Your browser is old and dusty. Try Google Chrome!

Details for sll0865

ORF sll0865
Accession NP_440940.1
Symbol uvrC
Category excinuclease ABC subunit C
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -335 -321 1.67122 0.183
NP_440557.1_1 Reverse -206 -225 8.84924 0.125
NP_441418.1_6 Reverse -161 -180 -29.4015 0.224
NP_441418.1_6 Reverse -158 -177 -30.7781 0.296
NP_441343.1_7 Forward -33 -14 4.12936 0.264
NP_441623.1_1 Forward -57 -39 -3.81576 0.269
NP_440561.1_1 Reverse -232 -251 9.24175 0.284
NP_441818.1_9 Forward -243 -224 -5.60541 0.254
NP_441818.1_9 Reverse -156 -175 -8.85033 0.283
NP_441098.1_3 Reverse -72 -91 -6.02333 0.28
NP_440996.1_3 Forward -253 -235 15.0638 0.166
NP_442287.1_1 Forward -59 -49 13.0576 0.288
NP_442655.1_2 Forward -214 -195 0.392778 0.293
NP_443027.1_4 Forward -130 -120 6.46988 0.275
NP_440061.1_9 Forward -174 -160 8.75042 0.164
NP_440061.1_9 Reverse -298 -312 6.29216 0.251
NP_440878.1_9 Forward -207 -188 5.01433 0.174
NP_442062.1_8 Forward -309 -299 3.71661 0.256
NP_440304.1_4 Reverse -331 -341 3.71661 0.293
NP_442981.1_7 Reverse -156 -175 3.34271 0.263
NP_442742.1_9 Reverse -336 -355 -12.4886 0.269
NP_442110.1_2 Reverse -152 -165 19.8461 0.0972
NP_441925.1_4 Forward -172 -153 -15.0459 0.263
NP_441149.1_9 Forward -45 -26 1.17865 0.221
NP_441434.1_6 Reverse -331 -341 16.303 0.243
NP_441738.1_2 Forward -22 -15 6.52862 0.261
NP_442889.1_8 Forward -38 -24 6.19383 0.199
NP_442570.1_3 Forward -317 -298 -8.752 0.292
NP_441716.1_1 Reverse -270 -284 5.01447 0.243
NP_441624.1_7 Reverse -237 -251 7.37441 0.257
NP_440012.1_6 Reverse -162 -181 8.65258 0.247
NP_440012.1_6 Forward -251 -232 7.7676 0.247
NP_441014.1_8 Forward -172 -153 -1.57384 0.224
NP_441014.1_10 Forward -135 -116 1.96529 0.221
NP_442848.1_4 Reverse -154 -168 7.86607 0.282
NP_442848.1_9 Forward -203 -184 -1.08219 0.284
NP_441012.1_4 Reverse -197 -210 11.3273 0.252
NP_441012.1_4 Reverse -302 -315 10.4424 0.262
NP_441012.1_4 Forward -174 -161 6.90245 0.276
NP_441012.1_4 Forward -132 -119 6.90245 0.276
NP_439978.1_2 Reverse -195 -214 19.2715 0.0892
NP_443018.1_3 Forward -308 -301 8.49558 0.141
NP_443018.1_3 Reverse -312 -319 5.34899 0.212
NP_441634.1_8 Forward -311 -297 2.06454 0.173
NP_441634.1_8 Reverse -123 -137 0.491246 0.228
NP_440376.1_1 Forward -197 -188 5.50626 0.131
NP_440376.1_1 Forward -228 -219 1.47469 0.251
NP_443065.1_6 Reverse -311 -330 3.34271 0.221
NP_442687.1_7 Forward -198 -188 4.79825 0.234
NP_442687.1_7 Forward -300 -290 4.3066 0.255
NP_442485.1_3 Forward -199 -180 -5.70374 0.295
NP_441846.1_10 Reverse -155 -174 -21.4367 0.256
NP_442530.1_2 Forward -119 -109 14.4347 0.204
NP_440642.1_10 Forward -44 -30 1.96562 0.284
NP_441013.1_3 Reverse -161 -180 12.6841 0.201
NP_440360.1_10 Forward -174 -160 2.75286 0.261
NP_440141.1_8 Forward -308 -289 5.89931 0.271
NP_441478.1_7 Reverse -161 -175 16.1259 0.272
NP_442937.1_5 Reverse -165 -184 7.86593 0.241
NP_440318.1_1 Reverse -257 -276 4.12936 0.242
NP_440203.1_5 Forward -131 -121 12.4676 0.147
NP_440203.1_5 Forward -339 -329 12.0743 0.166
NP_440984.1_7 Forward -202 -188 5.70279 0.245
NP_441580.1_6 Reverse -276 -295 -6.58872 0.235
NP_440153.1_8 Forward -176 -163 -2.24233 0.235
NP_440858.1_1 Forward -128 -109 -5.31042 0.281
NP_442536.1_8 Reverse -158 -177 13.8641 0.216
NP_443055.1_3 Reverse -7 -26 11.0271 0.27
NP_443055.1_6 Reverse -319 -337 -2.73484 0.299
NP_442002.1_9 Reverse -14 -21 10.3639 0.231
NP_442438.1_10 Reverse -162 -176 7.37441 0.0955
NP_441398.1_5 Forward -331 -312 8.16093 0.258
NP_441000.1_5 Reverse -190 -209 4.03023 0.286
NP_441916.1_7 Forward -197 -187 4.10993 0.19
NP_440206.1_10 Forward -324 -305 13.6675 0.288
NP_441041.1_4 Reverse -161 -180 -5.31042 0.151
NP_442004.1_6 Reverse -167 -181 3.53951 0.238
NP_439966.1_7 Reverse -304 -314 6.17443 0.191
NP_440260.1_8 Reverse -54 -72 -7.749 0.3
NP_442281.1_1 Forward -177 -163 3.44058 0.231
NP_001035871.2_7 Reverse -46 -56 17.9746 0.105
NP_439983.1_7 Forward -241 -223 9.65558 0.287
NP_440723.1_8 Reverse -157 -171 11.3077 0.243
NP_441860.1_1 Reverse -231 -245 14.7737 0.277
NP_440375.1_8 Reverse -301 -320 6.19431 0.168
NP_442029.1_1 Forward -311 -292 -3.14714 0.188
NP_442029.1_6 Forward -237 -218 5.60432 0.25
NP_442554.1_8 Forward -335 -325 4.0116 0.2
NP_442167.1_6 Forward -149 -133 11.7592 0.237
NP_441711.1_4 Forward -143 -124 3.73603 0.235
NP_441711.1_4 Forward -74 -55 3.04771 0.255
NP_442301.1_2 Forward -174 -155 20.4514 0.0575
NP_442301.1_2 Forward -177 -158 19.0748 0.0769
NP_441448.1_7 Reverse -239 -258 6.09597 0.273
NP_440158.1_8 Forward -254 -235 9.93088 0.263
NP_440379.1_5 Forward -324 -305 6.4893 0.133
NP_441468.1_1 Forward -314 -307 6.72562 0.126
NP_441339.1_4 Forward -211 -192 -4.81876 0.259
NP_442719.1_2 Forward -124 -106 -2.53818 0.19
NP_441612.1_2 Forward -221 -211 9.71104 0.21
NP_441612.1_2 Reverse -366 -376 9.22698 0.21
NP_442227.1_2 Forward -174 -155 -0.885524 0.26
NP_440145.1_3 Reverse -38 -57 -5.50708 0.269
NP_441906.1_2 Forward -60 -41 5.11187 0.286
NP_442542.1_2 Reverse -186 -199 5.32916 0.272
NP_441114.1_3 Reverse -322 -331 8.65285 0.231
NP_440558.1_2 Reverse -317 -336 -7.37537 0.293
NP_441048.1_6 Forward -116 -102 15.2903 0.296
NP_442789.1_4 Reverse -171 -190 0.982764 0.185
NP_441878.1_6 Forward -198 -188 -6.70647 0.194
NP_441445.1_1 Forward -308 -289 2.0644 0.243
NP_441590.1_4 Forward -180 -161 9.14342 0.249
NP_440738.1_5 Forward -60 -41 3.6377 0.26
NP_442397.1_6 Forward -252 -238 17.1092 0.178
NP_442397.1_9 Reverse -188 -207 4.03102 0.26
NP_441116.1_5 Forward -178 -159 13.5683 0.27
NP_441574.1_1 Reverse -167 -186 -4.52377 0.252
NP_440540.1_2 Reverse -155 -174 7.47261 0.271
NP_442347.1_2 Reverse -316 -325 6.5879 0.163
NP_442347.1_2 Forward -150 -141 5.89959 0.21
NP_442645.1_2 Forward -317 -298 -15.3402 0.197
NP_442645.1_2 Reverse -47 -66 -18.2901 0.27
NP_442594.1_8 Forward -240 -221 5.11266 0.254
NP_441633.1_3 Reverse -345 -358 -5.68391 0.236
NP_442590.1_9 Forward -247 -228 6.29264 0.261
NP_442998.1_5 Forward -346 -336 14.3364 0.149
NP_442998.1_5 Forward -345 -335 11.3864 0.187
NP_442998.1_5 Reverse -366 -376 7.74818 0.284
NP_440899.1_1 Forward -347 -328 10.3593 0.183
NP_440899.1_2 Forward -326 -307 9.53674 0.176
NP_440899.1_8 Reverse -259 -278 -9.44032 0.262
NP_440299.1_1 Forward -132 -119 6.31189 0.146
NP_440256.1_1 Reverse -52 -71 1.37609 0.0761
NP_441512.1_6 Forward -141 -122 14.8466 0.166
NP_441559.1_8 Reverse -342 -356 -6.29359 0.276
NP_442158.1_4 Reverse -261 -271 15.0247 0.176
NP_442054.1_4 Reverse -288 -307 8.55425 0.299
NP_441340.1_9 Forward -30 -20 7.38756 0.27
NP_440161.1_3 Reverse -83 -102 8.06259 0.278
NP_441027.1_1 Forward -87 -73 17.5018 0.185
NP_441027.1_1 Reverse -74 -88 10.0287 0.299
NP_440586.1_8 Forward -127 -120 7.51192 0.239
NP_440192.1_5 Forward -258 -239 10.4225 0.172
NP_443051.1_5 Reverse -98 -117 4.62101 0.277
NP_439937.1_9 Reverse -218 -235 -5.96001 0.157
NP_441181.1_6 Reverse -150 -168 3.06741 0.283
NP_442488.1_7 Reverse -117 -136 10.9142 0.239
NP_440139.1_1 Reverse -143 -162 7.57013 0.129
NP_442384.1_10 Reverse -119 -132 1.88757 0.243
NP_442262.1_10 Forward -308 -301 8.59391 0.22
NP_442262.1_10 Reverse -312 -319 7.6106 0.274
NP_440344.1_10 Forward -195 -178 -13.5308 0.287
NP_440282.1_10 Forward -186 -167 -9.34199 0.277
NP_440531.1_6 Reverse -343 -362 -4.03212 0.273
NP_441896.1_5 Forward -246 -239 15.3787 0.268
NP_441103.1_9 Reverse -339 -349 12.7825 0.284
NP_443036.1_1 Reverse -159 -178 12.3883 0.224
NP_442078.1_3 Reverse -357 -376 3.73524 0.189
NP_440999.1_9 Reverse -296 -310 -3.24533 0.289
NP_440999.1_9 Reverse -343 -357 -3.34366 0.291
NP_441543.1_2 Forward -196 -187 4.32629 0.26
NP_440071.1_6 Reverse -158 -172 15.1623 0.241
NP_442204.1_5 Forward -207 -188 4.42435 0.167
NP_440516.1_2 Reverse -294 -312 4.54237 0.138
NP_442120.1_10 Reverse -125 -144 1.57275 0.156
NP_440673.1_3 Forward -132 -125 8.98723 0.203
NP_442219.1_8 Forward -331 -312 9.32671 0.233
NP_441884.1_9 Reverse -167 -186 -23.6983 0.284
NP_441004.1_1 Reverse -155 -174 -12.8819 0.251
NP_441004.1_1 Reverse -152 -171 -15.6352 0.276
NP_441004.1_1 Reverse -173 -192 -16.6185 0.286
NP_441004.1_1 Reverse -158 -177 -17.0118 0.288
NP_442873.1_9 Forward -189 -170 7.86512 0.236
NP_442312.1_2 Reverse -211 -230 18.2882 0.118
NP_441542.1_4 Forward -348 -334 4.62115 0.264
NP_442515.1_1 Forward -198 -184 0.88457 0.178
NP_441396.1_5 Reverse -154 -163 8.25953 0.224
NP_441982.1_6 Reverse -364 -373 11.3395 0.288
NP_441982.1_6 Forward -392 -383 10.7665 0.292
NP_442709.1_3 Forward -215 -196 3.34271 0.288
NP_441046.1_2 Reverse -105 -124 -1.37718 0.288
NP_442689.1_8 Forward -124 -107 -4.77938 0.267
NP_440474.1_8 Reverse -126 -140 5.60385 0.246
NP_442006.1_2 Reverse -116 -133 -17.1691 0.27
NP_442006.1_2 Forward -73 -56 -17.7591 0.282
NP_441078.1_4 Reverse -188 -197 6.09625 0.0863
NP_441078.1_4 Forward -197 -188 5.99792 0.0932
NP_442348.1_2 Reverse -106 -115 14.7494 0.146
NP_441094.1_1 Forward -175 -161 20.7467 0.247
NP_441432.1_8 Reverse -124 -133 5.50626 0.151
NP_441432.1_9 Reverse -373 -386 11.2162 0.235
NP_440760.1_1 Reverse -188 -207 -23.1083 0.283
NP_440578.1_8 Reverse -149 -168 11.7992 0.25
NP_442353.1_4 Reverse -294 -313 7.57013 0.165
NP_443011.1_4 Forward -247 -228 6.39097 0.283
NP_442079.1_7 Reverse -273 -292 -0.197208 0.29
NP_442913.1_10 Forward -143 -124 -1.96717 0.18
NP_439956.1_7 Forward -347 -328 0.982764 0.292
NP_442346.1_5 Forward -300 -290 4.79825 0.272
NP_442346.1_10 Forward -326 -307 -3.73712 0.296
NP_441786.1_10 Forward -206 -187 5.70265 0.291
NP_440555.1_4 Reverse -38 -57 14.1591 0.172
NP_440010.1_10 Reverse -51 -70 2.16274 0.287
NP_441943.1_8 Forward -339 -320 -12.7836 0.261
NP_442551.1_4 Reverse -288 -303 13.3529 0.0946
NP_442311.1_5 Reverse -315 -334 1.37609 0.27
NP_441233.1_2 Reverse -153 -172 12.4875 0.262
NP_440751.1_9 Forward -136 -117 -2.65548 0.26
NP_442799.1_2 Reverse -177 -196 -1.18052 0.294
NP_440912.1_3 Reverse -210 -229 10.6184 0.254
NP_442699.1_8 Forward -352 -333 -12.0953 0.238
NP_441044.1_4 Forward -175 -157 4.9357 0.227
NP_442045.1_5 Reverse -338 -357 -3.04881 0.296
NP_440204.1_4 Forward -243 -224 8.25926 0.156
NP_440875.1_9 Reverse -127 -137 7.00932 0.287
NP_441813.1_7 Reverse -228 -242 17.5018 0.144
NP_440227.1_2 Reverse -108 -124 7.72835 0.29
NP_441239.1_9 Forward -317 -305 6.82381 0.175
NP_441239.1_9 Forward -174 -162 3.57889 0.283
NP_440833.1_6 Forward -344 -330 9.73373 0.261
NP_440212.1_9 Forward -29 -10 2.09897 0.252
NP_440212.1_9 Reverse -10 -29 0.657334 0.29
NP_440546.1_6 Reverse -157 -176 14.7491 0.149
NP_440546.1_6 Reverse -34 -53 11.5042 0.245
NP_440546.1_6 Forward -351 -332 9.0459 0.253
NP_442041.1_5 Reverse -38 -57 0.196116 0.257
NP_441230.1_5 Forward -139 -120 -0.39387 0.285
NP_440462.1_4 Forward -322 -308 15.0442 0.151
NP_442465.1_9 Forward -226 -212 8.84938 0.298
NP_441497.1_3 Forward -126 -107 -9.63698 0.294
NP_442479.1_9 Reverse -108 -127 -11.8003 0.275
NP_442402.1_10 Forward -374 -364 15.3192 0.18
NP_441848.1_4 Forward -123 -107 7.83714 0.288
NP_442023.1_2 Forward -72 -53 9.24257 0.255
NP_442679.1_1 Forward -279 -260 5.01433 0.147
NP_442380.1_5 Reverse -102 -121 18.6298 0.142
NP_440160.1_10 Forward -201 -182 16.1257 0.252
NP_442360.1_5 Forward -203 -193 13.2547 0.28
NP_441102.1_1 Forward -251 -232 5.01433 0.256
NP_441102.1_10 Reverse -155 -174 7.57094 0.229
NP_440520.1_1 Forward -331 -312 -4.81876 0.289
NP_442533.1_1 Reverse -152 -171 -8.26035 0.202
NP_442533.1_6 Reverse -306 -315 4.81794 0.172
NP_442541.1_10 Reverse -195 -209 2.65393 0.254
NP_442541.1_10 Reverse -217 -231 2.5556 0.255
NP_440263.1_3 Forward -258 -239 1.27776 0.295
NP_442322.1_4 Reverse -193 -210 -6.74666 0.277
NP_441697.1_5 Reverse -10 -29 -10.4568 0.279
NP_441028.1_6 Forward -373 -363 19.1541 0.132
NP_441028.1_6 Reverse -339 -349 5.78111 0.243
NP_440007.1_9 Reverse -302 -316 1.47456 0.285
NP_441930.1_1 Forward -201 -182 13.7658 0.179
NP_440886.1_7 Forward -369 -359 9.12434 0.0805
NP_440886.1_7 Forward -171 -161 4.10949 0.253
NP_440205.1_4 Forward -274 -255 13.3725 0.26
NP_442213.1_5 Reverse -151 -170 3.04771 0.231
NP_440907.2_8 Reverse -220 -230 10.206 0.103
NP_442264.1_2 Reverse -115 -132 11.9369 0.176
NP_440326.1_6 Forward -241 -227 19.0257 0.209
NP_441463.1_3 Forward -144 -125 -6.98204 0.253
NP_442794.1_1 Reverse -355 -367 3.2839 0.286
NP_441962.1_4 Reverse -322 -341 -10.4236 0.228
NP_441796.1_8 Forward -315 -297 12.2122 0.199
NP_441796.1_8 Reverse -305 -323 8.37728 0.297
NP_442020.1_1 Forward -125 -106 1.17865 0.255
NP_441836.1_2 Reverse -113 -132 1.47442 0.193
NP_440358.1_1 Forward -64 -50 16.8142 0.298
NP_442684.1_2 Forward -72 -53 14.8474 0.288
NP_441510.2_6 Reverse -38 -57 13.5683 0.244
NP_441720.1_2 Forward -138 -119 10.52 0.213
NP_440293.1_3 Reverse -171 -190 -0.590531 0.232
NP_440293.1_3 Reverse -56 -75 -5.11376 0.272
NP_442743.1_1 Forward -174 -155 10.52 0.241
NP_442930.1_1 Forward -116 -106 15.9091 0.19
NP_442680.1_5 Forward -357 -338 1.14682 0.251
NP_442936.1_10 Reverse -253 -267 9.26386 0.269
NP_442514.1_5 Forward -80 -61 -6.98278 0.275
NP_440478.1_10 Reverse -298 -312 6.29277 0.292
NP_442703.1_4 Reverse -315 -334 1.47364 0.284
NP_442341.1_7 Forward -229 -215 3.04785 0.237
NP_441173.1_9 Forward -372 -364 11.3271 0.226
NP_440076.1_5 Reverse -299 -318 12.29 0.274
NP_440091.1_1 Forward -300 -288 5.64384 0.111
NP_441397.1_8 Forward -348 -335 13.3352 0.245
NP_440258.1_8 Reverse -254 -273 13.0766 0.261
NP_440149.1_8 Reverse -55 -74 -4.6221 0.211
NP_441105.1_3 Forward -341 -322 1.0811 0.117
NP_441105.1_3 Reverse -57 -76 -7.86702 0.261
NP_442373.1_2 Reverse -155 -174 5.60432 0.148
NP_440216.1_9 Forward -271 -262 13.6677 0.189
NP_440216.1_9 Reverse -329 -338 7.37455 0.286
NP_440216.1_9 Forward -33 -24 6.78456 0.289
NP_440216.1_9 Forward -123 -114 5.40793 0.294
NP_441226.1_1 Reverse -318 -332 17.8952 0.211
NP_440416.1_9 Reverse -340 -359 -6.49039 0.0901
NP_440416.1_9 Forward -331 -312 -8.06369 0.109
NP_443052.1_9 Forward -174 -155 2.26107 0.174
NP_442116.1_2 Forward -126 -107 10.6184 0.289
NP_441135.1_3 Forward -344 -325 8.16093 0.276
NP_442154.1_1 Reverse -156 -174 -5.48739 0.127
NP_442154.1_1 Reverse -147 -165 -9.22396 0.177
NP_442154.1_3 Forward -388 -369 16.4719 0.241
NP_440988.1_10 Reverse -319 -333 4.41476 0.261
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGGGACTCTGCTTGAAAAACAAACTGATTTTCCCCCATCTTGAGAGGGATTACAGGGGCAAAATTGCCTTGGGCACTGCGTTCAATGGGCTGGCCATTGAGGGTAACGGTCACATTTGGAGCGGCAGAACCAATGAAAAAAATCGTCGGGCTACTGGTTTGGTGATTTTGGGGTGGATAGGCCAAAAATAAGGGCTGACTTTGGGCTACAGCCGGCATAGTGAAAACCACCGCTGCCCCCACACCAATCATTGTTCCCAACCAAGATTCCATTGCCATCATTGCAAAAAATTCCCGTTTTAAATCAGCCAATTGTATTAATTAACCCAGCCCAGACGCAAATTGCCAAGCCCTAGTTTTCCCTTCTACCATAGAAAAACATTCGCTCTTTTGCTTAATCA

CDS

ATGGTTGCTACTGTTTCCTCTACGTCTCTTCTTGAACAACCAGAATTATTAGAACGGCGTCTCCAGGAAATTCCCCAAGAGCCGGGGGTTTACTTCATGGGCGATCGCCAAGGAGAAATTCTCTACATCGGCAAGGCAAAAAAATTGAGAACTAGGGTTAGATCCTATTTTCGGGATTCCCAACCCCACACTGCCCGCATTGCTTTGATGGTGCAACAGGTAGCGGAAATTGAGTTTATTGTCACCGATACGGAAGCGGAAGCTTTAGCCTTAGAAGCTAATTTAATCAAACAACACCAACCCCATTTTAATGTTCTGCTTAAAGATGATAAAAAATATCCTTATGTGTGTATCACCTGGTCAGAAACCTATCCCCGTATTTTTATTACCAGAAAACGCCGTTTAAACCAGGCTAAGGATCGTTACTACGGGCCCTATGTGGATAGTTTTAGTTTACGGCAAACATTGCGATTAATACAACGTATTTTTCCTCTGCGGCAACGTCGTCAGCCCCTATTCAAACATCGTCCTTGCTTAAATTATGACATTGGCCGTTGTCCTGGAGTTTGCCAAGAATTAATTACCCCAGAAGACTACCGCCAAACCTTACAAAAAGTCGCTATGGTTTTCCAGGGACGTACCCAGGAACTACATCAATTGTTAACGCAACAAATGGAAAAGGCGGCGGCAGATTTAAAGTTTGAACAGGCGGCTCTAATTCGGGACCAAATTAATTCCCTCGGTAAACTCAACGCTGATCAAAAAGTTTCCTTACCCCAGGACACCATTTCCAGAGATGCGATCGCCGTGGCCAGCGATGGACAAATTAGTGCCATTCAACTTTTCCAAATTAGGGCGGGAAGATTGGTAGGAAGGCTGGGATTTTTCGCCGATGGAGTGGAGTCGGAGTTGGAAAAAGGGGAAGTATTACAGCGGGTTTTGGAACAGCATTATCAACAGGTCGAAGCGGTGGAAATTCCCAGCGAAGTCATTCTGCCCTGTGCTTTACCTGATGGAGAATTGCTCAATGATTGGTTAACTAGCCAACGGGGAAGAAAAGTAACTTTTAACCTCCCCCAAAGACAAACCAAAGCTGAGCTATTGGAAATGGTGGAACGTAACGCCCAGTACGAGTTAGAGAGGTTACAAAAACAGACTGCTAAAAACGTTACAGCGCTAGAAGATTTAGCGGAAATTTTAAATTTAGAAACTTTGCCAAAACGCATTGAAGGTTATGATATTTCCCACATTCAGGGTTCTAATGCTGTAGCTTCCCAAGTTGTATTTATTGATGGAGTGCCAGCCCAACAGTATTATCGCCATTATAAAATTAAAAACCCGTCCATTAAAGTCGGTCACTCTGACGATTTCGCCAGTTTGGCAGAAGTTATTATCCGCCGTTTTCAATCCTCTGTAAAAGGCAAAAAAAATCAACAGGATTGGCCAGATTTAATTATGATTGATGGCGGTAAAGGTCAACTATCAGCGGTGGTTAAGGTGCTGAAGAAAATGGATTTGCTGGATAAATTTACGGTGGTCAGTTTAGCGAAACAAAGGGAAGAAATTTTTCTACCGGGAGAATCCCAACCCTTGCCCACCCACGCGGAACAACCTGGAGTGCAATTATTACGCCGTTTGCGGGATGAAGCCCATCGCTTTGCGGTCAGTTTCCACCGTCAACAACGGCTTAGTAAAAGTCGGCGATCGCGCTTGGATGAAATTCCTGGTTTAGGTTTTAGTCGCCAAAAACAATTGTTAGCCCATTTCCGTTCTTTGGATTATATTCGGGAGGCCAGTGTCAAACAATTACAGGAAGTACCAGGTATTGGTCCCCAGTTAGCCCAGACAATTTATGATTACTTTCATCCGGTTAATTCATAA

Protein

MVATVSSTSLLEQPELLERRLQEIPQEPGVYFMGDRQGEILYIGKAKKLRTRVRSYFRDSQPHTARIALMVQQVAEIEFIVTDTEAEALALEANLIKQHQPHFNVLLKDDKKYPYVCITWSETYPRIFITRKRRLNQAKDRYYGPYVDSFSLRQTLRLIQRIFPLRQRRQPLFKHRPCLNYDIGRCPGVCQELITPEDYRQTLQKVAMVFQGRTQELHQLLTQQMEKAAADLKFEQAALIRDQINSLGKLNADQKVSLPQDTISRDAIAVASDGQISAIQLFQIRAGRLVGRLGFFADGVESELEKGEVLQRVLEQHYQQVEAVEIPSEVILPCALPDGELLNDWLTSQRGRKVTFNLPQRQTKAELLEMVERNAQYELERLQKQTAKNVTALEDLAEILNLETLPKRIEGYDISHIQGSNAVASQVVFIDGVPAQQYYRHYKIKNPSIKVGHSDDFASLAEVIIRRFQSSVKGKKNQQDWPDLIMIDGGKGQLSAVVKVLKKMDLLDKFTVVSLAKQREEIFLPGESQPLPTHAEQPGVQLLRRLRDEAHRFAVSFHRQQRLSKSRRSRLDEIPGLGFSRQKQLLAHFRSLDYIREASVKQLQEVPGIGPQLAQTIYDYFHPVNS