Your browser is old and dusty. Try Google Chrome!

Details for sll1209

ORF sll1209
Accession NP_439908.1
Symbol lig
Category DNA ligase
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -82 -68 -0.000409212 0.219
NP_440795.1_7 Forward -82 -75 14.6904 0.0123
NP_440795.1_7 Reverse -75 -82 14.6904 0.0123
NP_441418.1_6 Reverse -234 -253 -29.7948 0.238
NP_441418.1_6 Reverse -141 -160 -29.7948 0.238
NP_442291.1_5 Reverse -73 -89 4.87675 0.0841
NP_441453.1_4 Reverse -74 -82 16.539 0.00633
NP_441453.1_4 Forward -83 -75 16.539 0.00633
NP_442151.1_6 Forward -83 -69 8.75105 0.164
NP_442151.1_6 Reverse -74 -88 7.17775 0.206
NP_442151.1_6 Reverse -96 -110 5.70279 0.266
NP_442838.1_7 Reverse -241 -260 -1.86883 0.143
NP_441818.1_1 Reverse -75 -86 9.59626 0.232
NP_440226.1_1 Forward -83 -64 5.50599 0.154
NP_440226.1_1 Reverse -74 -93 3.6377 0.218
NP_441465.1_8 Forward -94 -76 7.98396 0.235
NP_442173.1_1 Forward -82 -74 15.4574 0.00633
NP_442173.1_1 Reverse -75 -83 15.4574 0.00633
NP_442752.1_4 Forward -83 -76 13.8055 0.0199
NP_442752.1_4 Reverse -74 -81 13.8055 0.0199
NP_442752.1_4 Reverse -246 -253 10.8555 0.0846
NP_443027.1_4 Forward -85 -75 16.2046 0.0437
NP_443027.1_4 Reverse -244 -254 6.37155 0.283
NP_441812.1_3 Reverse -73 -87 11.996 0.21
NP_442975.1_10 Forward -87 -73 12.8803 0.0459
NP_442975.1_10 Reverse -137 -151 7.27547 0.138
NP_442975.1_10 Reverse -70 -84 1.37564 0.299
NP_440784.1_7 Forward -82 -75 15.9687 0.0123
NP_440784.1_7 Reverse -75 -82 15.9687 0.0123
NP_442000.2_3 Forward -164 -145 10.9142 0.28
NP_440061.1_9 Forward -85 -71 7.96378 0.185
NP_441054.1_2 Forward -207 -188 15.2408 0.143
NP_440878.1_9 Reverse -303 -322 5.70265 0.174
NP_442062.1_8 Forward -83 -73 17.3846 0.00193
NP_442062.1_8 Reverse -74 -84 10.3048 0.0493
NP_442062.1_8 Reverse -246 -256 5.28991 0.176
NP_442062.1_8 Reverse -96 -106 3.51995 0.267
NP_440304.1_4 Forward -85 -75 19.9412 0.00364
NP_440304.1_4 Reverse -72 -82 1.84832 0.299
NP_442242.1_4 Forward -82 -75 14.3954 0.0124
NP_442242.1_4 Reverse -75 -82 14.3954 0.0124
NP_441781.1_7 Forward -150 -131 -1.18052 0.27
NP_441619.1_8 Reverse -68 -82 8.75042 0.237
NP_441619.1_8 Forward -89 -75 7.47213 0.277
NP_441208.1_9 Reverse -71 -85 7.27608 0.223
NP_442110.1_7 Forward -144 -130 7.86607 0.106
NP_442110.1_7 Reverse -74 -88 2.06454 0.222
NP_441925.1_2 Forward -297 -278 7.7676 0.262
NP_441083.1_5 Forward -83 -73 20.3345 0.00053
NP_441083.1_5 Reverse -74 -84 11.2881 0.0159
NP_441738.1_2 Forward -81 -74 15.28 0.0102
NP_441738.1_2 Reverse -76 -83 15.28 0.0102
NP_441558.1_5 Forward -85 -66 3.83436 0.296
NP_441942.1_6 Reverse -239 -258 14.3777 0.245
NP_440209.1_1 Reverse -74 -82 18.1123 0.00295
NP_440209.1_1 Forward -83 -75 18.1123 0.00295
NP_442889.1_8 Forward -86 -72 19.0751 0.0084
NP_442889.1_8 Reverse -93 -107 3.73557 0.273
NP_441713.1_1 Reverse -68 -87 -3.83545 0.113
NP_441713.1_3 Reverse -245 -264 3.14605 0.259
NP_440178.1_7 Reverse -73 -92 -13.8652 0.143
NP_440178.1_7 Reverse -152 -171 -22.2233 0.258
NP_441716.1_1 Reverse -74 -88 6.3911 0.198
NP_441716.1_2 Reverse -348 -367 2.59002 0.236
NP_442111.1_4 Reverse -73 -87 9.63603 0.0593
NP_440906.1_5 Forward -82 -75 15.8704 0.0124
NP_440906.1_5 Reverse -75 -82 15.8704 0.0124
NP_440747.1_10 Reverse -71 -83 14.887 0.00223
NP_440747.1_10 Forward -86 -74 -1.92764 0.0192
NP_440747.1_10 Forward -153 -141 -11.7607 0.142
NP_440747.1_10 Reverse -35 -47 -12.1541 0.227
NP_441486.1_1 Forward -86 -72 14.5526 0.00628
NP_441486.1_1 Reverse -71 -85 4.22782 0.0475
NP_442634.1_4 Reverse -72 -86 -2.06536 0.149
NP_441265.1_1 Forward -279 -260 1.67108 0.0182
NP_441014.1_10 Reverse -73 -92 -2.26292 0.274
NP_442848.1_1 Forward -89 -75 -4.13031 0.282
NP_441012.1_4 Reverse -256 -269 11.4257 0.252
NP_443018.1_3 Forward -82 -75 14.8871 0.0123
NP_443018.1_3 Reverse -75 -82 14.8871 0.0123
NP_443018.1_3 Reverse -247 -254 11.5438 0.0752
NP_441316.1_7 Forward -85 -70 2.14318 0.156
NP_441634.1_8 Reverse -151 -165 -2.55701 0.295
NP_441634.1_8 Reverse -72 -86 -4.7203 0.295
NP_440376.1_1 Forward -83 -74 19.4693 0.000692
NP_440376.1_1 Reverse -74 -83 19.4693 0.000692
NP_440376.1_1 Forward -150 -141 12.7828 0.0185
NP_440376.1_1 Forward -47 -38 1.47469 0.251
NP_441588.1_4 Forward -81 -71 15.9097 0.0369
NP_441588.1_4 Reverse -76 -86 6.66654 0.185
NP_442687.1_7 Forward -84 -74 9.02648 0.0994
NP_442687.1_7 Reverse -73 -83 8.92815 0.0994
NP_442485.1_3 Forward -94 -75 -4.42544 0.28
NP_441846.1_1 Forward -198 -179 4.32602 0.283
NP_441846.1_10 Forward -180 -161 -23.4033 0.285
NP_442530.1_2 Forward -396 -386 11.6814 0.282
NP_442658.1_1 Forward -85 -75 13.0576 0.04
NP_442658.1_1 Reverse -244 -254 8.14104 0.199
NP_442658.1_1 Reverse -72 -82 6.76441 0.214
NP_441855.2_4 Forward -134 -115 12.126 0.203
NP_442205.1_9 Forward -89 -73 5.07341 0.142
NP_441414.1_9 Forward -83 -64 16.3224 0.00987
NP_441414.1_9 Reverse -74 -93 -4.91709 0.164
NP_441958.1_5 Forward -84 -74 21.2195 0.000805
NP_441958.1_5 Reverse -73 -83 12.2714 0.00183
NP_440984.1_7 Reverse -69 -83 11.0127 0.122
NP_439990.1_5 Reverse -69 -82 7.6891 0.186
NP_439990.1_5 Forward -88 -75 6.80412 0.221
NP_442911.1_2 Reverse -64 -83 13.5691 0.0118
NP_442911.1_2 Forward -93 -74 -10.0303 0.268
NP_440153.1_5 Reverse -75 -89 1.96621 0.241
NP_442064.1_1 Reverse -69 -88 6.68596 0.0966
NP_443055.1_3 Forward -92 -73 18.1889 0.0481
NP_442002.1_9 Reverse -95 -102 13.0188 0.185
NP_440809.1_9 Forward -92 -74 -6.37237 0.225
NP_441294.1_7 Forward -87 -73 17.0257 0.0103
NP_442438.1_10 Forward -88 -74 1.86788 0.188
NP_441000.1_6 Reverse -73 -87 -4.52363 0.245
NP_441000.1_6 Forward -256 -242 -5.11362 0.261
NP_440147.1_4 Reverse -72 -85 10.7374 0.0355
NP_440147.1_4 Forward -85 -72 3.75586 0.181
NP_440147.1_4 Forward -257 -244 -0.177378 0.276
NP_440147.1_5 Forward -204 -185 16.2232 0.263
NP_441550.1_8 Reverse -72 -82 14.6309 0.0132
NP_441550.1_8 Forward -85 -75 13.0576 0.0273
NP_441916.1_7 Reverse -74 -84 18.9579 0.00144
NP_441916.1_7 Forward -83 -73 10.3048 0.0261
NP_441916.1_7 Forward -150 -140 2.63497 0.246
NP_441916.1_10 Forward -91 -72 12.3892 0.122
NP_441041.1_4 Reverse -74 -93 2.75272 0.07
NP_441041.1_7 Forward -86 -74 9.65268 0.108
NP_442396.1_5 Reverse -70 -83 21.1604 0.00421
NP_441725.1_5 Reverse -75 -85 11.1898 0.0247
NP_441725.1_5 Forward -82 -72 2.04498 0.115
NP_439966.1_7 Forward -85 -75 14.8275 0.0177
NP_439966.1_7 Reverse -72 -82 7.25606 0.15
NP_439966.1_9 Reverse -244 -253 1.1797 0.253
NP_442941.1_3 Reverse -75 -85 19.9412 0.00262
NP_442941.1_3 Forward -82 -72 11.0914 0.0116
NP_440289.1_2 Forward -86 -73 13.3923 0.0132
NP_442281.1_1 Reverse -69 -83 8.94708 0.0747
NP_440177.1_9 Reverse -66 -85 12.3892 0.238
NP_440437.1_1 Forward -89 -70 6.19431 0.0782
NP_440437.1_1 Forward -261 -242 -1.08219 0.194
NP_441644.1_6 Reverse -74 -84 19.0557 0.000803
NP_441644.1_6 Forward -83 -73 17.3841 0.00127
NP_441644.1_6 Reverse -205 -215 7.45273 0.124
NP_443049.1_6 Reverse -245 -255 11.4458 0.257
NP_442215.1_2 Reverse -72 -88 4.48343 0.0838
NP_442215.1_2 Forward -324 -308 2.41848 0.116
NP_442215.1_2 Forward -107 -91 -2.20308 0.193
NP_442029.1_6 Forward -98 -79 3.73603 0.277
NP_440929.1_8 Forward -83 -74 19.2726 0.000701
NP_440929.1_8 Reverse -74 -83 19.2726 0.000701
NP_442933.1_1 Reverse -344 -363 7.20922 0.253
NP_442933.1_10 Forward -83 -74 17.601 0.00325
NP_442933.1_10 Reverse -74 -83 17.601 0.00325
NP_442671.1_2 Forward -370 -351 0.501445 0.276
NP_441751.2_8 Reverse -75 -89 23.304 0.00466
NP_441751.2_8 Forward -82 -68 -3.04867 0.134
NP_442926.1_3 Forward -167 -148 8.94757 0.165
NP_442926.1_5 Reverse -136 -155 9.39653 0.279
NP_442554.1_8 Reverse -75 -85 16.9913 0.0065
NP_442554.1_8 Forward -82 -72 15.3197 0.00882
NP_442554.1_8 Forward -254 -244 5.09324 0.161
NP_442863.1_8 Forward -395 -376 20.4514 0.207
NP_441762.1_7 Forward -84 -72 0.530633 0.0747
NP_441762.1_7 Forward -256 -244 -6.15587 0.276
NP_441762.1_7 Reverse -73 -85 -6.94252 0.284
NP_442142.1_4 Forward -86 -73 13.5883 0.0348
NP_442142.1_4 Reverse -71 -84 3.55864 0.251
NP_442142.1_4 Reverse -93 -106 2.28034 0.295
NP_442292.1_1 Forward -82 -73 18.486 0.00229
NP_442292.1_1 Reverse -75 -84 17.5026 0.00435
NP_442476.1_6 Forward -82 -68 10.9143 0.0601
NP_441264.1_3 Forward -279 -260 0.0977854 0.233
NP_443009.1_5 Reverse -73 -84 14.5128 0.02
NP_443009.1_5 Forward -84 -73 10.1862 0.0792
NP_441715.1_4 Reverse -75 -85 14.238 0.0295
NP_441715.1_4 Forward -82 -72 7.94484 0.107
NP_441198.1_8 Forward -85 -75 13.2713 0.108
NP_440464.1_10 Forward -82 -72 13.0082 0.169
NP_441468.1_1 Forward -82 -75 15.8704 0.0124
NP_441468.1_1 Reverse -75 -82 15.8704 0.0124
NP_441468.1_1 Reverse -247 -254 4.07068 0.263
NP_441020.2_6 Reverse -244 -261 11.7402 0.112
NP_441015.1_10 Forward -167 -148 -11.7019 0.3
NP_441673.1_1 Forward -83 -74 20.8459 0.000698
NP_441673.1_1 Reverse -74 -83 20.8459 0.000698
NP_441731.1_3 Forward -271 -252 -3.44213 0.284
NP_441826.1_2 Forward -89 -75 5.1128 0.0978
NP_441826.1_2 Reverse -254 -268 -2.65535 0.273
NP_441826.1_2 Reverse -153 -167 -3.34366 0.284
NP_442868.1_6 Reverse -72 -82 9.81313 0.038
NP_442868.1_6 Forward -85 -75 1.06167 0.205
NP_442719.1_2 Forward -269 -251 -10.4046 0.273
NP_441612.1_2 Forward -83 -73 8.54929 0.21
NP_441612.1_2 Reverse -96 -106 6.61303 0.283
NP_442427.1_8 Reverse -65 -84 7.07928 0.221
NP_442808.1_1 Forward -84 -74 8.73102 0.0481
NP_442808.1_1 Reverse -73 -83 8.63269 0.0481
NP_440145.1_3 Forward -93 -74 7.96426 0.0466
NP_440145.1_3 Forward -172 -153 -5.40875 0.267
NP_442542.1_9 Reverse -239 -253 4.42388 0.297
NP_442050.1_5 Forward -85 -75 18.0724 0.00365
NP_442050.1_5 Reverse -72 -82 7.64939 0.243
NP_440558.1_2 Forward -92 -73 -0.688862 0.204
NP_441878.1_6 Forward -84 -74 10.5014 0.0176
NP_441878.1_6 Reverse -73 -83 10.4031 0.0176
NP_441878.1_6 Forward -256 -246 -0.41329 0.177
NP_441878.1_6 Reverse -95 -105 -7.49312 0.231
NP_441878.1_6 Reverse -140 -150 -7.68978 0.255
NP_441036.1_8 Forward -84 -74 15.713 0.00724
NP_441036.1_8 Reverse -73 -83 8.33817 0.174
NP_441557.1_5 Forward -83 -74 19.9609 0.000699
NP_441557.1_5 Reverse -74 -83 19.9609 0.000699
NP_441445.1_1 Forward -92 -73 10.5209 0.0945
NP_442066.2_4 Reverse -74 -93 -0.787193 0.18
NP_442066.2_9 Reverse -70 -83 11.1307 0.154
NP_441308.1_8 Forward -85 -75 13.353 0.218
NP_441458.1_10 Reverse -196 -215 2.0644 0.274
NP_442183.1_1 Forward -83 -69 11.5043 0.0702
NP_442183.1_1 Reverse -378 -392 6.19444 0.184
NP_442397.1_9 Forward -83 -64 4.81767 0.254
NP_441116.1_8 Forward -202 -183 15.3391 0.236
NP_440440.1_2 Forward -263 -244 14.9449 0.256
NP_440979.1_3 Reverse -75 -93 11.9172 0.234
NP_441459.1_8 Reverse -89 -102 10.8357 0.286
NP_441574.1_1 Forward -168 -149 -7.76869 0.293
NP_441549.1_9 Reverse -70 -88 -3.32411 0.198
NP_441549.1_9 Forward -154 -136 -3.81576 0.198
NP_442347.1_2 Forward -82 -73 12.4878 0.056
NP_442347.1_2 Reverse -75 -84 3.34298 0.284
NP_442645.1_2 Forward -91 -72 2.85105 0.0352
NP_442645.1_2 Reverse -66 -85 -22.42 0.291
NP_442645.1_2 Forward -263 -244 -22.9117 0.299
NP_441037.1_4 Reverse -72 -82 7.9999 0.237
NP_441037.1_4 Forward -85 -75 7.31769 0.237
NP_441037.1_4 Reverse -244 -254 5.95329 0.289
NP_442594.1_7 Reverse -130 -149 6.58682 0.205
NP_441633.1_3 Reverse -72 -85 1.00259 0.11
NP_441633.1_3 Forward -257 -244 -6.07724 0.236
NP_440136.1_2 Forward -82 -75 15.9687 0.0123
NP_440136.1_2 Reverse -75 -82 15.9687 0.0123
NP_442998.1_5 Reverse -220 -230 12.0747 0.176
NP_442998.1_5 Forward -396 -386 9.91146 0.232
NP_442998.1_10 Forward -81 -74 15.5754 0.0102
NP_442998.1_10 Reverse -76 -83 15.5754 0.0102
NP_442998.1_10 Forward -253 -246 6.13563 0.181
NP_440299.1_1 Reverse -70 -83 12.9984 0.0319
NP_440299.1_1 Forward -259 -246 3.36198 0.247
NP_441799.1_1 Reverse -70 -84 16.8135 0.0129
NP_441799.1_1 Forward -87 -73 12.487 0.043
NP_441007.1_10 Reverse -69 -82 8.27909 0.115
NP_442333.2_5 Reverse -124 -143 -3.93378 0.214
NP_440256.1_1 Reverse -71 -90 -10.0303 0.293
NP_440087.1_1 Forward -92 -73 -8.85033 0.285
NP_441559.1_8 Forward -88 -74 -0.295402 0.175
NP_440915.1_6 Reverse -70 -84 2.85119 0.111
NP_440915.1_6 Forward -87 -73 1.76955 0.131
NP_442785.1_7 Forward -85 -71 10.4227 0.228
NP_442866.1_1 Forward -149 -130 -3.3438 0.221
NP_440702.1_2 Forward -107 -88 -6.98204 0.265
NP_442993.1_1 Reverse -74 -90 9.49831 0.0186
NP_442386.1_9 Reverse -73 -82 13.8639 0.0289
NP_442386.1_9 Forward -84 -75 6.39082 0.219
NP_441340.1_5 Forward -82 -75 15.6737 0.0124
NP_441340.1_5 Reverse -75 -82 15.6737 0.0124
NP_442950.1_1 Forward -207 -188 12.6841 0.097
NP_442950.1_1 Reverse -182 -201 -5.99873 0.294
NP_442950.1_6 Reverse -191 -210 9.24257 0.172
NP_440586.1_8 Forward -82 -75 13.2151 0.026
NP_440586.1_8 Reverse -75 -82 13.2151 0.026
NP_440586.1_8 Reverse -247 -254 10.9535 0.119
NP_442251.1_6 Forward -82 -75 15.2804 0.0124
NP_442251.1_6 Reverse -75 -82 15.2804 0.0124
NP_440684.1_9 Reverse -68 -82 12.586 0.168
NP_441262.1_3 Reverse -74 -81 14.7888 0.0223
NP_441262.1_3 Forward -83 -76 14.7888 0.0223
NP_441262.1_3 Reverse -246 -253 5.25066 0.215
NP_440027.1_8 Forward -153 -134 9.93006 0.243
NP_443051.1_1 Forward -84 -75 19.5676 0.00335
NP_443051.1_1 Reverse -73 -82 10.4228 0.00754
NP_439937.1_9 Forward -256 -239 -7.33664 0.158
NP_442294.1_3 Reverse -188 -202 12.9786 0.274
NP_440439.1_1 Forward -86 -73 1.88757 0.139
NP_440372.1_2 Forward -82 -75 16.3621 0.0124
NP_440372.1_2 Reverse -75 -82 16.3621 0.0124
NP_440372.1_3 Reverse -351 -365 14.9084 0.17
NP_440770.1_5 Forward -366 -347 16.6629 0.277
NP_440819.1_5 Forward -397 -389 7.98423 0.228
NP_441803.1_2 Reverse -148 -167 0.982764 0.242
NP_441803.1_2 Forward -155 -136 0.294447 0.255
NP_440139.1_1 Reverse -251 -270 2.6536 0.225
NP_440267.1_2 Forward -88 -74 8.75042 0.162
NP_442384.1_10 Forward -83 -70 15.8506 0.00946
NP_442384.1_10 Reverse -74 -87 7.09911 0.0875
NP_442035.1_6 Reverse -246 -265 7.86593 0.26
NP_441018.1_7 Reverse -70 -89 7.07928 0.277
NP_442790.1_4 Reverse -65 -84 1.37609 0.0824
NP_442262.1_10 Forward -82 -75 14.1988 0.0123
NP_442262.1_10 Reverse -75 -82 14.1988 0.0123
NP_442262.1_10 Reverse -247 -254 11.7405 0.0841
NP_441689.1_5 Forward -85 -75 17.8758 0.0158
NP_441689.1_5 Reverse -72 -82 5.78111 0.197
NP_440344.1_10 Forward -90 -73 -6.25434 0.113
NP_440344.1_10 Reverse -89 -106 -9.89259 0.16
NP_440282.1_10 Forward -160 -141 -6.09707 0.25
NP_441965.1_10 Forward -86 -70 10.9733 0.107
NP_441640.1_8 Reverse -241 -260 -3.14714 0.249
NP_440297.1_9 Reverse -75 -85 9.22315 0.0917
NP_440297.1_9 Reverse -247 -257 -0.118297 0.282
NP_440297.1_9 Forward -82 -72 -0.118297 0.282
NP_440894.1_10 Forward -110 -91 5.211 0.238
NP_440894.1_10 Forward -327 -308 4.52268 0.252
NP_440888.1_2 Reverse -74 -88 16.4202 0.00685
NP_440888.1_2 Forward -83 -69 7.07881 0.208
NP_440491.1_1 Reverse -93 -112 11.2051 0.173
NP_440575.1_8 Forward -392 -373 -3.73712 0.261
NP_441543.1_2 Forward -82 -73 16.9127 0.00359
NP_441543.1_2 Reverse -75 -84 15.9293 0.00518
NP_441543.1_2 Forward -254 -245 6.39124 0.153
NP_442845.1_2 Forward -89 -75 13.6676 0.0934
NP_442845.1_2 Reverse -68 -82 13.2743 0.0955
NP_441469.1_8 Forward -84 -75 6.5879 0.227
NP_441469.1_8 Reverse -73 -82 6.48957 0.227
NP_441469.1_8 Reverse -245 -254 5.21127 0.283
NP_443064.1_6 Forward -83 -73 12.5669 0.0796
NP_443064.1_6 Reverse -74 -84 10.8217 0.13
NP_443064.1_6 Reverse -26 -36 8.6886 0.276
NP_442578.1_7 Forward -82 -75 14.5921 0.026
NP_442578.1_7 Reverse -75 -82 14.5921 0.026
NP_442578.1_7 Reverse -247 -254 5.15232 0.291
NP_441462.1_2 Reverse -74 -84 20.2362 0.000805
NP_441462.1_2 Forward -83 -73 11.5831 0.00406
NP_441462.1_2 Forward -150 -140 -0.806614 0.254
NP_441621.1_7 Forward -257 -243 -6.29359 0.283
NP_441929.1_3 Reverse -188 -207 13.5691 0.11
NP_443062.1_1 Reverse -74 -92 20.4418 0.0208
NP_443062.1_1 Forward -255 -237 3.37804 0.3
NP_442204.1_1 Reverse -131 -142 5.27021 0.213
NP_442204.1_1 Forward -87 -76 0.157002 0.283
NP_440516.1_8 Forward -83 -74 16.9127 0.00442
NP_440516.1_8 Reverse -74 -83 16.9127 0.00442
NP_440516.1_8 Forward -214 -205 -0.000272808 0.156
NP_442428.1_5 Forward -82 -75 15.8704 0.0124
NP_442428.1_5 Reverse -75 -82 15.8704 0.0124
NP_442428.1_5 Reverse -247 -254 4.46401 0.267
NP_442120.1_10 Forward -150 -131 -16.1268 0.296
NP_440778.1_1 Reverse -47 -66 17.155 0.189
NP_440673.1_2 Forward -265 -246 8.24345 0.275
NP_440673.1_2 Forward -93 -74 8.1459 0.28
NP_440673.1_3 Forward -81 -74 12.4288 0.0426
NP_440673.1_3 Reverse -76 -83 12.4288 0.0426
NP_440673.1_3 Forward -253 -246 11.6422 0.0724
NP_441052.1_2 Forward -83 -73 19.9412 0.00106
NP_441052.1_2 Reverse -74 -84 10.4031 0.0285
NP_441052.1_2 Reverse -141 -151 5.38824 0.12
NP_441052.1_2 Reverse -96 -106 3.91327 0.17
NP_442219.1_9 Forward -82 -73 17.7976 0.00718
NP_442219.1_9 Reverse -75 -84 8.25953 0.0681
NP_440436.1_4 Forward -82 -73 17.2072 0.00233
NP_440436.1_4 Reverse -75 -84 9.24241 0.0871
NP_440436.1_4 Forward -254 -245 5.60418 0.188
NP_441884.1_9 Forward -86 -67 -25.2716 0.29
NP_440314.1_9 Forward -82 -63 8.25926 0.04
NP_440314.1_9 Reverse -75 -94 -7.37537 0.24
NP_440648.1_6 Forward -240 -221 9.24175 0.198
NP_441719.1_2 Reverse -71 -85 16.4239 0.191
NP_441719.1_4 Forward -82 -75 16.3621 0.0124
NP_441719.1_4 Reverse -75 -82 16.3621 0.0124
NP_441719.1_4 Reverse -247 -254 3.77569 0.285
NP_441004.1_1 Reverse -248 -267 -16.0285 0.281
NP_442366.1_3 Reverse -73 -91 -4.79907 0.276
NP_442366.1_5 Reverse -71 -81 15.4175 0.0374
NP_442694.1_4 Reverse -345 -354 12.2911 0.253
NP_442206.1_10 Forward -83 -68 4.30646 0.178
NP_440094.1_9 Forward -106 -87 -3.63879 0.239
NP_443054.1_2 Forward -85 -71 1.57289 0.245
NP_441851.1_10 Reverse -73 -83 15.8113 0.00552
NP_441851.1_10 Reverse -245 -255 10.4031 0.0935
NP_441851.1_10 Forward -84 -74 8.53483 0.114
NP_441668.1_4 Reverse -64 -83 16.0274 0.0456
NP_442515.1_1 Forward -151 -137 8.84938 0.0698
NP_442515.1_1 Forward -84 -70 4.71948 0.107
NP_440593.1_3 Reverse -142 -161 -4.03212 0.244
NP_442689.1_8 Reverse -348 -365 -3.20608 0.246
NP_441349.1_10 Forward -93 -74 -2.75381 0.125
NP_441349.1_10 Reverse -64 -83 -5.11376 0.192
NP_441349.1_10 Reverse -28 -47 -9.047 0.281
NP_441409.1_6 Reverse -68 -87 -8.26035 0.165
NP_440432.1_9 Forward -82 -67 -3.26502 0.179
NP_440474.1_8 Reverse -75 -89 15.6336 0.0566
NP_440431.1_3 Forward -84 -65 -4.6221 0.179
NP_442450.1_5 Forward -85 -75 9.41981 0.115
NP_442450.1_5 Reverse -72 -82 7.55152 0.13
NP_440195.1_5 Reverse -240 -259 3.24438 0.273
NP_442006.1_2 Reverse -237 -254 3.48043 0.0829
NP_442243.1_1 Reverse -240 -258 -1.25988 0.273
NP_441570.1_1 Reverse -74 -92 -8.24065 0.107
NP_441570.1_1 Reverse -205 -223 -16.7954 0.254
NP_441078.1_4 Forward -83 -74 19.6659 0.0007
NP_441078.1_4 Reverse -74 -83 19.6659 0.0007
NP_441078.1_4 Reverse -141 -150 6.09625 0.0863
NP_441078.1_4 Reverse -246 -255 -2.06522 0.295
NP_442729.1_8 Reverse -70 -83 10.639 0.125
NP_442729.1_8 Forward -154 -141 5.72248 0.233
NP_440526.1_3 Reverse -75 -86 1.82816 0.267
NP_440526.1_3 Forward -82 -71 1.04151 0.267
NP_441432.1_8 Reverse -73 -82 16.8143 0.00595
NP_441432.1_8 Forward -84 -75 16.8143 0.00595
NP_442320.1_8 Reverse -68 -82 4.62115 0.0472
NP_442320.1_8 Reverse -240 -254 -3.93365 0.136
NP_441732.1_2 Forward -87 -71 -6.92296 0.0558
NP_441732.1_2 Reverse -309 -325 -16.4611 0.167
NP_440760.1_1 Forward -83 -64 -5.80207 0.0517
NP_442797.1_6 Forward -253 -234 9.48548 0.243
NP_442797.1_7 Forward -157 -139 1.00246 0.267
NP_442797.1_7 Reverse -146 -164 -0.275845 0.282
NP_440199.1_10 Forward -86 -76 14.238 0.0861
NP_441072.1_2 Forward -94 -75 6.78429 0.269
NP_442489.1_2 Forward -110 -91 2.26107 0.27
NP_442489.1_7 Forward -83 -74 20.1576 0.000695
NP_442489.1_7 Reverse -74 -83 20.1576 0.000695
NP_442489.1_7 Reverse -246 -255 -1.57357 0.213
NP_442489.1_7 Reverse -96 -105 -1.86856 0.259
NP_440559.1_1 Forward -82 -73 17.4043 0.00658
NP_440559.1_1 Reverse -75 -84 8.65285 0.0586
NP_441659.2_8 Reverse -74 -84 20.9245 0.000805
NP_441659.2_8 Forward -83 -73 18.1713 0.00133
NP_442913.1_10 Forward -92 -73 -0.983855 0.165
NP_442913.1_10 Forward -171 -152 -1.37718 0.17
NP_440708.1_6 Forward -142 -123 -0.39387 0.195
NP_440315.1_6 Forward -294 -278 10.1866 0.126
NP_442346.1_5 Reverse -73 -83 16.6963 0.00248
NP_442346.1_5 Forward -84 -74 16.303 0.00248
NP_440545.1_3 Reverse -70 -87 -6.746 0.287
NP_441856.1_3 Forward -86 -67 0.0977854 0.216
NP_441653.1_2 Reverse -235 -254 3.62625 0.264
NP_442603.1_7 Forward -83 -69 7.17714 0.211
NP_441948.1_4 Forward -262 -244 -3.71743 0.203
NP_441833.1_4 Forward -82 -75 15.9687 0.0124
NP_441833.1_4 Reverse -75 -82 15.9687 0.0124
NP_443040.1_1 Forward -395 -381 10.3772 0.291
NP_442162.1_9 Forward -82 -75 16.2637 0.0124
NP_442162.1_9 Reverse -75 -82 16.2637 0.0124
NP_440671.1_4 Forward -89 -75 14.6509 0.0573
NP_442404.1_3 Forward -46 -27 21.1406 0.0615
NP_441973.1_1 Reverse -144 -159 -7.19826 0.29
NP_442199.1_5 Reverse -238 -257 -4.42544 0.228
NP_442140.1_3 Forward -82 -72 12.2714 0.0632
NP_442140.1_3 Reverse -247 -257 4.3066 0.248
NP_442140.1_3 Forward -254 -244 4.10993 0.261
NP_440875.1_9 Forward -253 -243 11.5841 0.162
NP_440875.1_9 Reverse -76 -86 7.59334 0.255
NP_441813.1_5 Forward -85 -75 15.9097 0.01
NP_441813.1_5 Reverse -72 -82 8.63316 0.0367
NP_440590.1_4 Forward -82 -69 0.805932 0.143
NP_440590.1_4 Reverse -75 -88 -3.81562 0.255
NP_440567.1_1 Forward -82 -68 11.406 0.0286
NP_440567.1_1 Reverse -75 -89 6.88276 0.08
NP_440567.1_1 Forward -254 -240 0.786239 0.232
NP_442497.1_10 Reverse -75 -84 17.601 0.00813
NP_442497.1_10 Forward -82 -73 10.4228 0.0087
NP_440821.1_4 Forward -85 -75 11.0914 0.0146
NP_440821.1_4 Reverse -72 -82 9.41981 0.0286
NP_440821.1_4 Reverse -244 -254 -0.708283 0.287
NP_441239.1_9 Forward -85 -73 12.1337 0.0494
NP_441239.1_9 Reverse -244 -256 5.25052 0.223
NP_441239.1_9 Forward -257 -245 4.5622 0.251
NP_441239.1_9 Reverse -72 -84 3.38223 0.285
NP_441936.1_9 Reverse -286 -305 13.3725 0.26
NP_441617.1_6 Reverse -67 -86 6.88262 0.121
NP_440546.1_4 Reverse -74 -84 13.5365 0.0459
NP_440546.1_4 Forward -83 -73 10.046 0.109
NP_440055.1_10 Reverse -381 -399 16.2132 0.292
NP_440675.1_1 Reverse -71 -90 7.96426 0.195
NP_440462.1_6 Forward -85 -75 16.893 0.00853
NP_440462.1_6 Reverse -244 -254 4.99491 0.175
NP_440462.1_6 Reverse -72 -82 1.35667 0.294
NP_440868.1_4 Reverse -70 -82 8.10212 0.0602
NP_440868.1_4 Forward -87 -75 6.23383 0.0878
NP_440868.1_4 Reverse -242 -254 0.0389777 0.234
NP_441084.1_6 Forward -85 -71 16.8098 0.0523
NP_442039.1_4 Forward -82 -75 15.1821 0.0124
NP_442039.1_4 Reverse -75 -82 15.1821 0.0124
NP_442679.1_1 Reverse -94 -113 3.34271 0.153
NP_441926.1_3 Reverse -74 -90 24.5429 0.00176
NP_440825.1_7 Forward -82 -72 12.9096 0.152
NP_442837.1_3 Forward -82 -75 15.7721 0.0124
NP_442837.1_3 Reverse -75 -82 15.7721 0.0124
NP_440160.1_2 Forward -149 -130 -8.65367 0.286
NP_442053.1_1 Forward -83 -74 18.3876 0.0007
NP_442053.1_1 Reverse -74 -83 18.3876 0.0007
NP_440505.1_3 Forward -85 -75 15.123 0.014
NP_440505.1_3 Reverse -72 -82 9.22315 0.122
NP_440505.1_3 Forward -152 -142 4.50326 0.284
NP_442659.1_10 Forward -339 -320 16.5752 0.247
NP_441252.1_6 Reverse -122 -129 14.1004 0.25
NP_441203.1_1 Forward -82 -63 -12.1936 0.143
NP_440914.1_1 Forward -83 -73 17.5935 0.000537
NP_440914.1_1 Reverse -74 -84 16.3248 0.00196
NP_441011.1_8 Reverse -75 -84 16.6177 0.00602
NP_441011.1_8 Forward -82 -73 8.25953 0.144
NP_442533.1_6 Forward -83 -74 17.2076 0.00137
NP_442533.1_6 Reverse -74 -83 17.2076 0.00137
NP_442533.1_6 Reverse -141 -150 5.21127 0.15
NP_442533.1_6 Forward -148 -139 2.35967 0.259
NP_442533.1_6 Reverse -260 -269 1.96635 0.28
NP_441482.1_7 Forward -89 -75 -10.8168 0.216
NP_439944.1_9 Reverse -75 -85 17.6796 0.00347
NP_439944.1_9 Forward -82 -72 10.5014 0.0887
NP_442202.1_10 Forward -256 -242 5.01447 0.255
NP_441527.1_4 Reverse -50 -69 -8.83343 0.251
NP_441527.1_5 Forward -85 -66 18.3276 0.169
NP_440007.1_9 Forward -87 -73 9.2427 0.171
NP_441680.1_4 Forward -222 -203 1.0811 0.246
NP_440608.1_2 Forward -48 -29 5.01433 0.231
NP_441972.1_5 Reverse -140 -159 -9.83364 0.293
NP_441106.1_1 Forward -84 -75 18.486 0.0028
NP_441106.1_1 Reverse -73 -82 9.63616 0.0311
NP_441106.1_1 Reverse -245 -254 5.3096 0.162
NP_439903.1_6 Forward -86 -67 6.48849 0.167
NP_442306.1_10 Forward -88 -69 -20.4534 0.21
NP_441286.1_1 Reverse -73 -85 14.3953 0.00424
NP_441286.1_1 Forward -84 -72 3.48056 0.0467
NP_441286.1_1 Forward -151 -139 -5.07423 0.188
NP_441286.1_1 Forward -106 -94 -5.46756 0.203
NP_440670.1_8 Forward -83 -74 18.3876 0.000699
NP_440670.1_8 Reverse -74 -83 18.3876 0.000699
NP_440886.1_7 Forward -84 -74 8.04271 0.0805
NP_440886.1_7 Reverse -73 -83 7.94438 0.0805
NP_440886.1_7 Reverse -204 -214 3.12618 0.296
NP_440828.1_1 Forward -253 -234 5.60352 0.206
NP_442072.1_9 Reverse -73 -91 -2.93078 0.0325
NP_440907.2_8 Reverse -75 -85 9.51767 0.103
NP_440907.2_8 Forward -82 -72 7.64939 0.117
NP_441021.1_1 Forward -82 -63 -10.3253 0.234
NP_440326.1_5 Reverse -72 -85 15.2606 0.179
NP_440841.1_4 Forward -85 -66 -0.39387 0.132
NP_441463.1_3 Reverse -149 -168 -9.24366 0.278
NP_441463.1_3 Reverse -329 -348 -9.53865 0.28
NP_441463.1_3 Reverse -236 -255 -9.63698 0.282
NP_441463.1_6 Forward -85 -71 6.99573 0.265
NP_442842.1_4 Forward -149 -130 6.19431 0.223
NP_442893.1_4 Forward -200 -181 -1.77127 0.273
NP_441626.1_2 Forward -82 -75 15.7721 0.0124
NP_441626.1_2 Reverse -75 -82 15.7721 0.0124
NP_442794.1_1 Reverse -70 -82 9.28209 0.0795
NP_442794.1_1 Forward -109 -97 2.98891 0.286
NP_442615.1_1 Forward -92 -74 -0.669169 0.12
NP_442615.1_1 Reverse -65 -83 -2.53746 0.145
NP_441962.1_4 Forward -88 -69 -11.7019 0.244
NP_441962.1_9 Forward -223 -204 5.89931 0.258
NP_440387.1_1 Forward -83 -67 13.4315 0.00865
NP_440387.1_1 Reverse -74 -90 8.515 0.0282
NP_441431.1_2 Reverse -243 -257 7.07881 0.251
NP_441065.1_2 Reverse -182 -201 13.2677 0.18
NP_440114.1_10 Reverse -74 -88 16.2242 0.0194
NP_441510.2_6 Reverse -129 -148 12.4867 0.279
NP_441237.1_9 Forward -82 -72 14.828 0.0242
NP_442930.1_1 Reverse -191 -201 11.5826 0.258
NP_439910.1_2 Forward -91 -74 -11.8592 0.0788
NP_440457.1_1 Forward -87 -75 9.67541 0.092
NP_440798.1_6 Forward -254 -241 3.06754 0.153
NP_441981.1_9 Forward -136 -122 16.6175 0.293
NP_442509.1_6 Reverse -208 -227 9.53756 0.294
NP_442509.1_9 Forward -83 -73 8.14104 0.192
NP_442509.1_9 Reverse -74 -84 8.04271 0.192
NP_440554.1_4 Reverse -75 -85 16.1063 0.0189
NP_441885.1_5 Forward -83 -73 20.9245 0.000538
NP_441885.1_5 Reverse -74 -84 11.3864 0.00668
NP_441885.1_5 Reverse -141 -151 7.94484 0.0385
NP_442341.1_7 Forward -106 -92 7.47274 0.105
NP_442341.1_7 Forward -84 -70 5.21113 0.165
NP_442341.1_7 Forward -256 -242 1.17956 0.297
NP_442341.1_9 Forward -85 -71 9.24208 0.155
NP_442341.1_9 Reverse -72 -86 6.39049 0.228
NP_443000.1_7 Forward -85 -75 17.4829 0.00719
NP_443000.1_7 Reverse -72 -82 10.3048 0.0345
NP_440507.2_3 Reverse -144 -163 9.04509 0.236
NP_441842.1_10 Reverse -239 -253 15.9292 0.0359
NP_440275.1_3 Forward -85 -75 9.12481 0.055
NP_440275.1_3 Reverse -72 -82 8.04317 0.0602
NP_440275.1_3 Forward -216 -206 1.74999 0.285
NP_440091.1_1 Forward -87 -75 10.8554 0.0429
NP_440216.1_1 Reverse -74 -88 7.37441 0.00942
NP_440216.1_1 Forward -83 -69 -10.6202 0.145
NP_440216.1_1 Forward -150 -136 -12.5868 0.288
NP_440216.1_1 Reverse -246 -260 -12.6851 0.296
NP_440172.1_1 Reverse -74 -84 17.5813 0.00421
NP_440172.1_1 Forward -83 -73 15.0247 0.00945
NP_442371.1_1 Forward -397 -387 17.0891 0.086
NP_442015.1_10 Reverse -70 -83 1.39592 0.204
NP_441045.1_4 Reverse -282 -301 13.8641 0.274
NP_442329.1_7 Forward -140 -121 16.5182 0.162
NP_441226.1_7 Forward -82 -75 14.4934 0.0123
NP_441226.1_7 Reverse -75 -82 14.4934 0.0123
NP_442834.1_9 Forward -101 -82 3.93269 0.298
NP_441111.1_7 Forward -82 -74 18.7023 0.00294
NP_441111.1_7 Reverse -75 -83 18.7023 0.00294
NP_442379.1_10 Forward -90 -73 8.00365 0.102
NP_441766.1_2 Forward -83 -74 17.5026 0.00297
NP_441766.1_2 Reverse -74 -83 17.5026 0.00297
NP_441766.1_2 Reverse -205 -214 1.67135 0.278
NP_440416.1_9 Forward -262 -243 -19.0768 0.269
NP_443052.1_8 Forward -93 -74 -7.86702 0.164
NP_442564.1_4 Reverse -75 -94 18.3003 0.216
NP_440261.1_5 Forward -82 -69 -10.3055 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CAACTGGAAAAAATTCAATACCCTGAGAGAATAAATAATATTCAATCAAAAATCCGATTATGGTTTTGATGGATTCGTGGTACTCTCCCAGGGTCATGAACTCAATTACTCCGTCAAAATAGGTGATACGTAGCCCTGACCGTTGTTCCATCGCCGCCTGAATCGTCTTAAAATCTTCCCAACTATGACGACCGGGGAGGATAAAATTTTGACTTTCACTGAGAGTTAACGGAGAAGTGGCGACGCTCATGGGGACAGCCCTCTGCTTGGGTTGCACAAATGCTACATTCCCTATGTTAATCGCCCTTGGAGTGAAAGGCGATCGCCAAAATATATCCCCTGAACTCTTCTAAGGGGACTGTCAGGGTAAGCCTTTTGGACAATAAACAGTATTGAAGTT

CDS

ATGACCACCCCCGATCGCCTATTGCAACTGCGCCAACAACTCCAAAAAGCCAGCTACGCCTACTATGTACTGGATGCGCCGGTCATGGAGGACAGCGTTTACGACCAGCTTTACCGGGAACTGCAAAGGCTAGAGGCAGAAAATCCGGAGTTAATTACCCCCGACAGTCCGACCCAACGAGTGGGGGAGCAACCGGCCAGTCAGTTCCGCTCTGTTGCCCATAATATTCCCCTCTACAGCCTAGAAAATGCCTTTAATGTGCAGGAATTACAACAGTGGCAAGAACGCTGGCAACGCATTGCCCCAACCATCGAAAAGGCTGAATACGTCTGTGAGCTAAAAATTGACGGCTCGGCGATCGCCCTGACCTATGAGAATGGTTTGTTGGTGCGGGGGGTAACTAGGGGAGACGGCACCACCGGGGAAGAAATTAGCCAAAATATTAAAACCATTCGATCCATTCCCGTGAAGCTTAATTTAGATAATCCTCCCCCAACGGTGGAAGTGAGGGGGGAAGCCTTTTTGCCCCTAGAAGAATTTAATCGTATTAATCACGAGCGGGAAGCCCAGGGAGAAAGCTTATTTGCCAATCCCCGTAATGCCGCCGCCGGTACTCTCCGTCAGTTGGACCCCAAAATAGTCCACCAAAGACGCTTACAATTTTTTGCCTATACGCTCCATTTACCAGGGCAAGAAGACAAAATCCAAAGTCAATGGCAAGCTTTGGAATATCTCAAAAAAGCTGGCTTTATGGTTAATCCCCATTGTCAGCTCTGTAAAGGTTTAGATGAAGTAGTGGCATATTTTGAAGACTGGGAAGGCGCCCGGCAACGCTTACCCTATATGACCGACGGGGTGGTGGTGAAAATTAATCAGTATCCCCTGCAAAGAGAGTTAGGCTTCACCCAAAAATTTCCCCGCTGGGCGATCGCCTTAAAATATCCTGCCGAAGAAACCCCCACCGTAGTCAAAGCCATTGAAGTTAATGTGGGCCGCACCGGCGCAGTCACCCCCCTAGCCGTGATGGAGCCAGTACAGTTAGCCGGCACCACGGTACAAAGAGCCACTCTGCATAACCAAGACCGCATCCAAGAATTAGATATCCGGGTGGGGGACACGGTAATTATTCGCAAAGCAGGGGAAATTATCCCCGAAGTGGTCCGGGTAATGACAGAATTGCGCCCGGAAAACACCACCCCCTACATTTTTCCTTCCCATTGCCCGGCCTGTGGTTCCCCCTTGGTCCGACCCCTGGAAGAAGCTGTCATCCGTTGTGTCAATAGTTCCTGCTCCGCTATTTTGCAAGGCAGTTTAATTCACTGGGCTAGCCGCAACGCTTTGGATATCCAGGGTTTGGGGGAAAAAGTTGTGATTACGCTCTTGGAAAATCGGTTAGTCAACTCCGTTGCTGATTTATATGGTTTACAGGTGGAGCAGTTGTTAGGATTAGAACGTTTTGCCCAAAAATCCGCCGAAAAATTAATTGCCGCCATTGAAGTTAGCAAAAGCCAACCCTGGAGCCGCATTTTATTTGGCTTAGGTATCCGCCATGTGGGCCAGGTAAATGCCAAATTACTCAGCCAACAGTTTCCCACCGTGGAAAAACTAAGCCAAGCCAGCATTCCCGACCTGGAAGGAGTCTATGGCATTGGCCCAGAAATTGCCGAAGCCGTGGTTAATTGGTTCAGGAACCCCGGTAATCAACAATTAATTCAAGATTTAGAGGAGTTGGGTTTAGTATTGGCAAACCAAGGGATTGACCAGACCAAAACTGACAGCGGCAAGTTAAAGGGCAAAACCTTTGTGTTAACCGGGACTTTGCCCAACCTTAGTCGCCTAGAAGCTCAGGAATTAATTGAACAGAGCGGCGGTAAAGTAACCAGCAGTGTAAGTACCAAAACTGATTATGTTCTCTTGGGAGATAAACCAGGAAGTAAGGCCGCCAAGGCGGAAAGTTTGGGCATCAAGTTACTATCTGAGGCGGAGTTTTTACAATTGTTGGAGCCGTAG

Protein

MTTPDRLLQLRQQLQKASYAYYVLDAPVMEDSVYDQLYRELQRLEAENPELITPDSPTQRVGEQPASQFRSVAHNIPLYSLENAFNVQELQQWQERWQRIAPTIEKAEYVCELKIDGSAIALTYENGLLVRGVTRGDGTTGEEISQNIKTIRSIPVKLNLDNPPPTVEVRGEAFLPLEEFNRINHEREAQGESLFANPRNAAAGTLRQLDPKIVHQRRLQFFAYTLHLPGQEDKIQSQWQALEYLKKAGFMVNPHCQLCKGLDEVVAYFEDWEGARQRLPYMTDGVVVKINQYPLQRELGFTQKFPRWAIALKYPAEETPTVVKAIEVNVGRTGAVTPLAVMEPVQLAGTTVQRATLHNQDRIQELDIRVGDTVIIRKAGEIIPEVVRVMTELRPENTTPYIFPSHCPACGSPLVRPLEEAVIRCVNSSCSAILQGSLIHWASRNALDIQGLGEKVVITLLENRLVNSVADLYGLQVEQLLGLERFAQKSAEKLIAAIEVSKSQPWSRILFGLGIRHVGQVNAKLLSQQFPTVEKLSQASIPDLEGVYGIGPEIAEAVVNWFRNPGNQQLIQDLEELGLVLANQGIDQTKTDSGKLKGKTFVLTGTLPNLSRLEAQELIEQSGGKVTSSVSTKTDYVLLGDKPGSKAAKAESLGIKLLSEAEFLQLLEP