forward -330 -316 13.0776 0.0213
NP_442497.1_6 Forward -338 -319 10.5209 0.242
NP_442497.1_10 Reverse -323 -332 17.601 0.00813
NP_442497.1_10 Forward -330 -321 10.4228 0.0087
NP_440821.1_4 Reverse -320 -330 9.41981 0.0286
NP_440821.1_4 Forward -333 -323 2.24165 0.131
NP_441239.1_9 Forward -333 -321 13.0187 0.0389
NP_441239.1_9 Reverse -320 -332 3.38223 0.285
NP_441892.1_1 Reverse -313 -330 -1.23946 0.201
NP_441892.1_1 Forward -199 -182 -3.99273 0.253
NP_442270.1_9 Reverse -311 -330 1.67108 0.14
NP_442643.1_1 Reverse -316 -335 -11.0136 0.231
NP_440949.1_7 Reverse -217 -236 10.7167 0.233
NP_440546.1_4 Reverse -322 -332 13.5365 0.0459
NP_440546.1_4 Forward -331 -321 10.046 0.109
NP_439974.1_4 Forward -342 -323 13.1758 0.195
NP_441230.1_5 Forward -336 -317 5.01433 0.185
NP_440462.1_6 Forward -333 -323 18.7612 0.00454
NP_440462.1_6 Reverse -320 -330 1.35667 0.294
NP_442611.1_1 Reverse -322 -341 -2.75381 0.295
NP_440868.1_4 Forward -335 -323 8.00379 0.0602
NP_440868.1_4 Reverse -318 -330 6.1355 0.0878
NP_442499.1_3 Reverse -321 -339 4.14905 0.289
NP_442479.1_9 Forward -386 -367 -5.50708 0.266
NP_441474.1_1 Reverse -171 -190 -1.57461 0.262
NP_442402.1_4 Reverse -265 -284 -10.326 0.299
NP_440653.1_5 Reverse -299 -318 6.78429 0.271
NP_442460.1_7 Reverse -310 -329 16.0274 0.0299
NP_440696.1_3 Reverse -322 -340 -3.6191 0.287
NP_440696.1_6 Forward -169 -150 3.04771 0.292
NP_440843.1_8 Reverse -316 -335 13.5691 0.297
NP_442039.1_4 Forward -330 -323 15.1821 0.0124
NP_442039.1_4 Reverse -323 -330 15.1821 0.0124
NP_441811.1_8 Reverse -316 -330 7.47274 0.243
NP_440008.1_9 Reverse -316 -335 6.19431 0.293
NP_440825.1_7 Forward -330 -320 12.9096 0.152
NP_442696.1_6 Forward -80 -61 -9.93197 0.235
NP_442837.1_3 Forward -330 -323 15.7721 0.0124
NP_442837.1_3 Reverse -323 -330 15.7721 0.0124
NP_440160.1_7 Reverse -169 -188 11.8975 0.237
NP_442053.1_1 Forward -331 -322 18.3876 0.0007
NP_442053.1_1 Reverse -322 -331 18.3876 0.0007
NP_440505.1_3 Forward -333 -323 17.188 0.00332
NP_440505.1_3 Reverse -320 -330 9.22315 0.122
NP_440505.1_3 Forward -170 -160 6.56821 0.176
NP_440505.1_7 Reverse -329 -348 -0.590531 0.271
NP_440351.1_8 Forward -384 -366 15.3588 0.121
NP_441203.1_1 Forward -330 -311 -12.4886 0.143
NP_441408.2_7 Forward -333 -314 16.0274 0.0464
NP_440914.1_1 Forward -331 -321 17.5935 0.000537
NP_440914.1_1 Reverse -322 -332 16.3248 0.00196
NP_440914.1_1 Forward -15 -5 6.56569 0.273
NP_441011.1_8 Reverse -323 -332 16.6177 0.00602
NP_441011.1_8 Forward -330 -321 8.25953 0.144
NP_442533.1_6 Forward -331 -322 17.2076 0.00137
NP_442533.1_6 Reverse -322 -331 17.2076 0.00137
NP_442533.1_6 Reverse -169 -178 10.2261 0.0558
NP_442533.1_6 Forward -190 -181 4.71961 0.177
NP_442541.1_10 Reverse -259 -273 5.80051 0.248
NP_442232.1_3 Reverse -314 -333 -14.1602 0.288
NP_441482.1_7 Forward -337 -323 23.9923 0.00253
NP_441482.1_7 Reverse -316 -330 0.982901 0.0554
NP_441482.1_7 Reverse -225 -239 -11.6035 0.275
NP_439944.1_9 Forward -330 -320 10.5014 0.0887
NP_439944.1_9 Reverse -323 -333 9.12481 0.1
NP_441028.1_6 Reverse -264 -274 3.51951 0.292
NP_440116.1_5 Reverse -319 -336 25.1132 0.0128
NP_440116.1_8 Forward -330 -311 -8.65367 0.256
NP_440115.1_6 Forward -334 -324 14.0414 0.0615
NP_440115.1_6 Reverse -319 -329 9.32148 0.115
NP_440007.1_9 Forward -335 -321 10.226 0.163
NP_440007.1_9 Reverse -318 -332 1.37622 0.285
NP_442728.1_7 Forward -74 -60 12.7826 0.289
NP_441961.1_4 Forward -171 -152 2.26107 0.299
NP_443045.1_2 Forward -214 -195 14.4541 0.282
NP_440572.1_5 Forward -101 -82 13.8641 0.235
NP_441602.1_3 Reverse -317 -336 -5.21209 0.28
NP_441602.1_3 Forward -177 -158 -5.31042 0.282
NP_441972.1_5 Forward -330 -311 -8.16202 0.258
NP_441972.1_5 Reverse -244 -263 -9.44032 0.285
NP_441972.1_5 Reverse -149 -168 -10.0303 0.296
NP_441106.1_1 Forward -332 -323 18.486 0.0028
NP_441106.1_1 Reverse -321 -330 9.63616 0.0311
NP_439903.1_6 Forward -334 -315 19.0748 0.0527
NP_442588.1_6 Reverse -325 -344 -3.04881 0.296
NP_441286.1_1 Reverse -321 -333 5.93884 0.0258
NP_441286.1_1 Forward -332 -320 3.48056 0.0467
NP_441286.1_1 Forward -241 -229 -4.9759 0.183
NP_440670.1_8 Forward -331 -322 18.3876 0.000699
NP_440670.1_8 Reverse -322 -331 18.3876 0.000699
NP_441479.1_9 Forward -190 -172 13.0972 0.293
NP_441647.1_9 Forward -198 -179 21.1406 0.113
NP_440886.1_7 Forward -332 -322 8.04271 0.0805
NP_440886.1_7 Reverse -321 -331 7.94438 0.0805
NP_442614.1_2 Forward -331 -317 7.17775 0.275
NP_441784.1_1 Forward -134 -115 17.3057 0.187
NP_442072.1_9 Reverse -321 -339 -14.6322 0.153
NP_442072.1_9 Forward -332 -314 -22.007 0.216
NP_441753.1_10 Forward -77 -58 1.47442 0.264
NP_440907.2_8 Reverse -323 -333 9.616 0.103
NP_440907.2_8 Forward -330 -320 7.64939 0.117
NP_442264.1_5 Forward -331 -317 14.7492 0.222
NP_441021.1_1 Forward -189 -170 -5.70374 0.177
NP_441021.1_1 Forward -330 -311 -7.08038 0.181
NP_441021.1_1 Reverse -170 -189 -11.6036 0.27
NP_442842.1_9 Reverse -379 -398 12.8808 0.203
NP_441626.1_2 Forward -330 -323 15.7721 0.0124
NP_441626.1_2 Reverse -323 -330 15.7721 0.0124
NP_441988.1_5 Forward -391 -372 11.4058 0.274
NP_442365.1_7 Reverse -318 -337 -2.26216 0.199
NP_442794.1_1 Reverse -318 -330 21.9668 0.00123
NP_442794.1_1 Forward -335 -323 10.5604 0.0721
NP_442794.1_1 Reverse -221 -233 3.87389 0.283
NP_442615.1_1 Reverse -313 -331 10.2456 0.0216
NP_441962.1_4 Reverse -317 -336 -1.67217 0.125
NP_441962.1_9 Reverse -157 -176 22.2223 0.0702
NP_441742.1_7 Forward -335 -316 14.4541 0.245
NP_440387.1_1 Forward -331 -315 21.593 0.00219
NP_440387.1_1 Reverse -322 -338 14.6115 0.00635
NP_441431.1_2 Forward -334 -320 16.0269 0.04
NP_441431.1_3 Reverse -289 -308 3.6377 0.263
NP_441488.1_7 Reverse -292 -311 2.94938 0.242
NP_441488.1_8 Reverse -317 -331 13.077 0.146
NP_441836.1_2 Reverse -213 -232 16.9124 0.0403
NP_441993.1_1 Reverse -316 -335 22.0229 0.0133
NP_441993.1_1 Reverse -322 -341 5.55261 0.2
NP_440467.1_3 Reverse -220 -239 13.1118 0.209
NP_440467.1_3 Forward -239 -220 11.1586 0.284
NP_442323.1_7 Forward -336 -317 0.883656 0.298
NP_442357.1_3 Reverse -249 -268 11.2092 0.186
NP_441237.1_9 Forward -330 -320 14.828 0.0242
NP_441246.1_7 Forward -379 -360 9.14423 0.197
NP_440643.1_6 Forward -336 -317 15.2408 0.103
NP_440457.1_1 Forward -335 -323 7.70879 0.101
NP_440457.1_1 Reverse -318 -330 -0.452677 0.263
NP_441984.1_3 Forward -149 -131 6.70565 0.267
NP_441984.1_6 Reverse -150 -162 13.707 0.27
NP_441436.1_2 Forward -175 -156 -5.70374 0.294
NP_441436.1_8 Reverse -321 -340 11.5042 0.261
NP_440473.1_1 Forward -317 -298 11.161 0.283
NP_442509.1_9 Forward -331 -321 8.14104 0.192
NP_442509.1_9 Reverse -322 -332 8.04271 0.192
NP_443037.1_8 Reverse -308 -327 5.40766 0.279
NP_440554.1_4 Reverse -323 -333 17.9746 0.0131
NP_442862.1_3 Forward -384 -367 7.80699 0.253
NP_441885.1_5 Forward -331 -321 20.9245 0.000538
NP_441885.1_5 Reverse -322 -332 11.3864 0.00668
NP_442341.1_7 Forward -332 -318 7.66941 0.0994
NP_442341.1_7 Reverse -259 -273 3.63784 0.217
NP_442341.1_7 Reverse -321 -335 1.67122 0.282
NP_442341.1_9 Forward -333 -319 21.9267 0.00232
NP_441756.1_5 Forward -174 -155 3.93269 0.199
NP_441756.1_5 Forward -335 -316 -1.08219 0.253
NP_443000.1_7 Forward -333 -323 20.3345 0.00223
NP_443000.1_7 Reverse -320 -330 10.3048 0.0345
NP_441842.1_10 Reverse -224 -238 10.816 0.151
NP_440275.1_3 Forward -333 -323 16.1063 0.0155
NP_440275.1_3 Reverse -320 -330 8.04317 0.0602
NP_443060.1_5 Reverse -314 -333 12.3883 0.132
NP_441190.1_2 Forward -88 -69 -0.983855 0.297
NP_442495.1_2 Reverse -151 -170 10.8159 0.266
NP_440149.1_8 Forward -269 -250 -4.91709 0.215
NP_440149.1_8 Forward -331 -312 -8.06369 0.298
NP_441105.1_3 Reverse -311 -330 17.109 0.012
NP_440216.1_1 Reverse -322 -336 7.27608 0.00942
NP_440216.1_1 Forward -331 -317 -10.3252 0.145
NP_440216.1_9 Forward -274 -265 5.99792 0.289
NP_440172.1_1 Reverse -322 -332 17.5813 0.00421
NP_440172.1_1 Forward -331 -321 15.0247 0.00945
NP_440172.1_1 Reverse -260 -270 5.19158 0.149
NP_442371.1_1 Forward -390 -380 14.6309 0.185
NP_442371.1_1 Forward -273 -263 12.5659 0.246
NP_442015.1_10 Reverse -318 -331 19.8821 0.00366
NP_442015.1_10 Forward -335 -322 13.4906 0.0354
NP_441226.1_7 Forward -330 -323 14.4934 0.0123
NP_441226.1_7 Reverse -323 -330 14.4934 0.0123
NP_441226.1_7 Forward -157 -150 6.82361 0.246
NP_441111.1_7 Forward -330 -322 18.7023 0.00294
NP_441111.1_7 Reverse -323 -331 18.7023 0.00294
NP_442379.1_10 Reverse -315 -332 8.00365 0.102
NP_442379.1_10 Reverse -350 -367 5.54538 0.129
NP_441766.1_2 Forward -331 -322 17.5026 0.00297
NP_441766.1_2 Reverse -322 -331 17.5026 0.00297
NP_442417.1_5 Reverse -322 -336 16.2242 0.0423
NP_440416.1_1 Reverse -322 -341 -12.4886 0.272
NP_440416.1_9 Reverse -315 -334 2.16274 0.0412
NP_440416.1_9 Forward -235 -216 -14.9469 0.182
NP_440591.1_9 Reverse -315 -333 8.08229 0.187
NP_442154.1_1 Forward -189 -171 -19.3521 0.298
NP_440261.1_5 Reverse -323 -336 -2.73398 0.0924
NP_440261.1_5 Forward -177 -164 -6.2739 0.199
NP_440261.1_5 Forward -330 -317 -10.4038 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCCCCCAGGCCTGAAAAAAATGGCCCAGGATTGGGACTATTGCTTCCCGGTACTGTACGACGAAACCCAGGCGATCGCCAAGGCCTACCGAGCAGCCTGCACCCCCGACTTCTTTTTGTTTGATGCCCAGGGGAAATTGGCCTACCGGGGCCAGTTAGATGACAGTCGCCCTAGCAATGGTTTGCCCGTTACCGGAGTGGACCTGAGACAGGCCATGGATCTAGTGCTGGCCGGCAGTCCTGTGCCGACGGAACAAAAGCCCAGCATTGGTTGCAACATTAAATGGAAACCCGGCAATGAACCTGATTATCAAAGTAATTAGGCAGCCAAAAACCCAAGGGGGAGTAACCCCTGTGCCAAAATAACGGGAGAGTAATTGTGACAGAGCAAAGGCATTCCG

CDS

GTGGAAAAAGGACAACTAATTGAATTCCGGCATCAAGGAGAACGGCGGTTGGCGGTGGTCGATCGCCCGGACGGCAAAAAAGATTGGGTGGTTATTGATCAACAGGGCCAAAGCCATAAACTGAAGCCCCAGCGGGTGGAGTATGAAATTCCCGGCGGTCCCTACACCGTCGATGATCTGCCTAGTTTTTTAGGGGAAGTGGACCAGTATCTCGACCCCTCTAGTTTGGAGGTGGCCTGGGAACTATTGATTGAAGAGGGGGAAAGCATCACCCCGGCGGATTTGGCCCTATTGCTATTTTCTGAGCAAAGTCCTAGTCAATGCTATGCTGCCCATGCCCTGCTAGCAGAAGATAAACTCTATTTCAAACAAAAAGGCAATCATTACGAACCCCGCCCTAGTAGTCAAATCGAAGAAATTAAACATCAAATGCGGGTGCAAGCCCAAAAAGAACAGGAGCAACAGGGTTTCATTGACCGGGTAAATCAAGCCCTGGCCGGGGAAAAAGTTACCTGGGAAGGGAGCGATCGCCTACGGTTGGAAGCGTTGGAAAAATTTATCCTTTTCCCTGAACAAAATCATCGCCAGGCTTTGGATATTCTCCAAACCCTTGGTAAACCTGGCCGTACCGACGAAACCCAAAACCTCCTGATAGAATTAGGCATCTGGCAACGCCATGAAAATCTCTTTTTGCGTCGTAGTGCTTACCCCAACCAATTCCCCGCCAAGGTATCCGATGTGGCCCATGCTTACCTAACCAATCCTCCCCCCGACCCCGACCAAGAACGCTTCGATCTGACCACCCTAAAGACCTACACCATCGATGATGAAAGCACTTCGGAAATTGACGACGGTCTGAGTGTGGAAACCTTGGCGGACGGCGGCCATCGGCTTTGGATCCATGTGGCCGACCCCACCCGGTTGTTGAGTCCCAACGATGAACTGGATTTAGAAGCCCGTAAACGCAGTACCAGTCTTTACCTGCCCACGGGCATGATTTCCATGTTTCCGCCGGAGTTGGCCACGGGGCCGATGAGTTTACTCCAGGGGCAAAGATGTGTGGCCTTAAGTTTTGGAGTGACTTTGGATGAGGTGGGGGCAGTGAGGGATTTTACCATTGCCCCTAGTTGGGTTAAGCCTACCTATCGCCTCACCTACGAAGATGTGGATGAGATGTTGGTGCTGAAAATTCAAGGGGAACCGGAATTGCCCCTCCTAGCCGAAGCAGCCAAAAAACGGGCCCAATGGCGTAAATCCCAGGGGGCTATCACCATCAAAATGCCCGAAGCCATTATTAAAGTTAATGCCGACGAGGAAGTGCAAATTTATCTCCAGGAAACCTCCGTTTCTCGTCAACTGGTGGCGGAAATGATGATCTTGGCCGGGGAGGTGGCGGGGCGTTTTTGCCAAGAGCATGGCATCCCAGTCCCCTTCCGGGGCCAACCCCAGCCGGAGTTACCCTCCGATGAAGAGTTGTTGTCTTTACCGCCGGGCCCTGTGCGGGAATGTGCGGTACGCCGTTGTATGCCCCGTAGTGAAGTGGGCATTACCCCCAGTCGCCATGCTAGTTTGGGGCTGGATTTGTATTCCCAGGCCACCTCCCCTATCCGTCGTTACACTGATCTGATTACCCATTTTCAAATGAAGGCCTACCTACGGGGGGAGCCGTTGCCTTTCTCTGGGGAGCAGGTACAAGAAATTCTATACAGCGTTATGCCCTCTTCCAAGGAAGCTACGTTGGTGGAACGGCAAACTAACCGTTACTGGAGCTTGGAGTTTCTGCGGCGCAATATTAATGAGGTGTGGCAGGGGGTGATGCTCCGTTGGTTGCGGGAGGATGATGGCTTGGGTTTAATTCTTCTTGAAGAACTAGGTCTTGAATTGCCCCATCGCTTTGACCGTCCCATTTCCCCCGGCGATCGCCTAAGCCTAAAGGTTAGTAATGCCGACCCCCATCGAGACGAAATTCGCTTCCGGGAATTGTTGGCCAATGAAGCCTAG

Protein

MEKGQLIEFRHQGERRLAVVDRPDGKKDWVVIDQQGQSHKLKPQRVEYEIPGGPYTVDDLPSFLGEVDQYLDPSSLEVAWELLIEEGESITPADLALLLFSEQSPSQCYAAHALLAEDKLYFKQKGNHYEPRPSSQIEEIKHQMRVQAQKEQEQQGFIDRVNQALAGEKVTWEGSDRLRLEALEKFILFPEQNHRQALDILQTLGKPGRTDETQNLLIELGIWQRHENLFLRRSAYPNQFPAKVSDVAHAYLTNPPPDPDQERFDLTTLKTYTIDDESTSEIDDGLSVETLADGGHRLWIHVADPTRLLSPNDELDLEARKRSTSLYLPTGMISMFPPELATGPMSLLQGQRCVALSFGVTLDEVGAVRDFTIAPSWVKPTYRLTYEDVDEMLVLKIQGEPELPLLAEAAKKRAQWRKSQGAITIKMPEAIIKVNADEEVQIYLQETSVSRQLVAEMMILAGEVAGRFCQEHGIPVPFRGQPQPELPSDEELLSLPPGPVRECAVRRCMPRSEVGITPSRHASLGLDLYSQATSPIRRYTDLITHFQMKAYLRGEPLPFSGEQVQEILYSVMPSSKEATLVERQTNRYWSLEFLRRNINEVWQGVMLRWLREDDGLGLILLEELGLELPHRFDRPISPGDRLSLKVSNADPHRDEIRFRELLANEA