Your browser is old and dusty. Try Google Chrome!

Details for sll1143

ORF sll1143
Accession NP_440825.1
Symbol pcrA
Category ATP-dependent helicase PcrA
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -95 -81 1.67122 0.183
NP_441061.1_2 Reverse -344 -358 0.294584 0.213
NP_441061.1_2 Forward -369 -355 -2.26202 0.287
NP_441418.1_6 Forward -96 -77 -29.1065 0.216
NP_442291.1_5 Reverse -86 -102 -0.728113 0.189
NP_441453.1_4 Forward -96 -88 7.09925 0.0962
NP_441453.1_4 Reverse -87 -95 7.00092 0.107
NP_441453.1_4 Forward -198 -190 4.05099 0.268
NP_441453.1_7 Reverse -371 -378 13.4121 0.23
NP_442151.1_6 Forward -96 -82 14.2576 0.0379
NP_441818.1_1 Reverse -88 -99 13.5295 0.0731
NP_442623.1_3 Forward -95 -76 -9.34199 0.141
NP_442623.1_4 Forward -164 -145 -0.39387 0.252
NP_440150.1_2 Reverse -83 -102 4.22689 0.281
NP_440996.1_3 Forward -256 -238 11.7205 0.221
NP_442173.1_1 Forward -95 -87 12.9008 0.0296
NP_442173.1_1 Reverse -88 -96 5.72262 0.203
NP_442752.1_4 Forward -331 -324 10.5605 0.1
NP_442752.1_4 Reverse -204 -211 8.20058 0.127
NP_442752.1_4 Forward -294 -287 5.25066 0.256
NP_443027.1_4 Reverse -364 -374 10.5998 0.124
NP_440784.1_7 Reverse -88 -95 6.3323 0.228
NP_440784.1_7 Forward -95 -88 6.13563 0.241
NP_441681.1_1 Forward -284 -265 10.6192 0.19
NP_439979.1_9 Forward -95 -77 9.16393 0.257
NP_442062.1_8 Forward -96 -86 15.713 0.00658
NP_442062.1_8 Reverse -87 -97 8.04317 0.0816
NP_440304.1_4 Forward -98 -88 17.0896 0.0136
NP_440304.1_4 Reverse -85 -95 8.63316 0.0721
NP_440304.1_4 Reverse -359 -369 5.28991 0.218
NP_442242.1_4 Forward -95 -88 11.8388 0.0776
NP_440853.1_5 Forward -285 -266 15.1424 0.179
NP_441352.1_1 Forward -381 -362 30.2854 0.000363
NP_441352.1_2 Forward -326 -307 22.4189 0.0268
NP_441352.1_3 Forward -306 -287 26.5488 0.00628
NP_441352.1_4 Forward -285 -266 26.7455 0.00346
NP_441352.1_7 Forward -348 -329 20.4523 0.126
NP_441352.1_9 Forward -261 -242 23.5989 0.0285
NP_442742.1_9 Forward -240 -221 -12.4886 0.269
NP_442110.1_7 Forward -96 -82 8.75105 0.083
NP_441083.1_5 Forward -96 -86 10.5014 0.0197
NP_441083.1_5 Reverse -87 -97 9.61647 0.0243
NP_441738.1_2 Reverse -89 -96 13.8051 0.0221
NP_441558.1_5 Reverse -79 -98 4.12936 0.29
NP_440209.1_1 Reverse -87 -95 8.37755 0.0576
NP_440209.1_1 Forward -96 -88 8.27922 0.0687
NP_442889.1_8 Forward -99 -85 9.04542 0.105
NP_441713.1_1 Reverse -81 -100 -5.9004 0.114
NP_441713.1_3 Reverse -369 -388 4.52268 0.253
NP_441713.1_8 Reverse -83 -101 7.19731 0.294
NP_440178.1_7 Reverse -86 -105 -15.7335 0.163
NP_440178.1_7 Forward -97 -78 -22.125 0.255
NP_441716.1_1 Forward -96 -82 19.9608 0.00829
NP_442111.1_4 Reverse -39 -53 3.73617 0.233
NP_440906.1_5 Forward -95 -88 6.13563 0.241
NP_440906.1_5 Reverse -88 -95 6.13563 0.241
NP_440747.1_10 Reverse -84 -96 7.51213 0.00286
NP_440747.1_10 Forward -99 -87 -11.7607 0.142
NP_442973.1_5 Forward -105 -86 11.9958 0.218
NP_441486.1_1 Reverse -84 -98 2.94952 0.0718
NP_441486.1_1 Forward -99 -85 2.16287 0.0892
NP_441486.1_1 Forward -117 -103 -4.32697 0.194
NP_442850.1_10 Forward -386 -367 17.4369 0.29
NP_442634.1_4 Forward -98 -84 -3.147 0.161
NP_440842.1_4 Reverse -136 -155 5.95507 0.148
NP_441014.1_10 Forward -305 -286 -0.984623 0.257
NP_442848.1_1 Forward -102 -88 -4.52363 0.294
NP_441012.1_4 Reverse -83 -96 13.9823 0.208
NP_443018.1_3 Forward -95 -88 12.0355 0.0639
NP_443018.1_3 Forward -89 -82 10.2655 0.107
NP_443018.1_3 Reverse -88 -95 5.64398 0.181
NP_441634.1_8 Forward -92 -78 -1.27871 0.285
NP_440376.1_1 Forward -96 -87 16.0277 0.00493
NP_440376.1_1 Reverse -87 -96 9.73449 0.0365
NP_443065.1_6 Forward -379 -360 9.0459 0.151
NP_442687.1_7 Reverse -86 -96 9.02648 0.0994
NP_442687.1_7 Forward -97 -87 8.92815 0.0994
NP_441077.1_3 Reverse -31 -50 17.1082 0.154
NP_441077.1_6 Reverse -24 -40 5.21204 0.253
NP_442958.1_3 Reverse -293 -312 -2.85214 0.299
NP_440642.1_10 Forward -58 -44 19.1735 0.119
NP_440642.1_10 Forward -365 -351 3.44058 0.273
NP_442296.1_5 Reverse -346 -365 1.47442 0.281
NP_442658.1_1 Forward -98 -88 5.58445 0.262
NP_442658.1_1 Reverse -85 -95 5.19112 0.28
NP_443061.1_4 Forward -314 -295 1.47442 0.279
NP_441317.1_4 Reverse -62 -76 17.2942 0.136
NP_441317.1_4 Reverse -60 -74 9.84592 0.29
NP_441958.1_5 Forward -97 -87 10.6981 0.0112
NP_441958.1_5 Reverse -86 -96 2.53664 0.0409
NP_441127.1_1 Reverse -301 -315 9.14437 0.278
NP_440203.1_5 Forward -93 -83 13.7459 0.111
NP_440995.1_8 Forward -208 -189 1.96607 0.264
NP_439990.1_5 Reverse -82 -95 11.229 0.128
NP_442376.1_8 Forward -314 -300 7.76774 0.281
NP_442690.1_1 Reverse -126 -145 -16.0285 0.283
NP_442911.1_2 Reverse -77 -96 4.71934 0.0369
NP_442911.1_2 Reverse -351 -370 -9.93197 0.267
NP_440369.1_5 Forward -97 -78 9.3409 0.276
NP_442064.1_1 Reverse -82 -101 -3.3438 0.159
NP_443055.1_6 Forward -312 -294 7.58986 0.156
NP_440993.1_4 Reverse -343 -360 9.67528 0.213
NP_441099.1_5 Reverse -77 -96 0.982764 0.0714
NP_442002.1_9 Forward -97 -90 13.0188 0.185
NP_441294.1_7 Reverse -108 -122 13.6661 0.0583
NP_441294.1_7 Forward -100 -86 8.77068 0.281
NP_442438.1_10 Forward -101 -87 0.491246 0.225
NP_442438.1_10 Reverse -82 -96 -0.983719 0.287
NP_440377.1_1 Forward -156 -139 12.3367 0.26
NP_440147.1_4 Reverse -308 -321 4.64084 0.153
NP_440147.1_4 Reverse -85 -98 -0.177378 0.276
NP_441550.1_8 Forward -98 -88 5.58445 0.242
NP_441916.1_7 Reverse -87 -97 7.15819 0.0745
NP_440206.1_4 Forward -380 -361 0.981987 0.289
NP_441041.1_4 Forward -96 -77 6.39097 0.0435
NP_441041.1_4 Forward -319 -300 2.0644 0.0758
NP_441041.1_4 Forward -331 -312 -10.1286 0.228
NP_441041.1_7 Forward -99 -87 11.3047 0.0842
NP_441725.1_5 Reverse -88 -98 11.4848 0.0247
NP_441725.1_5 Forward -95 -85 9.7148 0.0503
NP_441725.1_5 Forward -369 -359 7.05986 0.106
NP_439966.1_7 Reverse -85 -95 11.9759 0.0528
NP_442941.1_3 Forward -95 -85 10.1081 0.024
NP_442941.1_3 Reverse -88 -98 1.65166 0.147
NP_440289.1_2 Forward -99 -86 12.999 0.0132
NP_440289.1_2 Reverse -84 -97 -3.12731 0.265
NP_442281.1_1 Reverse -82 -96 5.89884 0.142
NP_442281.1_1 Forward -101 -87 2.65393 0.26
NP_440437.1_1 Forward -102 -83 -2.85214 0.227
NP_441556.1_4 Reverse -369 -388 12.3189 0.219
NP_441556.1_10 Reverse -70 -84 10.1245 0.275
NP_443030.1_4 Reverse -288 -307 -6.68705 0.289
NP_441644.1_6 Forward -96 -86 13.4509 0.019
NP_441644.1_6 Reverse -87 -97 6.37109 0.161
NP_443049.1_2 Reverse -85 -104 12.9791 0.176
NP_442215.1_2 Reverse -85 -101 5.6634 0.0775
NP_442215.1_2 Forward -98 -82 -5.54633 0.251
NP_442029.1_5 Reverse -269 -288 16.8047 0.217
NP_440929.1_8 Reverse -87 -96 9.53783 0.0296
NP_440929.1_8 Forward -96 -87 9.4395 0.0326
NP_442933.1_10 Reverse -87 -96 7.86621 0.103
NP_442933.1_10 Forward -96 -87 7.86621 0.103
NP_441751.2_8 Forward -95 -81 -3.44199 0.145
NP_441751.2_8 Reverse -88 -102 -4.22864 0.166
NP_442554.1_8 Forward -95 -85 6.66654 0.111
NP_442554.1_8 Reverse -88 -98 5.68323 0.141
NP_442554.1_8 Reverse -190 -200 3.12662 0.239
NP_442554.1_8 Forward -89 -79 3.12662 0.239
NP_442554.1_8 Reverse -362 -372 2.92996 0.249
NP_442142.1_4 Forward -99 -86 10.3434 0.0744
NP_442292.1_1 Forward -95 -86 8.65285 0.0335
NP_442292.1_1 Reverse -88 -97 -0.000272808 0.239
NP_443009.1_5 Reverse -86 -97 14.8078 0.0189
NP_443009.1_5 Forward -97 -86 7.138 0.137
NP_442741.1_7 Forward -346 -327 14.0608 0.196
NP_441715.1_4 Forward -95 -85 12.2714 0.0684
NP_440015.1_9 Reverse -87 -105 1.69077 0.231
NP_441298.1_3 Reverse -57 -67 16.1594 0.232
NP_440464.1_10 Reverse -178 -188 11.5758 0.298
NP_441468.1_1 Forward -95 -88 6.3323 0.202
NP_441468.1_1 Reverse -88 -95 6.13563 0.209
NP_441673.1_1 Reverse -87 -96 11.1111 0.0121
NP_441673.1_1 Forward -96 -87 11.0128 0.018
NP_441826.1_2 Forward -102 -88 17.6008 0.0143
NP_441826.1_2 Reverse -81 -95 -2.85201 0.277
NP_441637.1_9 Reverse -61 -79 5.03403 0.245
NP_441637.1_9 Forward -262 -244 3.3624 0.264
NP_442063.1_2 Reverse -270 -289 -1.7705 0.232
NP_442490.1_9 Reverse -366 -385 -8.65367 0.293
NP_441764.1_4 Forward -155 -138 11.7005 0.21
NP_442868.1_6 Reverse -85 -95 6.66654 0.103
NP_442719.1_2 Forward -262 -244 -1.06322 0.175
NP_442719.1_2 Forward -319 -301 -3.81647 0.203
NP_442719.1_2 Reverse -61 -79 -11.5846 0.292
NP_441056.1_1 Forward -96 -77 -5.11376 0.257
NP_441612.1_2 Forward -273 -263 12.1314 0.21
NP_442808.1_1 Forward -232 -222 11.4843 0.0481
NP_442542.1_2 Forward -98 -85 11.4257 0.114
NP_442050.1_1 Reverse -348 -367 7.57094 0.265
NP_442050.1_5 Reverse -85 -95 14.0409 0.0259
NP_442903.1_2 Forward -82 -63 3.867 0.24
NP_440346.1_6 Reverse -252 -262 14.1473 0.273
NP_440558.1_2 Reverse -78 -97 -0.590531 0.204
NP_440558.1_2 Forward -373 -354 -2.75381 0.229
NP_441518.1_3 Forward -208 -189 -13.6686 0.264
NP_441878.1_6 Forward -97 -87 11.9764 0.0155
NP_441878.1_6 Reverse -86 -96 1.25834 0.108
NP_441878.1_6 Reverse -360 -370 -7.39479 0.222
NP_441036.1_8 Forward -101 -91 6.56821 0.225
NP_441557.1_5 Reverse -87 -96 10.2261 0.0144
NP_441557.1_5 Forward -96 -87 10.1278 0.0188
NP_442066.2_4 Reverse -87 -106 6.09597 0.0944
NP_442183.1_1 Forward -96 -82 4.22782 0.271
NP_442166.1_7 Reverse -367 -381 11.111 0.19
NP_441574.1_1 Forward -331 -312 -2.0655 0.224
NP_441549.1_9 Reverse -83 -101 -6.86402 0.206
NP_441549.1_9 Forward -373 -355 -10.1089 0.269
NP_440861.1_3 Forward -342 -324 11.3272 0.271
NP_442347.1_2 Reverse -286 -295 4.42462 0.284
NP_442645.1_2 Forward -104 -85 -17.1101 0.248
NP_442645.1_2 Forward -321 -302 -17.7985 0.264
NP_442645.1_2 Reverse -358 -377 -18.6834 0.278
NP_441037.1_4 Forward -314 -304 8.77956 0.237
NP_442594.1_3 Forward -225 -206 15.8307 0.0458
NP_442317.1_6 Reverse -305 -324 3.14605 0.264
NP_441633.1_3 Reverse -85 -98 2.47756 0.0954
NP_441633.1_3 Reverse -320 -333 -6.56889 0.259
NP_440136.1_2 Forward -95 -88 13.4121 0.0388
NP_440136.1_2 Reverse -88 -95 6.23397 0.171
NP_442998.1_10 Forward -94 -87 12.5271 0.0457
NP_442998.1_10 Reverse -89 -96 6.23397 0.157
NP_440299.1_1 Reverse -83 -96 13.0967 0.0319
NP_442333.2_1 Forward -372 -353 -5.70374 0.25
NP_440256.1_1 Reverse -84 -103 -0.0988766 0.0893
NP_441559.1_8 Reverse -82 -96 3.44117 0.143
NP_440915.1_6 Reverse -83 -97 1.86788 0.131
NP_440915.1_6 Forward -379 -365 -2.75368 0.28
NP_440997.1_3 Forward -219 -200 10.7175 0.266
NP_442158.1_4 Forward -59 -49 11.8781 0.264
NP_441704.1_8 Reverse -76 -95 19.2715 0.0499
NP_442452.1_8 Reverse -81 -95 12.3887 0.273
NP_442866.1_1 Forward -375 -356 -7.57203 0.266
NP_440677.1_1 Reverse -369 -388 7.07928 0.243
NP_442386.1_9 Reverse -86 -95 10.1274 0.139
NP_442386.1_9 Forward -231 -222 7.57079 0.219
NP_442386.1_9 Reverse -348 -357 6.88247 0.219
NP_441750.1_4 Reverse -83 -102 10.4225 0.157
NP_441340.1_5 Reverse -88 -95 6.23397 0.132
NP_441340.1_5 Forward -95 -88 6.13563 0.175
NP_441340.1_5 Reverse -190 -197 3.97235 0.274
NP_441947.1_10 Forward -98 -80 0.0191479 0.276
NP_442484.1_2 Reverse -76 -95 1.57275 0.229
NP_440168.1_8 Reverse -298 -317 4.03102 0.235
NP_440327.1_6 Forward -343 -324 4.62101 0.272
NP_440586.1_8 Forward -89 -82 9.08521 0.178
NP_440586.1_8 Reverse -311 -318 5.64364 0.297
NP_442251.1_6 Forward -95 -88 11.9372 0.0749
NP_441262.1_3 Forward -96 -89 11.5438 0.0584
NP_443051.1_1 Forward -97 -88 8.25953 0.0414
NP_443051.1_1 Reverse -86 -95 0.688044 0.134
NP_439937.1_9 Forward -97 -80 0.628129 0.0978
NP_440439.1_1 Reverse -84 -97 -0.472371 0.221
NP_440372.1_2 Reverse -88 -95 6.62729 0.151
NP_440372.1_2 Forward -95 -88 6.52896 0.188
NP_442488.1_9 Reverse -77 -96 13.5691 0.19
NP_439977.1_5 Reverse -75 -94 -0.39387 0.225
NP_440139.1_1 Forward -102 -83 11.8967 0.0797
NP_441572.1_7 Forward -102 -83 -6.49039 0.293
NP_440267.1_2 Forward -101 -87 11.7003 0.125
NP_442384.1_10 Forward -96 -83 8.27909 0.0674
NP_442262.1_10 Forward -95 -88 12.4288 0.0538
NP_442262.1_10 Forward -197 -190 9.47889 0.187
NP_442262.1_10 Forward -89 -82 9.18389 0.211
NP_441689.1_5 Reverse -85 -95 12.4676 0.132
NP_441689.1_5 Reverse -187 -197 7.94438 0.18
NP_440344.1_10 Reverse -80 -97 -6.84433 0.115
NP_442917.1_1 Forward -156 -137 11.995 0.175
NP_441060.1_1 Forward -322 -303 11.4993 0.294
NP_442910.1_1 Reverse -80 -99 -7.96535 0.273
NP_441640.1_8 Forward -95 -76 3.04771 0.144
NP_442750.1_3 Reverse -51 -70 -3.83545 0.204
NP_440297.1_9 Reverse -88 -98 10.5998 0.0917
NP_440297.1_9 Forward -369 -359 6.96153 0.161
NP_440297.1_9 Forward -95 -85 6.76487 0.17
NP_440297.1_9 Reverse -82 -92 -0.216628 0.282
NP_440999.1_9 Reverse -83 -97 -0.492064 0.209
NP_440888.1_2 Forward -96 -82 14.5519 0.0168
NP_440888.1_2 Forward -346 -332 5.99717 0.254
NP_442892.1_6 Reverse -237 -256 3.14605 0.253
NP_442277.1_2 Reverse -269 -283 15.9292 0.178
NP_442033.1_10 Forward -98 -79 -4.72043 0.179
NP_442033.1_10 Forward -306 -287 -8.65367 0.205
NP_440575.1_1 Reverse -258 -277 0.392004 0.29
NP_440575.1_8 Forward -66 -47 6.98095 0.154
NP_441543.1_2 Forward -95 -86 7.27622 0.13
NP_442845.1_2 Forward -294 -280 4.12949 0.267
NP_442845.1_2 Reverse -81 -95 3.44117 0.29
NP_441304.1_10 Reverse -51 -60 13.5694 0.239
NP_441469.1_8 Reverse -360 -369 7.76787 0.227
NP_442315.1_1 Reverse -151 -169 5.72234 0.256
NP_443064.1_6 Reverse -87 -97 10.2399 0.166
NP_443064.1_6 Forward -96 -86 8.97947 0.254
NP_440710.1_1 Forward -104 -86 5.42735 0.113
NP_440710.1_1 Forward -378 -360 0.904127 0.151
NP_440220.1_4 Reverse -309 -328 6.98015 0.193
NP_441462.1_2 Reverse -87 -97 10.4031 0.011
NP_441462.1_2 Forward -96 -86 1.74999 0.0811
NP_443062.1_1 Forward -375 -357 10.7886 0.11
NP_443062.1_1 Forward -96 -78 8.05839 0.16
NP_443062.1_6 Reverse -79 -98 7.07928 0.176
NP_442204.1_1 Reverse -83 -94 -0.0396598 0.285
NP_442204.1_2 Forward -292 -273 9.83255 0.225
NP_441560.1_8 Reverse -82 -101 16.6743 0.068
NP_440516.1_6 Reverse -385 -399 13.2736 0.188
NP_440516.1_8 Reverse -87 -96 7.17789 0.0754
NP_440516.1_8 Forward -96 -87 7.07956 0.0867
NP_442080.1_7 Forward -54 -35 0.58944 0.229
NP_442428.1_5 Forward -374 -367 7.90559 0.0969
NP_442428.1_5 Forward -95 -88 6.43063 0.148
NP_442428.1_5 Reverse -88 -95 6.13563 0.209
NP_440783.1_2 Reverse -70 -89 -4.42544 0.243
NP_441267.1_3 Reverse -260 -278 17.6196 0.0911
NP_442120.1_10 Forward -102 -83 -15.2418 0.292
NP_442823.1_8 Forward -324 -305 11.7008 0.28
NP_440673.1_2 Reverse -300 -319 11.8529 0.162
NP_440673.1_3 Forward -94 -87 9.77388 0.167
NP_440673.1_3 Forward -47 -40 9.08556 0.202
NP_440865.1_9 Reverse -158 -177 -8.94866 0.273
NP_441052.1_2 Forward -96 -86 10.3048 0.0289
NP_441052.1_2 Reverse -87 -97 0.963343 0.255
NP_440992.1_2 Forward -324 -305 8.65258 0.291
NP_442219.1_9 Forward -95 -86 7.96454 0.0696
NP_440436.1_4 Forward -95 -86 13.9623 0.0193
NP_440436.1_4 Reverse -88 -97 6.39082 0.162
NP_440314.1_9 Forward -239 -220 -3.24547 0.179
NP_441719.1_4 Reverse -88 -95 6.62729 0.151
NP_441719.1_4 Forward -95 -88 6.52896 0.188
NP_441004.1_1 Forward -337 -318 -13.5702 0.259
NP_441004.1_4 Forward -334 -324 11.2881 0.254
NP_441004.1_5 Forward -335 -321 7.66941 0.284
NP_442366.1_3 Forward -97 -79 2.28076 0.132
NP_442366.1_3 Forward -104 -86 -5.78238 0.296
NP_440328.1_8 Reverse -335 -354 16.4937 0.249
NP_443054.1_2 Reverse -85 -99 10.9143 0.0761
NP_441851.1_9 Forward -343 -324 10.7175 0.234
NP_441851.1_10 Forward -97 -87 15.8113 0.00552
NP_441851.1_10 Reverse -86 -96 6.07655 0.187
NP_441668.1_4 Reverse -30 -49 -1.7705 0.28
NP_442515.1_1 Reverse -86 -100 1.67122 0.152
NP_441396.1_5 Reverse -156 -165 7.37455 0.279
NP_441046.1_2 Forward -324 -305 18.3873 0.181
NP_441349.1_10 Reverse -77 -96 -7.86702 0.261
NP_441349.1_10 Forward -106 -87 -9.73531 0.297
NP_441661.1_3 Reverse -378 -395 -5.56602 0.281
NP_441409.1_6 Reverse -81 -100 -0.0988766 0.0673
NP_441409.1_8 Forward -81 -62 11.8368 0.209
NP_440432.1_9 Reverse -88 -103 -4.445 0.209
NP_440474.1_8 Reverse -362 -376 5.1122 0.257
NP_440431.1_3 Forward -97 -78 -9.63698 0.252
NP_442450.1_5 Forward -98 -88 9.32148 0.115
NP_440588.1_2 Reverse -78 -97 1.0811 0.139
NP_441570.1_1 Reverse -87 -105 -7.55234 0.0914
NP_441570.1_1 Reverse -361 -379 -16.7954 0.254
NP_441570.1_1 Forward -96 -78 -16.9921 0.26
NP_440078.1_8 Reverse -234 -253 1.0811 0.279
NP_441078.1_4 Reverse -87 -96 10.4228 0.0105
NP_441078.1_4 Forward -96 -87 10.3245 0.0119
NP_442348.1_2 Forward -255 -246 11.7994 0.225
NP_440707.1_9 Forward -330 -311 -0.000545616 0.293
NP_442443.1_1 Forward -327 -308 -6.29373 0.294
NP_441091.1_5 Forward -362 -343 2.94938 0.286
NP_440526.1_3 Reverse -88 -99 9.00628 0.105
NP_440526.1_3 Reverse -190 -201 0.54986 0.275
NP_441432.1_8 Reverse -86 -95 17.7976 0.00595
NP_441432.1_8 Reverse -188 -197 3.04799 0.268
NP_442320.1_8 Reverse -81 -95 -3.83532 0.134
NP_441732.1_2 Reverse -83 -99 -17.4444 0.258
NP_442343.1_10 Forward -173 -154 11.5042 0.289
NP_442797.1_6 Reverse -312 -331 14.5272 0.171
NP_442274.1_3 Forward -58 -39 9.93088 0.297
NP_441945.1_10 Forward -388 -369 6.58763 0.299
NP_441057.1_4 Forward -313 -295 -1.55415 0.272
NP_440913.1_1 Reverse -85 -103 5.82068 0.234
NP_441072.1_2 Forward -330 -311 7.7676 0.252
NP_440713.1_4 Reverse -77 -96 4.22769 0.231
NP_442489.1_7 Forward -96 -87 17.601 0.00221
NP_442489.1_7 Reverse -87 -96 10.4228 0.0151
NP_442079.1_7 Forward -95 -76 4.71934 0.187
NP_440559.1_1 Reverse -88 -97 14.0611 0.0342
NP_440559.1_1 Forward -95 -86 7.57121 0.106
NP_440559.1_1 Reverse -190 -199 4.12963 0.295
NP_441659.2_8 Reverse -87 -97 9.91146 0.0256
NP_441659.2_8 Forward -96 -86 8.33817 0.0443
NP_442913.1_10 Forward -105 -86 -1.57384 0.172
NP_440779.1_5 Reverse -189 -206 -14.0225 0.238
NP_442346.1_5 Reverse -86 -96 13.943 0.0183
NP_442346.1_5 Forward -97 -87 8.82982 0.124
NP_440352.1_5 Reverse -42 -61 12.6557 0.228
NP_440545.1_3 Reverse -77 -94 -2.61609 0.189
NP_440545.1_3 Reverse -83 -100 -5.95935 0.265
NP_440545.1_3 Forward -374 -357 -6.54933 0.283
NP_440459.1_2 Reverse -352 -369 8.29864 0.266
NP_442551.1_4 Forward -372 -357 -3.36336 0.287
NP_442603.1_7 Forward -96 -82 9.93039 0.137
NP_441833.1_4 Reverse -88 -95 6.23397 0.163
NP_441833.1_4 Forward -95 -88 6.13563 0.198
NP_442162.1_9 Forward -95 -88 12.6255 0.0393
NP_442162.1_9 Reverse -88 -95 6.52896 0.178
NP_440671.1_4 Forward -102 -88 13.7659 0.0748
NP_440671.1_4 Reverse -81 -95 8.65272 0.193
NP_442199.1_5 Forward -327 -308 -0.000545616 0.175
NP_442199.1_7 Forward -164 -145 5.11187 0.223
NP_440875.1_9 Reverse -287 -297 9.44274 0.233
NP_441813.1_5 Forward -98 -88 6.27322 0.0971
NP_441813.1_5 Reverse -85 -95 6.17489 0.1
NP_442089.1_1 Reverse -307 -326 -1.37718 0.269
NP_440590.1_4 Forward -95 -82 -3.71729 0.255
NP_442497.1_10 Reverse -88 -97 10.1278 0.0166
NP_442497.1_10 Forward -95 -86 0.589713 0.153
NP_440821.1_4 Forward -98 -88 10.0098 0.0221
NP_440821.1_4 Reverse -85 -95 8.53483 0.0468
NP_441239.1_9 Reverse -85 -97 6.03717 0.202
NP_440400.1_1 Reverse -313 -332 -2.8529 0.288
NP_441017.1_6 Forward -94 -80 15.3386 0.109
NP_440212.1_5 Reverse -178 -197 13.2741 0.273
NP_441656.1_6 Forward -305 -286 5.60432 0.289
NP_440462.1_6 Forward -296 -286 2.63497 0.28
NP_442340.1_3 Forward -242 -223 -6.98204 0.227
NP_442402.1_4 Forward -258 -239 -3.44288 0.216
NP_441084.1_6 Forward -228 -214 13.0285 0.146
NP_442039.1_4 Forward -95 -88 14.3954 0.0271
NP_442679.1_1 Forward -281 -262 0.0977854 0.211
NP_441926.1_3 Reverse -87 -103 3.59845 0.215
NP_440825.1_1 Forward -192 -173 20.5506 0.00748
NP_440825.1_7 Forward -48 -38 14.7639 0.152
NP_442837.1_3 Reverse -88 -95 6.0373 0.25
NP_442837.1_3 Forward -95 -88 5.93897 0.265
NP_442053.1_1 Reverse -87 -96 8.65285 0.0741
NP_442053.1_1 Forward -96 -87 8.55452 0.0784
NP_440505.1_3 Reverse -85 -95 14.6313 0.019
NP_440505.1_3 Forward -98 -88 4.50326 0.284
NP_442532.1_7 Forward -331 -317 2.35953 0.245
NP_440914.1_1 Forward -96 -86 8.32233 0.197
NP_440914.1_1 Reverse -87 -97 6.56569 0.273
NP_442101.1_10 Reverse -79 -98 -8.94866 0.243
NP_442533.1_6 Reverse -87 -96 8.65285 0.0727
NP_442533.1_6 Forward -96 -87 7.96454 0.0838
NP_442533.1_6 Reverse -310 -319 3.63797 0.206
NP_442541.1_10 Forward -370 -356 1.37564 0.287
NP_441482.1_7 Reverse -81 -95 -9.14519 0.194
NP_441482.1_7 Forward -102 -88 -9.34185 0.198
NP_439944.1_9 Forward -95 -85 9.41981 0.1
NP_439944.1_9 Reverse -88 -98 7.84651 0.127
NP_439944.1_9 Reverse -190 -200 4.79825 0.296
NP_441697.1_5 Forward -75 -56 -9.1199 0.268
NP_441697.1_5 Forward -76 -57 -10.4568 0.279
NP_440116.1_5 Reverse -261 -278 3.67709 0.225
NP_440116.1_8 Forward -95 -76 3.53937 0.0795
NP_441527.1_4 Forward -76 -57 0.142815 0.139
NP_441527.1_4 Forward -78 -59 -3.77235 0.173
NP_441527.1_4 Forward -77 -58 -6.8281 0.226
NP_441527.1_4 Forward -83 -64 -7.68752 0.236
NP_441527.1_4 Forward -287 -268 -11.5072 0.282
NP_440115.1_6 Reverse -84 -94 7.35486 0.147
NP_440007.1_9 Forward -362 -348 2.5562 0.277
NP_440007.1_9 Forward -379 -365 2.35953 0.281
NP_440007.1_9 Forward -100 -86 1.76955 0.285
NP_442728.1_7 Reverse -183 -197 10.6193 0.297
NP_439965.1_7 Forward -307 -288 11.7797 0.294
NP_441680.1_4 Reverse -345 -364 10.9142 0.153
NP_441825.1_4 Forward -255 -245 12.5664 0.249
NP_439903.1_6 Forward -373 -354 5.99684 0.173
NP_439903.1_6 Forward -322 -303 -0.689632 0.284
NP_001035870.1_3 Reverse -29 -48 -1.18052 0.224
NP_441286.1_1 Reverse -86 -98 14.1986 0.00473
NP_441286.1_1 Forward -97 -85 2.10393 0.0737
NP_442674.1_3 Forward -339 -320 11.3067 0.174
NP_440670.1_8 Forward -96 -87 15.1427 0.00768
NP_440670.1_8 Reverse -87 -96 8.65285 0.0627
NP_441930.1_2 Reverse -360 -370 11.5831 0.285
NP_440886.1_7 Reverse -86 -96 5.38779 0.185
NP_441784.1_8 Forward -177 -158 12.8808 0.278
NP_442072.1_9 Reverse -86 -104 -13.0589 0.098
NP_442264.1_2 Forward -100 -83 12.4285 0.164
NP_441463.1_3 Forward -380 -361 -9.53865 0.28
NP_441463.1_3 Reverse -77 -96 -10.1286 0.289
NP_441463.1_6 Forward -98 -84 9.79811 0.242
NP_441463.1_6 Reverse -85 -99 7.38227 0.261
NP_441626.1_2 Forward -95 -88 6.43063 0.147
NP_441626.1_2 Reverse -88 -95 6.0373 0.212
NP_439958.1_5 Reverse -249 -268 14.7491 0.218
NP_442365.1_7 Reverse -357 -376 -4.52377 0.245
NP_442365.1_7 Reverse -83 -102 -6.68705 0.299
NP_442794.1_1 Reverse -83 -95 17.1486 0.0232
NP_442615.1_1 Forward -328 -310 -7.25734 0.283
NP_442467.1_8 Reverse -176 -195 20.1573 0.258
NP_441962.1_4 Reverse -356 -375 -10.1286 0.224
NP_441962.1_4 Forward -95 -76 -12.8819 0.265
NP_440387.1_1 Forward -331 -315 -5.84132 0.254
NP_440855.1_1 Reverse -366 -385 -1.27885 0.279
NP_440855.1_5 Forward -385 -366 3.04693 0.287
NP_441993.1_1 Reverse -87 -106 4.96787 0.21
NP_440814.1_4 Forward -321 -302 -8.26035 0.221
NP_440114.1_10 Reverse -87 -101 14.9459 0.0326
NP_440114.1_10 Reverse -168 -182 8.16106 0.213
NP_440766.1_4 Reverse -83 -97 5.21113 0.113
NP_441237.1_9 Reverse -190 -200 9.7148 0.272
NP_442930.1_1 Forward -64 -54 11.091 0.26
NP_440457.1_1 Forward -100 -88 9.77374 0.092
NP_440798.1_6 Reverse -169 -182 0.0192843 0.294
NP_442680.1_5 Reverse -240 -259 0.3653 0.268
NP_442509.1_9 Reverse -87 -97 14.3359 0.031
NP_442936.1_10 Forward -68 -54 9.64668 0.268
NP_442936.1_10 Forward -147 -133 9.55098 0.268
NP_442514.1_5 Reverse -335 -354 -6.19614 0.264
NP_440554.1_4 Forward -197 -187 5.48657 0.145
NP_441885.1_5 Forward -96 -86 11.0914 0.00874
NP_441885.1_5 Reverse -87 -97 2.24165 0.0822
NP_441885.1_5 Reverse -189 -199 -1.49493 0.264
NP_441428.1_8 Reverse -353 -372 6.68596 0.216
NP_442341.1_7 Reverse -342 -356 6.78443 0.118
NP_442341.1_7 Reverse -86 -100 5.50613 0.154
NP_442341.1_7 Forward -97 -83 4.12949 0.2
NP_442341.1_7 Reverse -321 -335 3.04785 0.237
NP_443000.1_7 Reverse -85 -95 7.35486 0.0859
NP_440507.2_3 Reverse -78 -97 9.24175 0.227
NP_440091.1_1 Forward -100 -88 1.02229 0.218
NP_441183.1_2 Forward -67 -57 17.1143 0.243
NP_442638.1_3 Forward -161 -142 10.074 0.298
NP_439962.1_4 Forward -383 -364 -8.16202 0.292
NP_440149.1_8 Forward -96 -77 -1.96717 0.162
NP_440149.1_8 Reverse -360 -379 -2.75381 0.175
NP_440149.1_10 Reverse -361 -380 -11.9969 0.285
NP_441105.1_3 Forward -101 -82 -0.000545616 0.131
NP_441105.1_3 Reverse -70 -89 -6.1954 0.23
NP_441105.1_3 Reverse -332 -351 -8.16202 0.267
NP_442373.1_1 Forward -355 -336 -3.63879 0.244
NP_442373.1_2 Forward -334 -315 -11.2103 0.293
NP_440216.1_1 Reverse -87 -101 7.66941 0.00931
NP_440216.1_1 Forward -394 -380 -11.8001 0.219
NP_440216.1_9 Reverse -49 -58 14.2577 0.183
NP_440216.1_9 Reverse -83 -92 7.76787 0.286
NP_440216.1_9 Forward -89 -80 6.78456 0.289
NP_440216.1_9 Forward -88 -79 6.78456 0.289
NP_440172.1_1 Reverse -87 -97 13.0581 0.0224
NP_440172.1_1 Forward -96 -86 11.9764 0.0334
NP_442015.1_10 Reverse -83 -96 9.16406 0.053
NP_442015.1_10 Forward -356 -343 3.36254 0.183
NP_441226.1_7 Reverse -88 -95 5.64364 0.286
NP_441111.1_7 Reverse -88 -96 8.96754 0.0463
NP_441111.1_7 Forward -95 -87 8.86921 0.0589
NP_441766.1_2 Reverse -87 -96 7.76787 0.0714
NP_441766.1_2 Forward -96 -87 7.66954 0.0723
NP_441766.1_2 Forward -198 -189 3.34298 0.22
NP_440416.1_9 Reverse -278 -297 -1.57384 0.0652
NP_440416.1_9 Reverse -80 -99 -14.5535 0.178
NP_440416.1_9 Reverse -336 -355 -22.0267 0.3
NP_443052.1_9 Reverse -312 -331 -6.58872 0.285
NP_440261.1_5 Reverse -88 -101 -10.6005 0.201
NP_440261.1_5 Forward -95 -82 -12.3704 0.284
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AATTAGGGAAATTGACTGCCGCCCCAGTGATGCCATTTCCCTCGCGTTGCGGATGGACAGTCCCATTTGGGTGATGGAAGAAGTGTTGGCCGATGCTTCCATTCCCGTGGATCGAGATGCGGACGAAGAAGAAAGACAAGCTTTTCGGGATTTTCTCGACAATGTTAGCCCGGAAACCCTGATCAAACAGGCTCGCCTAAGTTCCGATAGCTTTGAGGCGGAATCCGATAGTTAGCCCCCTCAAAATCATTAAGCAATATTTAGTTCAGGTTAATAAATGGTGGTTGTAGATCTCTCAACGAAGGGCGATTGCCATGGAAACGGAAAAGAGCGAAAAAATAATTTCCCTTGGTTGATTGCTAAACTTAATTGTTGATTGAACCTTAAGCCTACTGTTACT

CDS

GTGCCCATGACTGTTGTCCCCGACTACCTTGCCCACCTCAATCCTTCCCAACGGCGGGCGGTGGAGCATTTTTGTGGCCCTCTTTTGGTGGTGGCCGGGGCCGGCTCAGGGAAAACTAGGGCACTAACCTACCGCATTGCCCATCTAATTCGTCAGCATCGCATCAATCCGGAAAATATCCTGGCGGTAACCTTTACCAATAAAGCCGCCAAGGAAATGAAGGAACGTTTGGAAAAGATTTTTGCCCAAGCCTGGGCCCAACAGGAATTTAGCCAACGGTGGGAATTGTTGGGGAAATATGAACAAAAACAGTTGCTTTCCAGGGTGTACAAAACAGTTACGAAACCCCTCTGGATTGGCACTTTCCACAGTCTATGTTCTCGTATTCTCCGCTACGACATTGATAAATATCAGGACAGCAGTGGCCGCCGTTGGACAAAACAGTTTTCCATTTTTGATGAAAGTGACGTGCAAAGTTTGTTTAAGACCATTGTCACTAAGGATATGGATTTGGACGAAAAACAGTTCAATCCTAAGAGTATTCGCTACCAGGTCAGTAATGCCAAAAACCTCGGGCAATCACCGGAGACCTATCTAAGGGAAAATCCCAGTTATAAAGGTAGGGTCATTGCGGAAGTTTACCAAGCTTACCAAAATCAATTGGCCGCTAATAACGCTCTAGATTTTGATGATTTAATTCTCATCCCTACCCGTTTATTTCAACAAAATGAATCAGTTTTAGGCTACTGGCACCGAAAATTTAACCATATTTTGGTGGATGAATACCAAGACACTAATCGCATCCAATATGATTTAATTCGTCTGCTGAGCACCAATGGGGAAGAACGGCAGTCGGAGTGGGATTGGCGGGGGCGTTCCACTTTTGTGGTGGGGGATGCAGACCAATCTATTTACAGTTTCCGCATGGCAGACTTTACCATCCTGCTCAATTTCCAAGAGGATTTTGGCGATCGCCTGTTGGATGGGGAAACGACCACCATGGTCAAACTAGAGGAAAATTACCGTTCTCGGGAAAATATCCTCCAAGCGGCTAACCATTTAATTGAACATAATAGCCAACGGATTGACAAGATCCTCAAGGCTACCCGGAGTGGCGGAGATGATATTATCCTTTACCAGGCGGATGATGAAAGGGATGAGTCCCGTTTTGTGATTAATAAAATTCTGAGCTTAAGGAAAAATAACCCAGAATTAAATTTTGGTGATTTTGCTATTTTATATCGCACCAATGCCCAATCCCGGGCCTTTGAAGAACAGCTATTAAATAATAATATTCGCTACAATATTGTCGGTGGTTTTCGCTTCTACGATCGCCAGGAAATTAAAGATGCCATTGCCTATCTCCGGGTGTTAGTTAATCCGGCGGATACGGTCAGCTTGTTGCGTATCATCAATACTCCCCGGCGGGGCATCGGTAAATCCACCATTGAAGGTTTTGTTAATGCCTCTAAGGAATTGGACATTCCCCTGTGGGAAATTATTACCGACGAAACTTCGGTGAATACTCTGGCCGGGCGATCAGGTAAAAAAACCCTGCAATTTGCCCGCATGCTCCAGGAAATCCAAAGCCAAATTGGTGAGCTTTCTGCGTCGGAAGCCCTCAGCTTAGTGTTGGAAAAATCCAATTATGTGGACGACTTAAAGCAAAAAGGCACCGAAGAAGCGGATAATCGCCTGGCCAACCTGGGGGAATTGGACAATGCAGTGCGACAGTTTGAAGCAGAAAGTGAAGACCCTAGCCTAGTGGATTTTTTGGCTTCAGCATCCCTCACTTCCGACCTTGATGACCTGGAGGAATCCGGAGACGAAGTGTCCCTCATGACTCTCCACTCTGCTAAGGGCCTGGAATTTCCAGTGGTCTTCTTAGTGGGGTTGGAGCAGGGCACTTGCCCCCACGCCCGCAGTTTAAATGATCCTTTGGATCTAGAAGAGGAACGCCGTTTATGTTACGTGGGCATTACCAGAGCCCAGGAAAATCTCTTTTTGACCCATGCTCGCATGCGTTACATCTGGGGTTCTTTAGAAACCAAAATACCGTCCCAATTTCTCCAGGAATTACCACCGGATTTATTGGCCGATGGCTCAACTGGTCGTAGAACTGGTCGCAATGCTCCTGCCGCCGATCCCAAGGGACCTTCCATTGCCCAAAAACAAGCCCGAAAAAAAACTGGTTCCCAGTCCACTCAACCGGCTAAAGACCTAATCTGGAATGTTGGCGATCGGGTAATGCACAACAATTTTGGAGAAGGCACTGTGACCCACATTTTAGGCAAAGGCCATAAAGCTAATTTGGCCATCAAATTTCCCGGCATTGGTGTGAAAATTATTGACCCCAGTTTCGCCCCTCTACGCCGCCTTTGA

Protein

MPMTVVPDYLAHLNPSQRRAVEHFCGPLLVVAGAGSGKTRALTYRIAHLIRQHRINPENILAVTFTNKAAKEMKERLEKIFAQAWAQQEFSQRWELLGKYEQKQLLSRVYKTVTKPLWIGTFHSLCSRILRYDIDKYQDSSGRRWTKQFSIFDESDVQSLFKTIVTKDMDLDEKQFNPKSIRYQVSNAKNLGQSPETYLRENPSYKGRVIAEVYQAYQNQLAANNALDFDDLILIPTRLFQQNESVLGYWHRKFNHILVDEYQDTNRIQYDLIRLLSTNGEERQSEWDWRGRSTFVVGDADQSIYSFRMADFTILLNFQEDFGDRLLDGETTTMVKLEENYRSRENILQAANHLIEHNSQRIDKILKATRSGGDDIILYQADDERDESRFVINKILSLRKNNPELNFGDFAILYRTNAQSRAFEEQLLNNNIRYNIVGGFRFYDRQEIKDAIAYLRVLVNPADTVSLLRIINTPRRGIGKSTIEGFVNASKELDIPLWEIITDETSVNTLAGRSGKKTLQFARMLQEIQSQIGELSASEALSLVLEKSNYVDDLKQKGTEEADNRLANLGELDNAVRQFEAESEDPSLVDFLASASLTSDLDDLEESGDEVSLMTLHSAKGLEFPVVFLVGLEQGTCPHARSLNDPLDLEEERRLCYVGITRAQENLFLTHARMRYIWGSLETKIPSQFLQELPPDLLADGSTGRRTGRNAPAADPKGPSIAQKQARKKTGSQSTQPAKDLIWNVGDRVMHNNFGEGTVTHILGKGHKANLAIKFPGIGVKIIDPSFAPLRRL