Your browser is old and dusty. Try Google Chrome!

Details for sll0848

ORF sll0848
Accession NP_441121.1
Symbol dnaA
Category chromosomal replication initiator protein DnaA
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -110 -124 10.7177 0.0582
NP_441061.1_2 Forward -117 -103 10.0294 0.0651
NP_441061.1_2 Reverse -322 -336 -2.36035 0.29
NP_440557.1_1 Forward -117 -98 9.0459 0.125
NP_440795.1_7 Forward -117 -110 14.6904 0.0123
NP_440795.1_7 Reverse -110 -117 14.6904 0.0123
NP_441418.1_6 Forward -118 -99 19.0757 0.000808
NP_441453.1_1 Reverse -102 -120 12.2114 0.0985
NP_441453.1_4 Reverse -109 -117 16.539 0.00633
NP_441453.1_4 Forward -118 -110 16.539 0.00633
NP_442151.1_6 Reverse -109 -123 14.3559 0.0362
NP_442151.1_6 Forward -124 -110 10.1277 0.13
NP_442151.1_6 Forward -118 -104 8.35772 0.175
NP_440561.1_5 Forward -339 -320 10.4225 0.278
NP_441818.1_1 Reverse -110 -121 15.6928 0.0257
NP_441818.1_9 Forward -118 -99 -7.37537 0.272
NP_441642.1_1 Reverse -197 -216 2.16274 0.289
NP_440226.1_1 Forward -118 -99 6.58763 0.125
NP_441630.1_3 Forward -126 -107 0.58944 0.272
NP_440259.1_4 Forward -91 -77 11.4317 0.255
NP_440150.1_6 Forward -121 -102 0.491109 0.3
NP_442173.1_1 Forward -117 -109 15.4574 0.00633
NP_442173.1_1 Reverse -110 -118 15.4574 0.00633
NP_442752.1_4 Forward -118 -111 13.8055 0.0199
NP_442752.1_4 Reverse -109 -116 13.8055 0.0199
NP_442752.1_4 Reverse -39 -46 10.8555 0.0846
NP_443027.1_4 Reverse -107 -117 16.2046 0.0437
NP_443027.1_4 Forward -120 -110 13.1564 0.0521
NP_441812.1_3 Forward -119 -105 11.0127 0.215
NP_442975.1_10 Reverse -105 -119 13.077 0.0459
NP_442975.1_10 Forward -122 -108 2.94893 0.266
NP_440784.1_7 Forward -117 -110 15.9687 0.0123
NP_440784.1_7 Reverse -110 -117 15.9687 0.0123
NP_442909.1_7 Reverse -110 -124 13.5686 0.12
NP_442909.1_7 Forward -123 -109 7.27547 0.221
NP_440061.1_9 Reverse -107 -121 20.1568 0.00431
NP_440110.1_8 Forward -120 -101 8.65258 0.0906
NP_441476.1_5 Reverse -290 -309 -3.63879 0.239
NP_439979.1_2 Forward -118 -99 5.99764 0.292
NP_442062.1_8 Reverse -109 -119 17.3846 0.00193
NP_442062.1_8 Forward -118 -108 10.3048 0.0493
NP_442062.1_8 Forward -325 -315 6.8632 0.116
NP_440761.1_4 Forward -123 -104 -4.13045 0.132
NP_441859.1_3 Reverse -108 -127 4.91521 0.211
NP_440304.1_4 Reverse -107 -117 19.9412 0.00364
NP_440304.1_4 Forward -120 -110 9.91146 0.051
NP_442242.1_4 Forward -117 -110 14.3954 0.0124
NP_442242.1_4 Reverse -110 -117 14.3954 0.0124
NP_440044.1_8 Reverse -110 -129 7.57094 0.0817
NP_441781.1_7 Forward -118 -99 0.687771 0.242
NP_439918.1_2 Forward -342 -323 -2.75381 0.249
NP_439918.1_3 Forward -121 -102 16.3224 0.113
NP_441935.1_2 Forward -220 -201 -3.63879 0.253
NP_441208.1_9 Forward -121 -107 15.6342 0.0815
NP_441594.1_6 Forward -211 -192 2.45773 0.251
NP_441594.1_6 Reverse -298 -317 2.3594 0.252
NP_440132.1_1 Forward -120 -102 21.2586 0.0192
NP_442110.1_7 Forward -118 -104 12.4876 0.0586
NP_442110.1_7 Reverse -109 -123 7.17775 0.123
NP_442726.1_7 Forward -398 -380 0.0191479 0.258
NP_441925.1_4 Reverse -87 -106 -6.49113 0.185
NP_440856.1_7 Forward -121 -102 -2.55715 0.191
NP_441083.1_5 Reverse -109 -119 20.3345 0.00053
NP_441083.1_5 Forward -118 -108 11.2881 0.0159
NP_442827.1_8 Forward -126 -107 6.98015 0.0988
NP_441738.1_2 Forward -116 -109 15.28 0.0102
NP_441738.1_2 Reverse -111 -118 15.28 0.0102
NP_441558.1_5 Reverse -107 -126 4.32602 0.283
NP_441558.1_5 Forward -120 -101 4.32602 0.283
NP_441955.1_8 Reverse -285 -302 6.13536 0.281
NP_440209.1_1 Reverse -109 -117 18.1123 0.00295
NP_440209.1_1 Forward -118 -110 18.1123 0.00295
NP_440447.1_1 Reverse -104 -122 2.96908 0.271
NP_441713.1_1 Forward -124 -105 3.44104 0.0568
NP_440178.1_7 Reverse -108 -127 -21.3384 0.218
NP_442570.1_3 Forward -333 -314 -3.83545 0.225
NP_442570.1_3 Forward -256 -237 -6.49039 0.258
NP_441716.1_1 Forward -118 -104 10.1277 0.0971
NP_441716.1_1 Reverse -109 -123 5.01447 0.243
NP_442111.1_4 Forward -119 -105 20.3541 0.00311
NP_440906.1_5 Forward -117 -110 15.8704 0.0124
NP_440906.1_5 Reverse -110 -117 15.8704 0.0124
NP_440747.1_10 Reverse -106 -118 7.80712 0.00223
NP_440747.1_10 Forward -121 -109 7.51213 0.00286
NP_440747.1_10 Forward -211 -199 -11.8591 0.161
NP_441130.1_10 Reverse -107 -121 10.7177 0.112
NP_441486.1_1 Forward -121 -107 4.22782 0.0475
NP_441486.1_1 Reverse -106 -120 -3.54032 0.179
NP_442330.1_3 Reverse -180 -199 7.7676 0.294
NP_442634.1_4 Forward -120 -106 15.6342 0.0115
NP_442634.1_4 Reverse -107 -121 -3.54032 0.161
NP_441014.1_8 Reverse -278 -297 1.17943 0.214
NP_441014.1_9 Forward -226 -207 10.8159 0.174
NP_441014.1_10 Forward -119 -100 -0.492971 0.252
NP_442848.1_1 Forward -124 -110 6.3911 0.0791
NP_442848.1_1 Reverse -103 -117 -1.47537 0.263
NP_442848.1_9 Forward -397 -378 0.982764 0.265
NP_441012.1_4 Reverse -195 -208 6.21414 0.284
NP_441012.1_4 Reverse -105 -118 5.91914 0.286
NP_443018.1_3 Forward -117 -110 14.8871 0.0123
NP_443018.1_3 Reverse -110 -117 14.8871 0.0123
NP_443018.1_3 Reverse -292 -299 10.2655 0.107
NP_441316.1_7 Reverse -107 -122 4.89645 0.121
NP_441634.1_8 Reverse -107 -121 3.24451 0.154
NP_440376.1_1 Forward -118 -109 19.4693 0.000692
NP_440376.1_1 Reverse -109 -118 19.4693 0.000692
NP_440376.1_1 Forward -208 -199 4.81794 0.149
NP_441857.1_5 Forward -125 -107 4.05072 0.222
NP_441588.1_4 Forward -46 -36 6.07655 0.214
NP_442687.1_7 Reverse -44 -54 10.0098 0.0994
NP_442687.1_7 Reverse -108 -118 9.02648 0.0994
NP_442687.1_7 Forward -119 -109 8.92815 0.0994
NP_442485.1_3 Reverse -92 -111 0.491109 0.24
NP_442958.1_3 Forward -129 -110 1.17943 0.267
NP_441013.1_3 Forward -118 -99 5.80098 0.281
NP_441422.1_7 Reverse -107 -124 -3.50107 0.235
NP_441422.1_7 Reverse -293 -310 -9.10594 0.293
NP_441029.1_4 Reverse -287 -306 -3.54046 0.283
NP_440691.1_8 Reverse -269 -286 15.3785 0.213
NP_440667.1_2 Forward -106 -87 -6.29373 0.273
NP_440667.1_10 Forward -105 -86 14.8474 0.233
NP_440887.1_8 Forward -112 -98 16.5192 0.263
NP_440360.1_10 Reverse -111 -125 8.06273 0.227
NP_440360.1_10 Reverse -87 -101 2.16287 0.27
NP_442658.1_1 Reverse -107 -117 13.0576 0.04
NP_442658.1_1 Forward -120 -110 9.616 0.147
NP_442658.1_10 Reverse -381 -400 12.7825 0.296
NP_442198.1_7 Forward -121 -102 11.2084 0.209
NP_440141.1_4 Forward -115 -96 -11.8986 0.298
NP_442782.1_2 Forward -118 -104 1.57289 0.281
NP_442205.1_9 Forward -124 -108 8.22001 0.103
NP_440656.1_8 Reverse -98 -117 -7.57203 0.261
NP_441414.1_9 Reverse -109 -128 -4.13045 0.148
NP_439968.1_8 Forward -116 -100 21.003 0.0485
NP_442937.1_5 Forward -111 -92 12.0942 0.119
NP_442937.1_5 Forward -123 -104 6.58763 0.275
NP_441958.1_5 Reverse -108 -118 21.2195 0.000805
NP_441958.1_5 Forward -119 -109 12.2714 0.00183
NP_441127.1_1 Forward -106 -92 7.76774 0.3
NP_442836.1_5 Reverse -193 -212 8.84924 0.14
NP_440203.1_5 Forward -115 -105 14.9258 0.0886
NP_440203.1_5 Reverse -318 -328 12.1726 0.164
NP_440203.1_5 Reverse -112 -122 10.3043 0.229
NP_439905.1_1 Reverse -110 -123 19.6855 0.0174
NP_440984.1_7 Forward -123 -109 12.586 0.122
NP_440984.1_7 Forward -213 -199 6.3911 0.217
NP_439990.1_5 Reverse -104 -117 8.18076 0.18
NP_442376.1_2 Forward -123 -104 -12.1936 0.286
NP_442690.1_1 Forward -37 -18 -12.8819 0.25
NP_442911.1_2 Forward -128 -109 12.5858 0.0124
NP_442911.1_2 Reverse -99 -118 -0.590531 0.0769
NP_441580.1_6 Reverse -98 -117 -6.68705 0.235
NP_442064.1_1 Forward -84 -65 -13.7669 0.298
NP_442064.1_4 Reverse -93 -112 6.68515 0.246
NP_440993.1_2 Reverse -104 -120 17.7581 0.0447
NP_442210.1_5 Forward -216 -197 15.6341 0.19
NP_442210.1_9 Forward -122 -104 12.8022 0.209
NP_440138.1_6 Reverse -110 -129 3.53858 0.242
NP_441099.1_5 Reverse -99 -118 6.98095 0.0429
NP_441654.1_7 Reverse -1 -20 11.5651 0.285
NP_440809.1_9 Reverse -100 -118 -7.65067 0.225
NP_441294.1_7 Reverse -257 -271 11.8423 0.124
NP_440411.1_10 Forward -120 -101 11.14 0.265
NP_441646.1_1 Forward -331 -312 3.83436 0.204
NP_442438.1_10 Forward -123 -109 11.8976 0.0426
NP_442438.1_10 Reverse -104 -118 1.57289 0.191
NP_442438.1_10 Forward -281 -267 -0.295402 0.256
NP_442771.1_1 Forward -120 -102 -5.48739 0.166
NP_440484.1_3 Forward -120 -106 8.35772 0.3
NP_440147.1_4 Reverse -107 -120 13.0973 0.0326
NP_440147.1_4 Forward -120 -107 1.49425 0.226
NP_441550.1_8 Forward -120 -110 16.7941 0.00906
NP_441550.1_8 Reverse -107 -117 13.0576 0.0273
NP_441550.1_8 Forward -56 -46 4.60114 0.299
NP_441916.1_7 Forward -118 -108 18.9579 0.00144
NP_441916.1_7 Reverse -109 -119 10.3048 0.0261
NP_441916.1_10 Reverse -101 -120 12.7825 0.122
NP_440206.1_4 Reverse -99 -118 4.22689 0.257
NP_440465.1_10 Reverse -106 -125 0.0977854 0.29
NP_441041.1_4 Forward -118 -99 10.9142 0.0268
NP_441041.1_4 Forward -336 -317 -8.85033 0.208
NP_441041.1_4 Forward -124 -105 -10.7186 0.236
NP_441041.1_7 Reverse -85 -97 6.73736 0.195
NP_441041.1_7 Reverse -106 -118 6.34865 0.211
NP_443063.1_7 Forward -119 -103 4.87675 0.288
NP_442004.1_6 Reverse -109 -123 17.5025 0.0564
NP_442004.1_6 Forward -118 -104 6.48943 0.172
NP_441725.1_4 Reverse -104 -118 12.9786 0.0693
NP_441725.1_5 Forward -117 -107 11.1898 0.0247
NP_441725.1_5 Reverse -110 -120 9.02648 0.0553
NP_439966.1_7 Reverse -107 -117 14.8275 0.0177
NP_439966.1_7 Forward -120 -110 14.8275 0.0177
NP_439966.1_9 Forward -120 -111 0.884706 0.253
NP_442941.1_3 Forward -117 -107 19.9412 0.00262
NP_442941.1_3 Reverse -110 -120 10.9931 0.0116
NP_440289.1_2 Reverse -106 -119 3.85419 0.0735
NP_440289.1_2 Forward -121 -108 -4.60227 0.29
NP_440983.1_5 Reverse -97 -116 -2.55715 0.231
NP_440983.1_5 Reverse -73 -92 -6.58872 0.278
NP_440260.1_8 Forward -295 -277 0.412472 0.2
NP_442281.1_1 Reverse -104 -118 17.6002 0.00542
NP_442281.1_1 Forward -123 -109 4.42388 0.195
NP_441334.1_7 Forward -120 -101 -9.44032 0.12
NP_441079.1_7 Reverse -3 -22 -0.689632 0.2
NP_442256.1_2 Forward -120 -102 -0.570838 0.14
NP_442256.1_10 Forward -343 -324 21.9273 0.00948
NP_440437.1_1 Reverse -103 -122 18.584 0.0128
NP_442012.1_1 Forward -124 -105 3.93269 0.179
NP_442012.1_1 Forward -310 -291 0.58944 0.235
NP_442012.1_1 Reverse -103 -122 -1.37718 0.286
NP_441556.1_4 Reverse -100 -119 21.7667 0.0255
NP_441556.1_10 Forward -123 -109 16.4514 0.108
NP_440498.1_1 Reverse -100 -118 9.26226 0.0786
NP_442982.1_5 Reverse -99 -118 4.32602 0.179
NP_441644.1_6 Forward -118 -108 19.0557 0.000803
NP_441644.1_6 Reverse -109 -119 17.3841 0.00127
NP_441644.1_6 Forward -208 -198 3.51951 0.277
NP_441644.1_6 Reverse -199 -209 3.42118 0.282
NP_442215.1_2 Forward -120 -104 3.50012 0.0955
NP_442215.1_2 Forward -50 -34 -2.39974 0.197
NP_442215.1_2 Reverse -313 -329 -3.57971 0.218
NP_442215.1_2 Reverse -197 -213 -7.11963 0.286
NP_440929.1_8 Forward -118 -109 19.2726 0.000701
NP_440929.1_8 Reverse -109 -118 19.2726 0.000701
NP_440929.1_8 Reverse -321 -330 3.53964 0.225
NP_442933.1_10 Forward -118 -109 17.601 0.00325
NP_442933.1_10 Reverse -109 -118 17.601 0.00325
NP_441751.2_8 Forward -117 -103 7.9644 0.0327
NP_441751.2_8 Reverse -110 -124 2.85119 0.0759
NP_442554.1_8 Reverse -110 -120 18.0729 0.00543
NP_442554.1_8 Forward -117 -107 16.9913 0.0065
NP_442970.1_3 Forward -20 -2 15.6898 0.161
NP_441762.1_7 Reverse -108 -120 2.79224 0.0676
NP_441762.1_7 Forward -264 -252 -6.35254 0.284
NP_441762.1_7 Forward -119 -107 -6.94252 0.284
NP_442142.1_4 Reverse -106 -119 14.8666 0.0302
NP_442142.1_4 Reverse -288 -301 10.0485 0.0806
NP_442142.1_4 Reverse -100 -113 6.31189 0.169
NP_442142.1_4 Forward -121 -108 4.93527 0.206
NP_442292.1_1 Reverse -110 -119 18.486 0.00229
NP_442292.1_1 Forward -117 -108 17.5026 0.00435
NP_442476.1_6 Reverse -110 -124 23.1074 0.0071
NP_442476.1_6 Reverse -296 -310 0.392915 0.262
NP_441711.1_4 Reverse -100 -119 11.3075 0.109
NP_441523.1_6 Reverse -105 -124 8.16093 0.19
NP_443009.1_5 Forward -119 -108 14.5128 0.02
NP_443009.1_5 Reverse -108 -119 10.1862 0.0792
NP_442301.1_2 Reverse -99 -118 5.40686 0.264
NP_442301.1_2 Reverse -108 -127 4.62021 0.275
NP_442301.1_2 Reverse -87 -106 3.34192 0.296
NP_442408.2_1 Forward -118 -99 8.25926 0.143
NP_441715.1_4 Forward -117 -107 14.238 0.0295
NP_441715.1_4 Reverse -110 -120 7.84651 0.107
NP_441448.1_1 Forward -105 -86 17.5024 0.15
NP_440158.1_8 Forward -120 -101 22.0256 0.0321
NP_440183.1_1 Forward -117 -98 5.50599 0.282
NP_440183.1_9 Reverse -293 -312 -4.32711 0.194
NP_441198.1_8 Reverse -107 -117 13.2713 0.108
NP_440379.1_5 Reverse -312 -331 -2.26216 0.196
NP_440379.1_5 Reverse -199 -218 -5.9004 0.227
NP_440379.1_5 Reverse -94 -113 -7.37537 0.243
NP_440464.1_10 Reverse -40 -50 12.4352 0.225
NP_441468.1_1 Forward -117 -110 15.8704 0.0124
NP_441468.1_1 Reverse -110 -117 15.8704 0.0124
NP_441618.1_7 Forward -367 -348 13.2096 0.295
NP_441020.2_6 Forward -120 -103 19.6067 0.00737
NP_441015.1_10 Forward -123 -104 5.89931 0.112
NP_441015.1_10 Forward -111 -92 -11.3086 0.294
NP_441673.1_1 Forward -118 -109 20.8459 0.000698
NP_441673.1_1 Reverse -109 -118 20.8459 0.000698
NP_441673.1_1 Forward -208 -199 -7.86675 0.187
NP_441673.1_1 Reverse -199 -208 -7.96508 0.206
NP_442253.1_5 Reverse -312 -329 -6.746 0.298
NP_441426.1_7 Reverse -382 -399 16.9518 0.291
NP_441172.1_2 Forward -56 -39 17.4426 0.121
NP_441826.1_2 Reverse -103 -117 3.73617 0.106
NP_441826.1_2 Forward -124 -110 -4.7203 0.299
NP_442490.1_9 Forward -130 -111 -8.752 0.293
NP_442868.1_6 Forward -120 -110 17.4829 0.012
NP_442868.1_6 Reverse -107 -117 1.06167 0.205
NP_442868.1_6 Forward -210 -200 0.668351 0.213
NP_442868.1_6 Forward -393 -383 0.0783647 0.248
NP_441056.1_1 Forward -118 -99 -7.27704 0.272
NP_441612.1_2 Reverse -109 -119 8.54929 0.21
NP_441612.1_2 Reverse -261 -271 8.25885 0.228
NP_442227.1_2 Forward -308 -289 -1.57384 0.264
NP_442227.1_2 Reverse -93 -112 -2.36049 0.272
NP_442227.1_2 Reverse -195 -214 -3.83545 0.298
NP_443058.1_7 Forward -119 -100 8.75091 0.206
NP_442361.1_3 Reverse -103 -116 17.2272 0.0481
NP_442808.1_1 Reverse -108 -118 8.73102 0.0481
NP_442808.1_1 Forward -119 -109 8.63269 0.0481
NP_442808.1_1 Reverse -281 -291 1.74956 0.281
NP_441101.1_1 Forward -120 -102 7.98396 0.294
NP_440918.1_2 Forward -120 -101 9.14423 0.299
NP_442820.1_3 Reverse -270 -280 17.9741 0.187
NP_442542.1_2 Reverse -204 -217 9.06573 0.142
NP_442113.1_10 Reverse -90 -109 -6.88371 0.265
NP_442505.1_2 Reverse -170 -189 14.1136 0.252
NP_442050.1_5 Reverse -107 -117 18.0724 0.00365
NP_442050.1_5 Forward -120 -110 15.6142 0.01
NP_442342.1_9 Forward -120 -104 4.58176 0.247
NP_441493.2_7 Forward -400 -381 10.9142 0.291
NP_441114.1_3 Reverse -317 -326 8.25953 0.231
NP_440558.1_2 Reverse -100 -119 7.66927 0.118
NP_440558.1_2 Reverse -312 -331 6.19431 0.136
NP_440558.1_2 Forward -159 -140 -6.78538 0.28
NP_440558.1_2 Forward -328 -309 -6.98204 0.284
NP_442576.1_9 Reverse -257 -271 15.7678 0.291
NP_442789.1_4 Forward -120 -101 8.55425 0.0993
NP_441518.1_3 Reverse -99 -118 -14.4552 0.276
NP_441878.1_6 Reverse -108 -118 10.5014 0.0176
NP_441878.1_6 Forward -119 -109 10.4031 0.0176
NP_441878.1_6 Forward -325 -315 -6.60814 0.193
NP_441878.1_6 Forward -209 -199 -7.00147 0.201
NP_441878.1_6 Reverse -315 -325 -7.59145 0.245
NP_441036.1_8 Reverse -108 -118 15.713 0.00724
NP_441036.1_8 Forward -119 -109 8.33817 0.174
NP_442650.1_2 Reverse -109 -123 4.81781 0.163
NP_441557.1_5 Forward -118 -109 19.9609 0.000699
NP_441557.1_5 Reverse -109 -118 19.9609 0.000699
NP_441557.1_8 Reverse -376 -386 10.206 0.292
NP_441445.1_1 Reverse -174 -193 2.75272 0.229
NP_441445.1_1 Forward -115 -96 2.65439 0.233
NP_441445.1_1 Reverse -190 -209 1.27776 0.259
NP_441445.1_1 Forward -127 -108 1.27776 0.259
NP_442066.2_4 Forward -292 -273 -7.27704 0.276
NP_442066.2_9 Forward -122 -109 10.639 0.154
NP_441308.1_8 Reverse -107 -117 13.353 0.218
NP_440101.1_3 Forward -123 -104 7.7676 0.17
NP_440101.1_10 Forward -208 -189 3.53937 0.236
NP_442183.1_1 Forward -118 -104 18.2892 0.00781
NP_442183.1_1 Reverse -109 -123 14.9459 0.026
NP_440356.1_1 Reverse -200 -219 13.5683 0.247
NP_441116.1_5 Reverse -265 -284 13.5683 0.27
NP_440979.1_3 Forward -117 -99 10.5406 0.245
NP_441574.1_1 Forward -118 -99 5.211 0.127
NP_440829.1_5 Reverse -324 -338 19.9162 0.0818
NP_441549.1_9 Forward -122 -104 13.6872 0.0304
NP_441638.1_10 Forward -237 -223 17.1092 0.203
NP_442347.1_2 Reverse -110 -119 12.4878 0.056
NP_442347.1_2 Forward -117 -108 3.34298 0.284
NP_440547.1_1 Reverse -98 -117 9.83173 0.237
NP_440547.1_8 Forward -118 -99 20.7473 0.105
NP_441037.1_4 Forward -120 -110 9.55921 0.21
NP_441037.1_4 Reverse -107 -117 7.31769 0.237
NP_441633.1_3 Reverse -107 -120 -3.4223 0.177
NP_441633.1_3 Forward -365 -352 -5.19226 0.229
NP_441633.1_3 Forward -120 -107 -6.17557 0.238
NP_440136.1_2 Forward -117 -110 15.9687 0.0123
NP_440136.1_2 Reverse -110 -117 15.9687 0.0123
NP_442590.1_10 Forward -124 -105 6.09597 0.25
NP_442998.1_10 Forward -116 -109 15.5754 0.0102
NP_442998.1_10 Reverse -111 -118 15.5754 0.0102
NP_440899.1_2 Reverse -98 -117 15.6332 0.0689
NP_440299.1_1 Reverse -105 -118 13.195 0.0319
NP_440299.1_1 Forward -122 -109 9.75346 0.0661
NP_441799.1_1 Forward -122 -108 17.3052 0.011
NP_441799.1_1 Reverse -105 -119 6.48882 0.17
NP_441007.1_5 Reverse -116 -135 10.1275 0.225
NP_441007.1_10 Forward -123 -110 20.6688 0.0139
NP_441007.1_10 Reverse -104 -117 1.10092 0.209
NP_441007.1_10 Forward -213 -200 -1.06236 0.3
NP_442333.2_5 Reverse -98 -117 -14.2585 0.272
NP_440256.1_1 Forward -121 -102 -0.39387 0.0928
NP_440256.1_1 Reverse -106 -125 -2.95047 0.125
NP_440256.1_1 Reverse -361 -380 -7.96535 0.248
NP_441229.1_10 Forward -334 -315 -0.0988766 0.288
NP_440456.1_7 Forward -283 -269 11.111 0.285
NP_441559.1_8 Reverse -104 -118 1.27789 0.156
NP_440915.1_6 Forward -122 -108 5.01447 0.0943
NP_440915.1_6 Reverse -105 -119 3.8345 0.1
NP_440997.1_6 Forward -207 -188 11.2092 0.261
NP_441179.1_9 Reverse -101 -111 9.321 0.28
NP_442785.1_7 Reverse -107 -121 11.701 0.228
NP_441704.1_8 Forward -129 -110 14.7483 0.096
NP_441704.1_8 Reverse -98 -117 6.98015 0.253
NP_442069.1_7 Reverse -92 -111 9.93006 0.291
NP_442866.1_1 Forward -123 -104 14.1591 0.0714
NP_440748.1_5 Reverse -318 -337 7.17762 0.187
NP_440657.1_7 Reverse -239 -258 8.16093 0.227
NP_440537.1_2 Reverse -255 -273 16.0471 0.13
NP_441464.1_8 Reverse -109 -123 10.816 0.178
NP_441464.1_10 Forward -131 -117 10.226 0.262
NP_441464.1_10 Forward -108 -94 7.47274 0.296
NP_440695.1_5 Forward -118 -99 -1.47551 0.284
NP_441939.1_3 Forward -117 -98 7.7676 0.19
NP_441939.1_3 Reverse -110 -129 7.47261 0.201
NP_441199.1_6 Reverse -105 -124 -0.688862 0.277
NP_441494.1_6 Forward -123 -110 10.7374 0.225
NP_441494.1_6 Forward -99 -86 7.09911 0.267
NP_442993.1_1 Forward -208 -192 -2.69473 0.118
NP_440677.1_1 Reverse -100 -119 15.7324 0.103
NP_442386.1_9 Forward -119 -110 13.8639 0.0289
NP_442386.1_9 Reverse -282 -291 10.324 0.132
NP_442386.1_9 Reverse -108 -117 6.39082 0.219
NP_440570.1_5 Forward -257 -238 6.09597 0.185
NP_441750.1_1 Forward -112 -93 -5.11376 0.21
NP_441750.1_4 Reverse -279 -298 7.07928 0.159
NP_441340.1_5 Forward -117 -110 15.6737 0.0124
NP_441340.1_5 Reverse -110 -117 15.6737 0.0124
NP_441340.1_9 Reverse -24 -34 8.93007 0.256
NP_441271.1_1 Forward -124 -106 13.3914 0.224
NP_442327.1_3 Forward -22 -3 7.97315 0.227
NP_440168.1_9 Forward -120 -101 7.66927 0.227
NP_440327.1_6 Forward -118 -99 5.211 0.264
NP_440327.1_6 Forward -342 -323 2.75272 0.29
NP_440586.1_1 Forward -122 -103 1.96607 0.231
NP_440586.1_1 Forward -125 -106 -4.72043 0.278
NP_440586.1_8 Forward -117 -110 13.2151 0.026
NP_440586.1_8 Reverse -110 -117 13.2151 0.026
NP_440586.1_8 Reverse -292 -299 9.08521 0.178
NP_442251.1_6 Forward -117 -110 15.2804 0.0124
NP_442251.1_6 Reverse -110 -117 15.2804 0.0124
NP_441262.1_3 Reverse -109 -116 14.7888 0.0223
NP_441262.1_3 Forward -118 -111 14.7888 0.0223
NP_443051.1_1 Reverse -108 -117 19.5676 0.00335
NP_443051.1_1 Forward -119 -110 10.4228 0.00754
NP_439996.1_6 Forward -113 -94 25.794 0.00324
NP_441232.1_10 Forward -135 -116 2.16274 0.255
NP_439937.1_9 Reverse -108 -125 -4.58339 0.157
NP_440408.1_7 Reverse -109 -128 8.35759 0.281
NP_440439.1_1 Forward -121 -108 10.5407 0.0365
NP_440439.1_1 Reverse -106 -119 9.06573 0.0475
NP_439943.1_1 Forward -362 -343 -5.31042 0.23
NP_440372.1_2 Forward -117 -110 16.3621 0.0124
NP_440372.1_2 Reverse -110 -117 16.3621 0.0124
NP_441789.1_7 Reverse -99 -118 -3.93454 0.28
NP_441803.1_2 Reverse -104 -123 10.8159 0.0809
NP_439977.1_5 Forward -124 -105 12.2908 0.0597
NP_440267.1_2 Reverse -104 -118 9.6354 0.156
NP_442384.1_10 Forward -118 -105 15.4572 0.00986
NP_442384.1_10 Reverse -109 -122 11.0324 0.039
NP_441877.1_7 Reverse -290 -309 4.81688 0.218
NP_441877.1_7 Reverse -104 -123 2.85027 0.218
NP_441018.1_7 Forward -122 -103 13.1758 0.14
NP_441018.1_7 Forward -334 -315 6.39097 0.289
NP_442790.1_4 Forward -127 -108 -11.7019 0.233
NP_442262.1_10 Forward -117 -110 14.1988 0.0123
NP_442262.1_10 Reverse -110 -117 14.1988 0.0123
NP_442262.1_10 Reverse -292 -299 9.18389 0.211
NP_441689.1_5 Reverse -107 -117 17.8758 0.0158
NP_441689.1_5 Forward -120 -110 5.87944 0.197
NP_440163.1_10 Reverse -196 -206 10.7964 0.193
NP_440344.1_10 Reverse -102 -119 7.70866 0.0127
NP_440344.1_10 Forward -125 -108 -7.92597 0.12
NP_440282.1_10 Reverse -99 -118 11.6025 0.0802
NP_440282.1_10 Reverse -311 -330 -6.29373 0.25
NP_440531.1_3 Forward -263 -244 10.8159 0.202
NP_440531.1_6 Forward -308 -289 -1.96717 0.241
NP_442123.1_3 Forward -118 -99 10.0292 0.294
NP_440487.1_1 Forward -121 -102 -3.63879 0.214
NP_441965.1_3 Forward -128 -109 13.3725 0.0845
NP_441965.1_10 Forward -121 -105 8.61333 0.123
NP_441965.1_10 Reverse -288 -304 3.59845 0.259
NP_441965.1_10 Reverse -106 -122 2.12349 0.289
NP_440297.1_9 Forward -117 -107 9.22315 0.0917
NP_440297.1_9 Reverse -110 -120 -0.216628 0.282
NP_441592.1_4 Reverse -39 -58 -3.83545 0.29
NP_441896.1_3 Forward -127 -108 0.392778 0.226
NP_441896.1_5 Forward -368 -361 12.2322 0.273
NP_440894.1_10 Forward -311 -292 6.19431 0.221
NP_440894.1_10 Forward -219 -200 3.93269 0.261
NP_440999.1_9 Forward -122 -108 6.29277 0.0991
NP_440999.1_9 Reverse -105 -119 3.44117 0.13
NP_440888.1_2 Reverse -109 -123 16.1252 0.00789
NP_440888.1_2 Forward -118 -104 13.9619 0.022
NP_442892.1_9 Forward -137 -123 18.4851 0.14
NP_440600.1_4 Reverse -101 -119 -7.94566 0.294
NP_440491.1_1 Forward -121 -102 8.96362 0.223
NP_440052.1_5 Reverse -371 -390 -2.36049 0.212
NP_439969.1_1 Reverse -198 -217 -5.80207 0.288
NP_441748.1_7 Forward -327 -308 13.695 0.238
NP_442948.1_2 Forward -119 -100 11.5042 0.128
NP_442948.1_2 Reverse -108 -127 4.81767 0.258
NP_441123.1_1 Reverse -279 -298 20.1573 0.0577
NP_441949.1_4 Forward -108 -89 8.16093 0.224
NP_441543.1_2 Reverse -110 -119 16.9127 0.00359
NP_441543.1_2 Forward -117 -108 15.9293 0.00518
NP_442845.1_2 Forward -124 -110 16.9125 0.0608
NP_442845.1_2 Reverse -103 -117 4.03116 0.271
NP_441551.1_5 Forward -122 -106 20.9039 0.0208
NP_442710.1_7 Reverse -2 -21 -2.60947 0.245
NP_441469.1_8 Reverse -108 -117 6.5879 0.227
NP_441469.1_8 Forward -119 -110 6.48957 0.227
NP_441469.1_8 Forward -305 -296 5.3096 0.277
NP_443064.1_6 Reverse -109 -119 12.5669 0.0796
NP_443064.1_6 Forward -48 -38 10.9186 0.13
NP_443064.1_6 Forward -118 -108 10.8217 0.13
NP_442578.1_7 Forward -117 -110 14.5921 0.026
NP_442578.1_7 Reverse -110 -117 14.5921 0.026
NP_440710.1_1 Reverse -101 -119 -2.63579 0.195
NP_440071.1_1 Reverse -96 -113 7.90458 0.295
NP_441462.1_2 Forward -118 -108 20.2362 0.000805
NP_441462.1_2 Reverse -109 -119 11.5831 0.00406
NP_441621.1_7 Forward -120 -106 4.52282 0.0934
NP_443062.1_1 Forward -118 -100 10.106 0.121
NP_440519.1_8 Forward -118 -102 3.59845 0.244
NP_442204.1_1 Reverse -105 -116 19.2332 0.0136
NP_442204.1_5 Forward -128 -109 15.4374 0.0439
NP_442204.1_5 Reverse -35 -54 4.71934 0.165
NP_442204.1_6 Forward -112 -93 5.40766 0.271
NP_441560.1_10 Reverse -101 -120 8.65258 0.239
NP_441351.1_1 Forward -345 -326 13.0775 0.235
NP_440516.1_8 Forward -118 -109 16.9127 0.00442
NP_440516.1_8 Reverse -109 -118 16.9127 0.00442
NP_442428.1_5 Forward -117 -110 15.8704 0.0124
NP_442428.1_5 Reverse -110 -117 15.8704 0.0124
NP_442428.1_8 Forward -113 -94 -2.45882 0.296
NP_441443.1_7 Forward -115 -96 2.3594 0.218
NP_442120.1_10 Forward -124 -105 -8.752 0.238
NP_440673.1_3 Forward -116 -109 12.4288 0.0426
NP_440673.1_3 Reverse -111 -118 12.4288 0.0426
NP_440673.1_3 Reverse -72 -79 9.08556 0.202
NP_440865.1_9 Forward -124 -105 -8.06369 0.257
NP_441052.1_2 Reverse -109 -119 19.9412 0.00106
NP_441052.1_2 Forward -118 -108 10.4031 0.0285
NP_442219.1_9 Reverse -110 -119 17.7976 0.00718
NP_442219.1_9 Forward -117 -108 8.25953 0.0681
NP_440436.1_4 Reverse -110 -119 17.2072 0.00233
NP_440436.1_4 Forward -117 -108 9.24241 0.0871
NP_441884.1_9 Forward -121 -102 -13.8652 0.138
NP_441884.1_9 Reverse -106 -125 -23.2067 0.284
NP_440041.1_2 Forward -120 -101 -4.81876 0.293
NP_442907.1_9 Reverse -104 -123 -1.08219 0.232
NP_441719.1_4 Forward -117 -110 16.3621 0.0124
NP_441719.1_4 Reverse -110 -117 16.3621 0.0124
NP_441733.1_10 Forward -307 -294 4.93583 0.236
NP_441004.1_1 Forward -118 -99 -11.9969 0.243
NP_441004.1_1 Forward -124 -105 -13.6686 0.26
NP_442813.1_4 Forward -70 -51 -2.85214 0.287
NP_442813.1_4 Forward -137 -118 -6.49039 0.299
NP_442813.1_4 Forward -136 -117 -7.4737 0.299
NP_442366.1_3 Forward -119 -101 -3.6191 0.253
NP_440129.1_10 Reverse -102 -116 7.27608 0.177
NP_442873.1_3 Reverse -99 -118 9.53674 0.182
NP_440296.1_10 Forward -121 -102 -14.5535 0.27
NP_442694.1_9 Forward -233 -214 8.75091 0.272
NP_442206.1_10 Forward -118 -103 15.8112 0.0799
NP_443054.1_2 Reverse -107 -121 2.75286 0.241
NP_443054.1_2 Reverse -381 -395 2.06454 0.245
NP_441851.1_10 Forward -119 -109 15.8113 0.00552
NP_441851.1_10 Reverse -353 -363 9.61647 0.114
NP_441851.1_10 Reverse -108 -118 8.53483 0.114
NP_440682.1_2 Reverse -200 -219 -16.3235 0.25
NP_441542.1_4 Reverse -64 -78 3.04785 0.292
NP_442011.1_1 Reverse -188 -207 0.786102 0.268
NP_442515.1_1 Reverse -108 -122 11.701 0.0388
NP_442515.1_1 Forward -119 -105 -4.91696 0.298
NP_441396.1_5 Forward -108 -99 8.25953 0.224
NP_440593.1_3 Forward -53 -34 -6.68705 0.28
NP_440463.1_8 Forward -113 -94 5.75726 0.277
NP_440940.1_7 Reverse -99 -117 5.62325 0.225
NP_441349.1_10 Forward -128 -109 12.4875 0.0204
NP_441349.1_10 Reverse -189 -208 -0.197208 0.0936
NP_441349.1_10 Forward -367 -348 -4.81876 0.183
NP_441409.1_6 Forward -124 -105 0.294447 0.0653
NP_441409.1_6 Reverse -103 -122 -9.047 0.178
NP_440432.1_9 Forward -117 -102 -0.413427 0.164
NP_442843.1_1 Forward -299 -280 0.392778 0.17
NP_439960.1_4 Forward -113 -94 18.1898 0.125
NP_439960.1_10 Reverse -102 -120 0.904127 0.205
NP_439960.1_10 Forward -218 -200 -0.570838 0.231
NP_439960.1_10 Forward -215 -197 -4.20908 0.292
NP_440474.1_8 Reverse -110 -124 5.70218 0.244
NP_440726.1_2 Reverse -99 -118 5.211 0.224
NP_440431.1_4 Reverse -233 -252 -7.68752 0.264
NP_442450.1_5 Reverse -107 -117 9.41981 0.115
NP_440588.1_2 Forward -127 -108 5.80098 0.0617
NP_440588.1_2 Forward -333 -314 -5.01543 0.236
NP_440588.1_2 Reverse -36 -55 -5.31042 0.247
NP_440588.1_2 Forward -57 -38 -6.39206 0.28
NP_440195.1_4 Reverse -322 -341 6.68596 0.27
NP_442006.1_2 Forward -112 -95 -13.5308 0.197
NP_442006.1_2 Reverse -214 -231 -17.8574 0.283
NP_441003.1_9 Reverse -100 -119 8.06259 0.224
NP_441003.1_9 Reverse -94 -113 3.34271 0.294
NP_440483.1_1 Reverse -341 -360 -4.91709 0.221
NP_441570.1_1 Forward -118 -100 18.8004 0.00322
NP_441570.1_1 Reverse -261 -279 -13.5505 0.223
NP_441078.1_4 Forward -118 -109 19.6659 0.0007
NP_441078.1_4 Reverse -109 -118 19.6659 0.0007
NP_441078.1_4 Forward -208 -199 -1.57357 0.266
NP_442729.1_5 Reverse -213 -223 9.22315 0.235
NP_442729.1_8 Forward -122 -109 10.049 0.125
NP_441663.1_8 Reverse -103 -122 3.93269 0.174
NP_441663.1_8 Reverse -277 -296 -1.18052 0.24
NP_440526.1_3 Reverse -110 -121 10.6779 0.0646
NP_441432.1_8 Reverse -108 -117 16.8143 0.00595
NP_441432.1_8 Forward -119 -110 16.8143 0.00595
NP_441432.1_9 Forward -15 -2 8.30749 0.29
NP_441333.1_1 Forward -12 -2 12.1619 0.241
NP_442320.1_8 Forward -124 -110 7.66941 0.0189
NP_442320.1_8 Reverse -103 -117 -4.52363 0.171
NP_441732.1_2 Reverse -105 -121 31.0328 0.000298
NP_440629.1_6 Reverse -103 -122 20.0199 0.0283
NP_440760.1_1 Reverse -109 -128 -15.3402 0.146
NP_440760.1_1 Reverse -321 -340 -20.0601 0.22
NP_442797.1_7 Reverse -102 -120 2.47742 0.239
NP_441945.1_10 Forward -119 -100 15.9291 0.146
NP_441057.1_4 Forward -295 -277 -1.65248 0.272
NP_442353.1_4 Forward -214 -195 -0.29631 0.289
NP_440913.1_1 Forward -120 -102 14.5721 0.116
NP_440913.1_1 Forward -327 -309 3.3624 0.299
NP_443011.1_4 Forward -113 -94 12.9791 0.212
NP_441072.1_2 Reverse -185 -204 5.50599 0.296
NP_440713.1_4 Reverse -99 -118 13.5691 0.0973
NP_442489.1_7 Forward -118 -109 20.1576 0.000695
NP_442489.1_7 Reverse -109 -118 20.1576 0.000695
NP_442489.1_7 Forward -208 -199 -1.08191 0.179
NP_442079.1_7 Forward -117 -98 10.1275 0.111
NP_440559.1_1 Reverse -110 -119 17.4043 0.00658
NP_440559.1_1 Forward -117 -108 8.65285 0.0586
NP_441659.2_8 Forward -118 -108 20.9245 0.000805
NP_441659.2_8 Reverse -109 -119 18.1713 0.00133
NP_441659.2_8 Reverse -199 -209 3.71661 0.152
NP_442913.1_1 Reverse -115 -134 5.60432 0.247
NP_442913.1_10 Forward -217 -198 -2.36049 0.184
NP_442913.1_10 Forward -127 -108 -5.40875 0.264
NP_439912.1_10 Reverse -288 -307 22.9097 0.0252
NP_441040.1_2 Reverse -198 -217 -15.1435 0.286
NP_441800.1_7 Reverse -89 -107 3.75572 0.198
NP_440335.1_9 Reverse -72 -90 11.6222 0.273
NP_442776.1_1 Reverse -98 -117 11.1109 0.159
NP_442346.1_5 Forward -119 -109 16.6963 0.00248
NP_442346.1_5 Reverse -108 -118 16.303 0.00248
NP_440545.1_3 Forward -122 -105 15.7718 0.0128
NP_440545.1_3 Reverse -105 -122 8.88863 0.0418
NP_441856.1_7 Forward -112 -93 13.5691 0.192
NP_440831.1_3 Reverse -36 -55 12.503 0.139
NP_441923.1_6 Forward -111 -97 17.7975 0.114
NP_441653.1_2 Reverse -98 -117 4.10942 0.261
NP_440010.1_4 Reverse -99 -118 2.6536 0.222
NP_440010.1_4 Reverse -105 -124 -3.54122 0.299
NP_441943.1_8 Reverse -274 -293 -13.2752 0.265
NP_442551.1_4 Forward -327 -312 0.766545 0.245
NP_442603.1_7 Reverse -109 -123 10.1271 0.133
NP_442603.1_7 Forward -118 -104 8.25877 0.178
NP_441888.1_7 Reverse -104 -118 3.63784 0.225
NP_440449.1_6 Forward -126 -108 12.8272 0.111
NP_441833.1_4 Forward -117 -110 15.9687 0.0124
NP_441833.1_4 Reverse -110 -117 15.9687 0.0124
NP_441329.1_6 Reverse -12 -31 -1.48055 0.293
NP_442162.1_9 Forward -117 -110 16.2637 0.0124
NP_442162.1_9 Reverse -110 -117 16.2637 0.0124
NP_440671.1_4 Reverse -103 -117 11.406 0.133
NP_442404.1_9 Reverse -112 -126 9.83206 0.263
NP_441915.1_4 Reverse -198 -217 12.0933 0.229
NP_442199.1_5 Reverse -101 -120 -3.3438 0.205
NP_442199.1_6 Forward -128 -109 9.0459 0.274
NP_442140.1_3 Reverse -110 -120 13.5497 0.0542
NP_442021.1_3 Forward -124 -105 -6.1954 0.257
NP_440875.1_9 Forward -116 -106 8.27469 0.233
NP_440875.1_9 Reverse -195 -205 7.00932 0.287
NP_440875.1_9 Reverse -297 -307 6.91198 0.294
NP_441813.1_5 Reverse -107 -117 15.9097 0.01
NP_441813.1_5 Forward -120 -110 8.73149 0.0367
NP_441813.1_7 Reverse -94 -108 9.04542 0.264
NP_440590.1_4 Reverse -110 -123 11.6223 0.019
NP_440567.1_1 Reverse -110 -124 20.0591 0.0136
NP_440567.1_1 Forward -117 -103 11.2093 0.0294
NP_442497.1_10 Forward -117 -108 17.601 0.00813
NP_442497.1_10 Reverse -110 -119 10.4228 0.0087
NP_440821.1_4 Forward -120 -110 17.9746 0.00497
NP_440821.1_4 Reverse -107 -117 11.0914 0.0146
NP_441239.1_9 Reverse -107 -119 12.1337 0.0494
NP_441239.1_9 Forward -120 -108 7.11881 0.169
NP_441727.1_3 Forward -125 -106 25.5655 0.00187
NP_441727.1_3 Reverse -102 -121 5.11266 0.256
NP_441892.1_1 Reverse -100 -117 6.13536 0.0995
NP_441892.1_1 Reverse -282 -299 -2.81276 0.228
NP_441892.1_1 Forward -211 -194 -4.18939 0.256
NP_440665.1_1 Forward -115 -96 -2.85214 0.183
NP_440665.1_1 Forward -118 -99 -6.29373 0.202
NP_440665.1_1 Reverse -97 -116 -12.6852 0.251
NP_440604.1_6 Forward -118 -99 0.982764 0.164
NP_442044.1_1 Reverse -104 -123 -2.36049 0.176
NP_441508.1_4 Reverse -327 -341 13.3805 0.297
NP_442643.1_1 Forward -124 -105 -10.0303 0.231
NP_440949.1_7 Reverse -101 -120 12.3883 0.214
NP_441617.1_6 Forward -337 -318 -2.16383 0.258
NP_441617.1_6 Forward -254 -235 -7.4737 0.292
NP_442138.1_10 Forward -118 -99 7.17762 0.0707
NP_440546.1_4 Forward -118 -108 13.5365 0.0459
NP_440546.1_4 Reverse -109 -119 10.046 0.109
NP_440546.1_6 Forward -128 -109 7.7676 0.267
NP_441230.1_5 Forward -123 -104 -0.688862 0.292
NP_440675.1_1 Forward -121 -102 2.55606 0.262
NP_440462.1_6 Reverse -107 -117 16.893 0.00853
NP_440462.1_6 Forward -120 -110 10.3048 0.0396
NP_440868.1_4 Forward -122 -110 19.0169 0.0123
NP_440868.1_4 Reverse -105 -117 6.1355 0.0878
NP_440868.1_8 Forward -122 -103 4.42435 0.103
NP_441204.1_1 Forward -340 -321 8.55425 0.25
NP_442499.1_1 Reverse -104 -123 3.53937 0.252
NP_441474.1_1 Reverse -99 -118 16.5182 0.0944
NP_442402.1_10 Reverse -91 -101 10.6976 0.282
NP_441848.1_4 Reverse -72 -88 8.3146 0.288
NP_441848.1_7 Reverse -268 -287 -3.83621 0.285
NP_441084.1_6 Reverse -107 -121 12.3498 0.164
NP_441084.1_6 Reverse -319 -333 11.3802 0.205
NP_440696.1_3 Forward -122 -104 -3.02911 0.282
NP_442039.1_4 Forward -117 -110 15.1821 0.0124
NP_442039.1_4 Reverse -110 -117 15.1821 0.0124
NP_441811.1_8 Forward -124 -110 10.6193 0.219
NP_442837.1_3 Forward -117 -110 15.7721 0.0124
NP_442837.1_3 Reverse -110 -117 15.7721 0.0124
NP_440160.1_3 Reverse -97 -116 10.52 0.209
NP_442053.1_1 Forward -118 -109 18.3876 0.0007
NP_442053.1_1 Reverse -109 -118 18.3876 0.0007
NP_440505.1_3 Forward -120 -110 16.598 0.00683
NP_440505.1_3 Reverse -107 -117 15.123 0.014
NP_442659.1_10 Forward -324 -305 16.5752 0.247
NP_441102.1_1 Forward -117 -98 4.12936 0.275
NP_441102.1_10 Forward -214 -195 8.84924 0.21
NP_441203.1_1 Forward -67 -48 -17.6018 0.297
NP_442532.1_7 Reverse -109 -123 6.58777 0.171
NP_441408.2_7 Reverse -319 -338 -5.50708 0.295
NP_442174.1_9 Forward -120 -101 12.9791 0.164
NP_440914.1_1 Reverse -109 -119 17.5935 0.000537
NP_440914.1_1 Forward -118 -108 16.3248 0.00196
NP_441011.1_8 Forward -117 -108 16.6177 0.00602
NP_441011.1_8 Reverse -110 -119 8.25953 0.144
NP_442533.1_1 Forward -121 -102 -15.4385 0.254
NP_442533.1_6 Forward -118 -109 17.2076 0.00137
NP_442533.1_6 Reverse -109 -118 17.2076 0.00137
NP_442533.1_6 Reverse -199 -208 5.50626 0.14
NP_442533.1_6 Forward -208 -199 4.22796 0.186
NP_442232.1_3 Forward -126 -107 -13.1769 0.282
NP_443016.1_1 Reverse -103 -122 -3.44213 0.225
NP_443016.1_10 Reverse -376 -395 10.6192 0.235
NP_441482.1_7 Reverse -103 -117 15.7325 0.00937
NP_441235.1_2 Reverse -192 -211 11.7983 0.223
NP_439944.1_9 Reverse -110 -120 19.1546 0.00329
NP_439944.1_9 Forward -117 -107 17.6796 0.00347
NP_441697.1_5 Reverse -2 -21 -7.11457 0.242
NP_440816.1_7 Forward -227 -208 10.3242 0.241
NP_441028.1_6 Reverse -275 -285 9.616 0.21
NP_441028.1_6 Forward -268 -258 6.86274 0.23
NP_442202.1_10 Reverse -290 -304 6.88276 0.255
NP_440116.1_5 Forward -121 -104 14.1985 0.0693
NP_440116.1_8 Forward -117 -98 -5.80207 0.195
NP_441527.1_4 Reverse -331 -350 -12.5576 0.291
NP_440115.1_6 Forward -121 -111 17.9746 0.0163
NP_440115.1_6 Reverse -106 -116 7.45319 0.147
NP_440007.1_9 Reverse -105 -119 11.996 0.163
NP_440007.1_9 Reverse -318 -332 0.786239 0.29
NP_440608.1_6 Reverse -95 -114 11.11 0.238
NP_441602.1_3 Forward -123 -104 13.9625 0.072
NP_441602.1_3 Forward -309 -290 -0.688862 0.224
NP_441602.1_4 Reverse -98 -117 9.43923 0.278
NP_441972.1_5 Reverse -98 -117 -6.58872 0.233
NP_441972.1_5 Forward -117 -98 -8.06369 0.258
NP_441972.1_5 Reverse -110 -129 -8.55534 0.267
NP_441972.1_5 Reverse -272 -291 -9.93197 0.294
NP_441106.1_1 Reverse -108 -117 18.486 0.0028
NP_441106.1_1 Forward -119 -110 9.63616 0.0311
NP_439903.1_1 Reverse -49 -68 0.392778 0.236
NP_439903.1_1 Forward -380 -361 -2.65548 0.274
NP_439903.1_6 Reverse -106 -125 4.71854 0.191
NP_439903.1_6 Forward -121 -102 3.73524 0.207
NP_439903.1_6 Reverse -312 -331 0.981987 0.255
NP_441286.1_1 Forward -119 -107 14.3953 0.00424
NP_441286.1_1 Reverse -108 -120 12.232 0.00999
NP_440670.1_8 Forward -118 -109 18.3876 0.000699
NP_440670.1_8 Reverse -109 -118 18.3876 0.000699
NP_441930.1_2 Forward -325 -315 14.9263 0.19
NP_440886.1_7 Reverse -108 -118 8.04271 0.0805
NP_440886.1_7 Forward -119 -109 7.94438 0.0805
NP_440886.1_7 Reverse -96 -106 6.66608 0.115
NP_440886.1_7 Forward -264 -254 3.22451 0.291
NP_440828.1_4 Reverse -93 -112 -1.77127 0.206
NP_442614.1_2 Reverse -109 -123 14.6509 0.0946
NP_442614.1_2 Forward -208 -194 10.0294 0.235
NP_442614.1_2 Reverse -199 -213 9.43936 0.242
NP_442072.1_9 Forward -119 -101 -22.4986 0.241
NP_442213.1_6 Reverse -287 -306 7.47261 0.246
NP_441753.1_10 Reverse -100 -119 5.211 0.186
NP_441808.1_8 Forward -118 -99 11.7992 0.219
NP_441808.1_8 Forward -115 -96 8.45592 0.26
NP_440907.2_4 Forward -89 -70 14.4388 0.253
NP_440907.2_8 Reverse -110 -120 10.8943 0.0969
NP_440907.2_8 Forward -117 -107 9.51767 0.103
NP_442264.1_2 Forward -122 -105 14.5918 0.128
NP_441021.1_1 Forward -303 -284 -12.7836 0.295
NP_440326.1_5 Forward -120 -107 13.589 0.229
NP_440841.1_4 Reverse -107 -126 2.85105 0.0964
NP_441463.1_3 Reverse -99 -118 7.86593 0.0503
NP_441463.1_3 Forward -128 -109 -10.227 0.291
NP_441463.1_6 Reverse -107 -121 16.8524 0.114
NP_441626.1_2 Forward -117 -110 15.7721 0.0124
NP_441626.1_2 Reverse -110 -117 15.7721 0.0124
NP_441988.1_5 Reverse -278 -297 13.2741 0.274
NP_442365.1_7 Forward -122 -103 0.982764 0.175
NP_442365.1_7 Reverse -105 -124 -3.44213 0.22
NP_442794.1_1 Reverse -105 -117 10.2654 0.0721
NP_442615.1_1 Forward -127 -109 12.8022 0.0126
NP_441962.1_4 Forward -123 -104 0.392778 0.115
NP_441962.1_4 Reverse -110 -129 -9.63698 0.218
NP_441962.1_4 Forward -330 -311 -13.8652 0.279
NP_440387.1_1 Forward -118 -102 15.2998 0.00554
NP_440387.1_1 Reverse -109 -125 4.3851 0.0426
NP_440855.1_5 Reverse -107 -126 1.6703 0.295
NP_441431.1_3 Forward -337 -318 4.12936 0.263
NP_441836.1_2 Forward -124 -105 5.80098 0.121
NP_441993.1_1 Forward -124 -105 4.67549 0.215
NP_440467.1_8 Reverse -202 -221 15.2408 0.127
NP_440114.1_10 Reverse -109 -123 9.14437 0.183
NP_442698.1_10 Reverse -219 -238 0.491109 0.297
NP_442323.1_7 Reverse -104 -123 3.44025 0.242
NP_441206.1_4 Reverse -188 -207 -1.96717 0.193
NP_441552.1_3 Forward -125 -106 12.6833 0.292
NP_440766.1_4 Reverse -105 -119 6.98109 0.097
NP_441237.1_9 Reverse -110 -120 14.9263 0.0242
NP_442743.1_5 Forward -117 -98 7.57094 0.163
NP_440457.1_1 Reverse -105 -117 8.39711 0.101
NP_440457.1_1 Forward -122 -110 0.137309 0.25
NP_440473.1_9 Reverse -280 -299 -7.4737 0.236
NP_442509.1_9 Reverse -45 -55 10.4026 0.179
NP_442509.1_9 Reverse -109 -119 8.14104 0.192
NP_442509.1_9 Forward -118 -108 8.04271 0.192
NP_442509.1_9 Reverse -283 -293 7.15773 0.234
NP_440554.1_4 Forward -117 -107 16.1063 0.0189
NP_440554.1_4 Reverse -110 -120 6.37155 0.123
NP_441845.1_6 Reverse -97 -115 -0.374176 0.274
NP_442737.1_5 Forward -119 -100 17.436 0.109
NP_441885.1_5 Reverse -109 -119 20.9245 0.000538
NP_441885.1_5 Forward -118 -108 11.3864 0.00668
NP_440478.1_2 Reverse -317 -336 2.26107 0.2
NP_440478.1_3 Forward -113 -94 18.2882 0.137
NP_440478.1_10 Reverse -380 -394 16.0275 0.107
NP_441428.1_8 Forward -126 -107 8.84924 0.206
NP_442341.1_7 Forward -119 -105 8.55439 0.0864
NP_442341.1_7 Reverse -108 -122 7.76774 0.0994
NP_442341.1_9 Forward -211 -197 8.06211 0.179
NP_442341.1_9 Reverse -107 -121 6.68548 0.217
NP_443000.1_7 Reverse -107 -117 17.4829 0.00719
NP_443000.1_7 Forward -120 -110 10.4031 0.0345
NP_443059.1_10 Reverse -101 -120 5.99684 0.194
NP_443059.1_10 Reverse -95 -114 2.26028 0.239
NP_442513.1_5 Forward -278 -259 6.29183 0.282
NP_441561.1_4 Reverse -275 -294 8.84924 0.191
NP_441842.1_1 Reverse -111 -124 18.7999 0.0142
NP_441842.1_10 Forward -125 -111 16.6175 0.0301
NP_441842.1_10 Reverse -102 -116 7.47274 0.257
NP_440275.1_3 Forward -120 -110 17.6796 0.0102
NP_440275.1_3 Reverse -107 -117 9.12481 0.055
NP_440091.1_1 Forward -122 -110 8.29878 0.0653
NP_443060.1_1 Reverse -293 -312 12.585 0.166
NP_440679.1_5 Forward -115 -96 4.916 0.298
NP_440679.1_10 Forward -116 -97 -6.58872 0.162
NP_441359.1_5 Forward -218 -199 0.884433 0.29
NP_439951.1_3 Forward -342 -325 16.3618 0.0937
NP_439962.1_4 Reverse -287 -306 -8.06369 0.292
NP_440175.1_7 Forward -122 -104 10.6318 0.25
NP_440149.1_8 Forward -118 -99 6.88262 0.0635
NP_440149.1_8 Reverse -109 -128 -0.885524 0.154
NP_440149.1_8 Reverse -26 -45 -4.22878 0.203
NP_441105.1_3 Forward -129 -110 6.88262 0.0569
NP_441105.1_3 Forward -213 -194 1.57275 0.113
NP_441105.1_3 Reverse -343 -362 -9.53865 0.29
NP_440216.1_1 Forward -118 -104 -2.55701 0.0521
NP_440216.1_1 Reverse -109 -123 -9.44018 0.145
NP_440172.1_1 Forward -118 -108 17.5813 0.00421
NP_440172.1_1 Reverse -109 -119 15.0247 0.00945
NP_440172.1_1 Forward -54 -44 1.94665 0.29
NP_442015.1_10 Reverse -105 -118 11.229 0.0372
NP_442015.1_10 Forward -122 -109 2.77255 0.187
NP_441226.1_7 Forward -117 -110 14.4934 0.0123
NP_441226.1_7 Reverse -110 -117 14.4934 0.0123
NP_441757.1_3 Forward -119 -100 1.76941 0.159
NP_441111.1_7 Forward -117 -109 18.7023 0.00294
NP_441111.1_7 Reverse -110 -118 18.7023 0.00294
NP_442379.1_10 Forward -125 -108 -3.20608 0.252
NP_442379.1_10 Reverse -102 -119 -4.28772 0.291
NP_441766.1_2 Forward -118 -109 17.5026 0.00297
NP_441766.1_2 Reverse -109 -118 17.5026 0.00297
NP_442417.1_5 Forward -118 -104 18.8791 0.0203
NP_440416.1_9 Forward -311 -292 -7.17871 0.0972
NP_440416.1_9 Reverse -102 -121 -12.1936 0.155
NP_443052.1_8 Forward -128 -109 -12.1936 0.249
NP_442403.1_8 Forward -298 -279 -0.000545616 0.241
NP_442403.1_9 Forward -121 -102 7.17762 0.193
NP_440591.1_9 Reverse -284 -302 10.8356 0.111
NP_442154.1_1 Forward -111 -93 -13.5505 0.217
NP_442154.1_1 Forward -117 -99 -16.1071 0.232
NP_442154.1_1 Forward -114 -96 -17.5821 0.26
NP_440261.1_5 Reverse -110 -123 6.80412 0.0316
NP_440261.1_5 Forward -117 -104 -10.6005 0.201
NP_440988.1_10 Forward -105 -91 13.3215 0.175
NP_440988.1_10 Reverse -107 -121 10.2235 0.187
NP_440988.1_10 Reverse -197 -211 7.02871 0.224
NP_440988.1_10 Reverse -320 -334 4.12432 0.274
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACGGAATCGGGCCGCCGCAGAAAGGACATTAATGGCTTGGATTCGCACCAGCCTTTCTTTGATCAGTTTTGGCGTGGGCATTGACCGTATTGTCGCTGCCATCCATGGCGCGTTTCCGGGGGGCAGAAATGGTTTTCACCTATCCCGGACTTTGGGTTTATCCTTTATTATCATTGGCACCTTAGCCCTACTGGCGGCGGCCATTAATCACCGTCAGGATTTAAAGCACATTGAACGGGGACGTTTCACTTACCAGTCCCGTCTTTCCATTAGTTTTGTGGTGGCGATCGCCTTGGTGGTGGTGGGAACCTTTGCTTTTTTAGCAATCATGTTCCAATCGTTTTAGGCCGTTCACGCTCACCAATAGAGTTTTCCTACTAAGTATATTTGTATATTTTTG

CDS

ATGGTCTCCTGCGAAAATCTTTGGCAACAGGCCCTAGCAATCCTGGCAACCCAGTTAACCAAACCGGCCTTTGACACTTGGATCAAAGCATCAGTCCTAATTTCCTTGGGGGATGGGGTGGCCACCATTCAGGTGGAGAATGGTTTTGTCCTGAACCATCTGCAAAAAAGCTATGGACCACTGCTGATGGAGGTACTGACGGATTTAACAGGCCAGGAGATCACGGTGAAGCTCATTACCGATGGCTTGGAACCCCATAGCTTAATTGGCCAGGAGTCTTCTCTGCCCATGGAGACCACCCCTAAAAATGCCACAGCGCTCAATGGTAAATATACTTTTTCTCGTTTTGTGGTGGGGCCCACCAATCGCATGGCCCATGCGGCATCTTTGGCTGTAGCAGAATCCCCCGGACGGGAATTTAATCCTCTTTTTCTCTGTGGCGGCGTTGGTCTAGGCAAAACCCACCTCATGCAGGCGATCGCCCATTACCGACTGGAAATGTACCCTAACGCCAAGGTTTATTACGTTTCCACAGAAAGATTTACCAATGATCTGATCACGGCCATCCGCCAGGACAATATGGAGGATTTCCGAAGCTATTACCGCAGTGCAGACTTTCTACTCATTGACGACATTCAATTTATTAAGGGCAAGGAGTACACCCAAGAGGAGTTTTTCCACACCTTCAACAGTCTCCACGAAGCGGGCAAACAAGTGGTTGTAGCCTCCGACCGTGCTCCCCAAAGGATTCCTGGCTTACAGGACCGGCTCATTTCCCGTTTTTCCATGGGCTTAATTGCCGATATCCAGGTGCCAGATTTGGAAACCCGCATGGCCATTCTGCAAAAAAAGGCTGAGTACGACAGGATTCGTCTGCCCAAGGAGGTCATTGAGTATATTGCTTCCCATTACACTTCCAACATCCGGGAACTGGAAGGAGCCCTGATCCGGGCGATCGCCTACACGTCCCTATCGAACGTGGCCATGACAGTGGAAAACATTGCGCCGGTGCTCAATCCCCCGGTGGAAAAGGTGGCCGCCGCCCCGGAGACCATCATCACCATTGTGGCCCAGCATTATCAGTTAAAGGTTGAAGAACTACTCAGTAACTCCCGCCGTCGGGAAGTTAGCCTGGCGCGTCAAGTGGGGATGTATTTAATGCGTCAGCACACAGACCTGAGTTTGCCTCGCATTGGGGAAGCCTTTGGCGGGAAAGACCACACCACCGTGATGTACAGTTGCGACAAAATAACCCAGCTCCAGCAAAAAGATTGGGAGACCAGTCAGACCCTCACTAGCCTCAGTCATCGCATCAATATTGCCGGCCAAGCCCCGGAATCCTAG

Protein

MVSCENLWQQALAILATQLTKPAFDTWIKASVLISLGDGVATIQVENGFVLNHLQKSYGPLLMEVLTDLTGQEITVKLITDGLEPHSLIGQESSLPMETTPKNATALNGKYTFSRFVVGPTNRMAHAASLAVAESPGREFNPLFLCGGVGLGKTHLMQAIAHYRLEMYPNAKVYYVSTERFTNDLITAIRQDNMEDFRSYYRSADFLLIDDIQFIKGKEYTQEEFFHTFNSLHEAGKQVVVASDRAPQRIPGLQDRLISRFSMGLIADIQVPDLETRMAILQKKAEYDRIRLPKEVIEYIASHYTSNIRELEGALIRAIAYTSLSNVAMTVENIAPVLNPPVEKVAAAPETIITIVAQHYQLKVEELLSNSRRREVSLARQVGMYLMRQHTDLSLPRIGEAFGGKDHTTVMYSCDKITQLQQKDWETSQTLTSLSHRINIAGQAPES