Your browser is old and dusty. Try Google Chrome!

Details for sll0766

ORF sll0766
Accession NP_442053.1
Symbol radC
Category DNA repair protein RadC
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -50 -64 11.6026 0.242
NP_441061.1_2 Reverse -38 -52 12.0943 0.0481
NP_440795.1_7 Forward -69 -62 5.74231 0.279
NP_441418.1_6 Forward -70 -51 -29.4998 0.228
NP_441418.1_6 Reverse -79 -98 -30.1882 0.262
NP_440897.1_6 Forward -235 -216 -4.52452 0.28
NP_441453.1_4 Forward -70 -62 6.70593 0.121
NP_441623.1_1 Reverse -167 -185 -2.63579 0.241
NP_442151.1_6 Forward -70 -56 10.6193 0.119
NP_443002.1_5 Forward -391 -373 10.6381 0.256
NP_442173.1_1 Reverse -62 -70 11.7208 0.034
NP_443027.1_4 Forward -313 -303 7.05986 0.248
NP_439997.1_4 Reverse -360 -379 6.88262 0.266
NP_441812.1_1 Forward -332 -318 17.0102 0.188
NP_440784.1_7 Reverse -62 -69 6.43063 0.218
NP_440784.1_7 Forward -69 -62 6.23397 0.241
NP_442909.1_7 Reverse -62 -76 12.2903 0.131
NP_440061.1_9 Reverse -282 -296 9.04542 0.154
NP_440061.1_9 Forward -368 -354 6.88214 0.228
NP_440061.1_9 Reverse -129 -143 5.30886 0.29
NP_440110.1_8 Forward -90 -71 3.24438 0.211
NP_441054.1_2 Forward -193 -174 10.7175 0.284
NP_442062.1_8 Forward -292 -282 2.83163 0.293
NP_440304.1_4 Reverse -29 -39 4.3066 0.271
NP_440304.1_4 Reverse -189 -199 4.20827 0.272
NP_442242.1_4 Reverse -62 -69 13.3138 0.027
NP_440044.1_8 Reverse -62 -81 2.16274 0.155
NP_441781.1_7 Reverse -61 -80 -0.0988766 0.256
NP_441781.1_7 Forward -242 -223 -2.16383 0.288
NP_441781.1_7 Forward -275 -256 -2.75381 0.289
NP_440916.1_1 Reverse -159 -173 10.9143 0.206
NP_441352.1_2 Forward -258 -239 7.86593 0.162
NP_441619.1_8 Forward -76 -62 9.34041 0.221
NP_441208.1_9 Reverse -47 -61 5.70279 0.262
NP_440014.1_10 Forward -56 -37 15.2408 0.128
NP_440856.1_4 Reverse -277 -296 -5.40875 0.288
NP_441083.1_5 Reverse -61 -71 16.2046 0.00804
NP_441083.1_5 Forward -70 -60 0.275027 0.237
NP_441738.1_2 Reverse -63 -70 13.3134 0.0335
NP_441738.1_2 Reverse -162 -169 6.72528 0.236
NP_441738.1_2 Forward -389 -382 6.52862 0.261
NP_441558.1_5 Reverse -101 -120 5.40766 0.251
NP_441558.1_5 Reverse -257 -276 4.42435 0.281
NP_440209.1_1 Forward -70 -62 8.27922 0.0687
NP_440209.1_1 Reverse -61 -69 5.42762 0.105
NP_442180.1_10 Forward -115 -96 4.03102 0.171
NP_441713.1_1 Reverse -55 -74 -11.8003 0.236
NP_441713.1_3 Reverse -21 -40 4.12936 0.258
NP_441713.1_8 Reverse -168 -186 12.6055 0.196
NP_441770.1_4 Forward -96 -77 -4.81876 0.204
NP_440178.1_7 Reverse -60 -79 -21.24 0.215
NP_442570.1_3 Forward -309 -290 3.53937 0.166
NP_441624.1_7 Forward -82 -68 6.88276 0.275
NP_441163.1_1 Reverse -23 -40 6.62629 0.254
NP_440906.1_5 Reverse -62 -69 6.52896 0.199
NP_440906.1_5 Forward -69 -62 6.0373 0.262
NP_440747.1_1 Reverse -65 -83 9.0656 0.246
NP_440747.1_10 Reverse -58 -70 -4.28759 0.0903
NP_440747.1_10 Forward -73 -61 -4.58258 0.109
NP_441847.1_9 Reverse -205 -223 11.6222 0.232
NP_441486.1_1 Forward -73 -59 6.29277 0.0344
NP_440944.1_6 Reverse -181 -199 12.2122 0.237
NP_440403.1_10 Reverse -94 -113 6.58763 0.214
NP_442848.1_1 Forward -76 -62 12.0943 0.0448
NP_443018.1_3 Reverse -62 -69 5.15232 0.226
NP_443018.1_3 Forward -69 -62 5.05399 0.238
NP_440376.1_1 Reverse -79 -88 5.3096 0.137
NP_440376.1_1 Reverse -61 -70 0.0980582 0.285
NP_440376.1_1 Reverse -357 -366 -0.000272808 0.285
NP_440376.1_1 Forward -293 -284 -0.0986038 0.285
NP_440376.1_1 Forward -70 -61 -0.0986038 0.285
NP_442687.1_7 Reverse -60 -70 6.76487 0.154
NP_442687.1_7 Reverse -7 -17 6.66654 0.155
NP_442687.1_7 Reverse -190 -200 6.56821 0.159
NP_441763.1_5 Forward -110 -91 -4.03212 0.234
NP_442658.1_1 Reverse -29 -39 11.8776 0.0697
NP_442658.1_1 Reverse -189 -199 5.38779 0.269
NP_442198.1_3 Reverse -52 -71 2.3594 0.299
NP_440141.1_8 Reverse -22 -41 12.3892 0.187
NP_440141.1_8 Reverse -349 -368 8.55425 0.23
NP_442782.1_2 Forward -169 -155 8.06273 0.202
NP_442782.1_2 Reverse -266 -280 -0.000409212 0.297
NP_440656.1_8 Forward -286 -267 -8.55534 0.273
NP_441414.1_9 Reverse -61 -80 -9.73531 0.266
NP_441256.1_2 Forward -191 -172 9.3409 0.198
NP_441256.1_8 Forward -258 -239 7.17762 0.257
NP_442321.1_1 Forward -202 -183 -7.4737 0.262
NP_441958.1_5 Reverse -60 -70 0.963343 0.12
NP_441958.1_5 Forward -71 -61 -6.70647 0.287
NP_441127.1_1 Reverse -22 -36 13.3726 0.196
NP_440950.1_8 Forward -332 -313 21.4399 0.0482
NP_440203.1_5 Forward -197 -187 13.6475 0.112
NP_440203.1_5 Reverse -64 -74 9.71433 0.245
NP_439905.1_1 Forward -39 -26 16.5389 0.0578
NP_439905.1_1 Reverse -284 -297 7.59077 0.255
NP_440984.1_7 Reverse -26 -40 8.84938 0.134
NP_440984.1_7 Reverse -33 -47 6.78443 0.2
NP_440984.1_7 Reverse -130 -144 4.71948 0.292
NP_440984.1_7 Forward -273 -259 4.62115 0.296
NP_439990.1_5 Forward -102 -89 6.4108 0.239
NP_439990.1_8 Forward -387 -368 3.14605 0.283
NP_442911.1_2 Forward -69 -50 -6.39206 0.182
NP_443055.1_6 Reverse -283 -301 -2.43985 0.295
NP_440934.1_2 Reverse -62 -81 0.982764 0.277
NP_441099.1_5 Reverse -69 -88 -10.7186 0.261
NP_440106.1_3 Forward -165 -148 16.3618 0.162
NP_441646.1_1 Forward -300 -281 -1.67217 0.293
NP_442438.1_10 Forward -64 -50 1.08123 0.206
NP_441000.1_6 Reverse -60 -74 -3.93365 0.225
NP_440147.1_4 Forward -72 -59 -0.669033 0.294
NP_441295.1_4 Forward -38 -19 4.12936 0.29
NP_441550.1_8 Forward -72 -62 4.7978 0.283
NP_441550.1_8 Reverse -59 -69 4.60114 0.299
NP_441331.1_10 Forward -375 -356 18.0953 0.177
NP_441331.1_10 Reverse -233 -252 16.9494 0.252
NP_441041.1_4 Forward -70 -51 -13.0786 0.28
NP_441041.1_7 Reverse -58 -70 12.6652 0.0611
NP_441041.1_7 Forward -62 -50 7.90349 0.154
NP_441041.1_7 Reverse -209 -221 5.08534 0.278
NP_440569.1_10 Reverse -167 -186 2.24364 0.295
NP_442004.1_6 Reverse -61 -75 11.5043 0.115
NP_441725.1_5 Forward -199 -189 4.89658 0.115
NP_441725.1_5 Forward -39 -29 4.79825 0.115
NP_441725.1_5 Forward -69 -59 -0.0199663 0.223
NP_439966.1_7 Forward -393 -383 5.68278 0.214
NP_442941.1_3 Reverse -62 -72 1.65166 0.147
NP_440289.1_2 Reverse -58 -71 1.10092 0.137
NP_440983.1_5 Reverse -82 -101 -8.45701 0.295
NP_440260.1_7 Forward -227 -208 -0.0988766 0.241
NP_442281.1_1 Reverse -56 -70 2.35894 0.269
NP_441334.1_6 Forward -370 -351 16.9124 0.213
NP_441334.1_7 Forward -202 -183 -20.3551 0.275
NP_439983.1_1 Reverse -239 -257 12.8997 0.222
NP_441556.1_4 Reverse -70 -89 13.1865 0.201
NP_440498.1_5 Reverse -351 -369 10.9427 0.265
NP_441644.1_6 Reverse -61 -71 4.99446 0.216
NP_442215.1_2 Forward -72 -56 5.17175 0.0796
NP_442029.1_1 Forward -313 -294 -19.8634 0.297
NP_442554.1_8 Reverse -62 -72 12.6647 0.0234
NP_442554.1_8 Reverse -260 -270 3.91327 0.203
NP_441762.1_7 Forward -71 -59 -7.43418 0.29
NP_442142.1_4 Reverse -58 -71 4.83694 0.209
NP_442292.1_1 Reverse -62 -71 16.421 0.00748
NP_442476.1_6 Reverse -51 -65 2.5562 0.179
NP_442476.1_6 Reverse -284 -298 0.0979218 0.274
NP_443009.1_5 Forward -293 -282 7.138 0.137
NP_443009.1_5 Forward -392 -381 6.54802 0.157
NP_443009.1_5 Forward -201 -190 4.08976 0.263
NP_443009.1_5 Reverse -356 -367 3.99143 0.268
NP_442301.1_2 Reverse -238 -257 3.44025 0.294
NP_441715.1_4 Reverse -62 -72 6.66654 0.132
NP_441448.1_1 Reverse -20 -39 16.0274 0.158
NP_441448.1_1 Reverse -347 -366 4.916 0.268
NP_440183.1_9 Forward -110 -91 -14.7502 0.27
NP_441468.1_1 Reverse -62 -69 13.0188 0.0383
NP_441468.1_1 Forward -69 -62 6.0373 0.223
NP_441673.1_1 Forward -70 -61 1.27803 0.155
NP_441673.1_1 Reverse -61 -70 1.27803 0.155
NP_441826.1_2 Forward -46 -32 -2.16369 0.267
NP_442868.1_6 Forward -72 -62 0.176696 0.247
NP_442719.1_2 Reverse -204 -222 7.3932 0.119
NP_441612.1_2 Reverse -79 -89 16.1975 0.209
NP_441911.1_10 Forward -345 -326 10.6799 0.226
NP_441101.1_10 Reverse -24 -43 -6.39206 0.29
NP_442542.1_2 Reverse -29 -42 5.03416 0.288
NP_442542.1_9 Reverse -219 -233 5.80051 0.256
NP_441114.1_3 Forward -198 -189 7.57121 0.231
NP_440558.1_2 Reverse -28 -47 -3.14714 0.234
NP_440558.1_2 Forward -395 -376 -7.27704 0.291
NP_442789.1_4 Forward -90 -71 -3.3438 0.25
NP_441878.1_6 Reverse -60 -70 0.668351 0.139
NP_441878.1_6 Reverse -30 -40 -7.39479 0.222
NP_441878.1_6 Reverse -190 -200 -7.59145 0.245
NP_441036.1_8 Reverse -381 -391 5.78156 0.258
NP_442650.1_2 Reverse -61 -75 2.16287 0.292
NP_441557.1_5 Forward -70 -61 0.983037 0.0911
NP_441557.1_5 Reverse -61 -70 0.688044 0.128
NP_441557.1_8 Forward -234 -224 12.5659 0.236
NP_441590.1_4 Reverse -285 -304 3.14526 0.29
NP_442066.2_9 Forward -246 -233 9.75405 0.163
NP_441433.1_8 Forward -199 -180 2.16274 0.225
NP_442347.1_2 Reverse -62 -71 5.50626 0.229
NP_442645.1_2 Forward -78 -59 -12.2919 0.144
NP_442645.1_2 Forward -166 -147 -18.2901 0.27
NP_441037.1_4 Reverse -189 -199 6.92787 0.237
NP_442594.1_7 Forward -81 -62 16.4199 0.0576
NP_442508.1_8 Forward -83 -66 13.4119 0.256
NP_442317.1_6 Reverse -237 -256 5.99764 0.238
NP_441633.1_7 Reverse -124 -143 14.3558 0.22
NP_440136.1_1 Forward -315 -299 9.69426 0.238
NP_440136.1_2 Reverse -62 -69 6.52896 0.116
NP_440136.1_2 Forward -69 -62 6.13563 0.193
NP_442998.1_10 Reverse -63 -70 12.3305 0.0564
NP_440299.1_1 Forward -239 -226 7.78685 0.105
NP_440299.1_1 Forward -74 -61 4.83694 0.197
NP_441799.1_1 Reverse -57 -71 13.1753 0.0348
NP_441799.1_1 Reverse -298 -312 5.01387 0.227
NP_441799.1_1 Forward -296 -282 4.52221 0.247
NP_440640.1_6 Forward -26 -7 8.94757 0.17
NP_442802.1_6 Reverse -78 -97 -1.86883 0.204
NP_440256.1_1 Reverse -34 -53 -7.27704 0.232
NP_441559.1_8 Reverse -279 -293 12.9793 0.0574
NP_441559.1_8 Forward -63 -49 -7.57189 0.295
NP_441270.1_5 Forward -21 -2 15.4341 0.191
NP_440915.1_6 Forward -297 -283 9.34103 0.0431
NP_440915.1_6 Forward -63 -49 0.491246 0.162
NP_440717.1_3 Reverse -162 -176 9.24208 0.25
NP_441866.1_6 Forward -394 -375 11.11 0.21
NP_442866.1_1 Forward -205 -186 -8.45701 0.279
NP_440787.1_5 Forward -374 -360 16.4209 0.185
NP_440695.1_6 Forward -376 -362 10.2174 0.269
NP_441939.1_3 Forward -234 -215 7.07928 0.212
NP_441494.1_6 Reverse -26 -39 6.90245 0.272
NP_442993.1_1 Reverse -266 -282 -9.87289 0.197
NP_440677.1_6 Forward -179 -160 11.0125 0.251
NP_442386.1_9 Reverse -66 -75 9.5374 0.159
NP_440570.1_5 Reverse -69 -88 -2.26216 0.278
NP_441404.1_3 Reverse -148 -167 19.4322 0.175
NP_442054.1_3 Forward -375 -356 -5.70374 0.297
NP_441340.1_5 Reverse -62 -69 5.93897 0.198
NP_441340.1_5 Forward -69 -62 5.84064 0.208
NP_442484.1_2 Forward -81 -62 1.76941 0.226
NP_442791.1_9 Reverse -166 -185 11.7 0.284
NP_442251.1_6 Reverse -62 -69 13.0188 0.0408
NP_440027.1_3 Reverse -88 -106 6.01657 0.23
NP_440027.1_3 Reverse -292 -310 3.36165 0.273
NP_443051.1_1 Forward -71 -62 0.589713 0.143
NP_443051.1_1 Reverse -60 -69 -1.08191 0.281
NP_439937.1_9 Forward -294 -277 -10.3849 0.227
NP_439937.1_9 Reverse -60 -77 -16.0881 0.287
NP_440398.1_2 Forward -20 -1 3.53937 0.231
NP_443039.1_7 Reverse -160 -174 4.52221 0.259
NP_440439.1_1 Reverse -281 -294 1.49425 0.153
NP_440439.1_1 Reverse -47 -60 1.10092 0.162
NP_440439.1_1 Forward -147 -134 -2.04567 0.293
NP_440372.1_2 Reverse -62 -69 6.62729 0.151
NP_440372.1_2 Forward -69 -62 6.52896 0.188
NP_441138.1_5 Reverse -314 -327 10.0884 0.238
NP_440316.1_10 Reverse -30 -40 13.0581 0.214
NP_439977.1_5 Reverse -277 -296 0.982764 0.197
NP_441572.1_7 Reverse -55 -74 14.1591 0.0295
NP_441572.1_7 Reverse -220 -239 4.52268 0.0961
NP_441572.1_7 Forward -65 -46 -1.86883 0.19
NP_442384.1_10 Forward -88 -75 2.87088 0.21
NP_442114.1_8 Forward -329 -315 17.0102 0.17
NP_442114.1_8 Forward -328 -314 4.42388 0.264
NP_442790.1_4 Forward -97 -78 -13.8652 0.268
NP_442262.1_10 Reverse -62 -69 10.6589 0.14
NP_440344.1_10 Forward -53 -36 -12.4492 0.254
NP_440531.1_6 Reverse -23 -42 -5.11376 0.293
NP_440350.1_5 Reverse -311 -330 13.0775 0.134
NP_442187.1_3 Forward -71 -61 16.2046 0.0938
NP_440894.1_10 Reverse -10 -29 2.16274 0.294
NP_440999.1_2 Reverse -68 -87 14.3558 0.164
NP_440888.1_2 Forward -46 -32 8.55376 0.156
NP_440888.1_2 Forward -88 -74 6.19383 0.243
NP_440803.1_3 Forward -296 -277 5.30933 0.241
NP_442277.1_2 Forward -41 -27 16.4209 0.169
NP_442277.1_7 Forward -331 -315 -1.99853 0.289
NP_442033.1_10 Forward -295 -276 -14.5535 0.299
NP_440575.1_8 Reverse -156 -175 -3.73712 0.261
NP_441543.1_2 Reverse -62 -71 7.17789 0.131
NP_441918.1_7 Reverse -357 -376 -2.0655 0.297
NP_441469.1_8 Reverse -60 -69 10.8161 0.195
NP_443064.1_6 Reverse -284 -294 9.46426 0.219
NP_443064.1_6 Forward -241 -231 8.6886 0.276
NP_442578.1_7 Forward -69 -62 5.15232 0.291
NP_441462.1_2 Forward -70 -60 8.04317 0.045
NP_443062.1_1 Forward -112 -94 8.05839 0.16
NP_442204.1_1 Reverse -222 -233 9.69511 0.0736
NP_440516.1_6 Forward -39 -25 11.5037 0.202
NP_440516.1_8 Forward -70 -61 9.14451 0.0354
NP_442428.1_5 Reverse -62 -69 6.3323 0.193
NP_442428.1_5 Forward -69 -62 6.13563 0.209
NP_441443.1_2 Forward -48 -29 -6.68705 0.291
NP_440673.1_3 Forward -198 -191 8.98723 0.203
NP_441052.1_2 Reverse -61 -71 11.0914 0.0285
NP_441052.1_2 Forward -88 -78 3.02829 0.185
NP_442219.1_9 Reverse -62 -71 8.25953 0.0681
NP_440436.1_4 Reverse -62 -71 7.47246 0.129
NP_440436.1_4 Forward -199 -190 6.48915 0.157
NP_440436.1_4 Forward -39 -30 6.48915 0.157
NP_441884.1_8 Reverse -60 -79 -9.24366 0.268
NP_441884.1_9 Forward -311 -292 -21.0434 0.225
NP_441884.1_9 Reverse -19 -38 -23.6 0.284
NP_440689.1_8 Reverse -47 -66 10.3242 0.269
NP_440314.1_9 Forward -69 -50 -7.57203 0.241
NP_441719.1_4 Reverse -62 -69 6.62729 0.151
NP_441719.1_4 Forward -69 -62 6.52896 0.188
NP_441733.1_10 Forward -255 -242 3.5592 0.295
NP_441004.1_1 Forward -26 -7 -14.5535 0.268
NP_441004.1_1 Forward -257 -238 -17.0118 0.288
NP_441004.1_2 Reverse -20 -39 5.40766 0.193
NP_441004.1_4 Reverse -188 -198 10.2065 0.254
NP_439949.1_7 Forward -224 -210 11.406 0.288
NP_442873.1_3 Reverse -42 -61 3.24359 0.29
NP_440296.1_10 Forward -62 -43 -7.4737 0.238
NP_440296.1_10 Reverse -188 -207 -12.7836 0.269
NP_442206.1_1 Forward -40 -21 -10.9153 0.219
NP_443054.1_2 Reverse -282 -296 3.24451 0.24
NP_442515.1_1 Reverse -78 -92 2.85119 0.129
NP_441046.1_2 Forward -256 -237 2.45773 0.24
NP_441349.1_10 Forward -80 -61 -2.16383 0.114
NP_440432.1_9 Reverse -303 -318 -1.49507 0.167
NP_442843.1_1 Forward -300 -281 17.0107 0.0745
NP_439960.1_6 Reverse -240 -259 7.07928 0.291
NP_441477.1_6 Reverse -27 -41 17.9942 0.195
NP_440431.1_4 Forward -331 -312 -7.40105 0.262
NP_440431.1_7 Forward -168 -149 0.392778 0.249
NP_442450.1_5 Reverse -59 -69 8.33817 0.13
NP_440588.1_2 Forward -79 -60 8.35759 0.0455
NP_441873.1_3 Forward -310 -291 17.994 0.196
NP_442006.1_2 Reverse -22 -39 -8.90928 0.197
NP_442006.1_2 Reverse -95 -112 -16.0874 0.238
NP_441570.1_1 Reverse -61 -79 -16.8938 0.257
NP_440078.1_2 Forward -257 -238 14.1591 0.297
NP_441078.1_4 Forward -88 -79 5.70292 0.111
NP_441078.1_4 Forward -70 -61 0.29472 0.205
NP_441078.1_4 Reverse -61 -70 0.0980582 0.205
NP_442729.1_8 Reverse -75 -88 8.08242 0.125
NP_442348.1_2 Reverse -357 -366 10.6195 0.259
NP_442348.1_2 Forward -222 -213 7.57121 0.28
NP_442443.1_1 Reverse -350 -369 -0.983855 0.228
NP_442443.1_1 Reverse -23 -42 -1.18052 0.231
NP_440526.1_3 Forward -199 -188 5.76138 0.233
NP_441432.1_8 Forward -71 -62 7.17789 0.102
NP_441333.1_1 Reverse -314 -324 14.7357 0.208
NP_441732.1_2 Reverse -75 -91 -6.33298 0.0495
NP_441732.1_2 Reverse -57 -73 -8.10294 0.116
NP_441732.1_2 Reverse -255 -271 -17.2477 0.247
NP_442343.1_7 Forward -202 -183 19.769 0.166
NP_442797.1_7 Reverse -381 -399 -0.275845 0.282
NP_440913.1_1 Reverse -189 -207 5.03403 0.252
NP_440713.1_4 Forward -80 -61 1.96607 0.273
NP_442489.1_2 Reverse -56 -75 3.6377 0.235
NP_442489.1_7 Forward -70 -61 0.589713 0.17
NP_442489.1_7 Reverse -61 -70 0.589713 0.17
NP_440559.1_1 Reverse -62 -71 7.66954 0.0999
NP_441659.2_8 Forward -70 -60 -0.0199663 0.282
NP_439956.1_7 Reverse -185 -204 3.6377 0.257
NP_441800.1_10 Reverse -103 -122 12.9791 0.096
NP_442776.1_1 Reverse -68 -87 5.50599 0.241
NP_440779.1_5 Forward -200 -183 -14.3175 0.244
NP_441185.1_7 Reverse -20 -39 13.1758 0.279
NP_442346.1_5 Reverse -190 -200 12.5664 0.0394
NP_442346.1_5 Reverse -60 -70 4.50326 0.286
NP_440545.1_3 Forward -239 -222 -3.99273 0.215
NP_440545.1_3 Forward -74 -57 -4.48438 0.227
NP_440545.1_3 Forward -44 -27 -5.56602 0.253
NP_440025.1_3 Forward -370 -356 17.5813 0.107
NP_441629.1_3 Reverse -241 -260 -4.42619 0.29
NP_441786.1_10 Forward -79 -60 10.4225 0.191
NP_442900.1_1 Forward -181 -162 -5.01543 0.233
NP_442603.1_7 Forward -70 -56 7.66879 0.198
NP_441585.1_5 Reverse -235 -254 3.34192 0.255
NP_441050.1_5 Forward -259 -241 8.57394 0.176
NP_441050.1_5 Reverse -187 -205 -2.83245 0.284
NP_439970.1_10 Reverse -119 -138 18.289 0.174
NP_441833.1_4 Reverse -62 -69 12.9205 0.0393
NP_441833.1_4 Forward -69 -62 6.13563 0.198
NP_441329.1_6 Forward -344 -325 -3.1994 0.298
NP_442162.1_9 Reverse -62 -69 6.52896 0.178
NP_442162.1_9 Forward -69 -62 6.43063 0.208
NP_442404.1_9 Reverse -2 -16 9.83206 0.263
NP_442140.1_3 Forward -69 -59 5.48657 0.207
NP_440875.1_9 Forward -110 -100 9.15072 0.233
NP_442028.1_1 Reverse -313 -326 6.93719 0.294
NP_440590.1_4 Reverse -62 -75 0.412608 0.157
NP_440590.1_4 Forward -251 -238 -1.16069 0.212
NP_440567.1_1 Forward -69 -55 6.09611 0.0894
NP_440567.1_1 Reverse -62 -76 1.27789 0.211
NP_442497.1_10 Forward -69 -60 0.983037 0.123
NP_442497.1_10 Reverse -62 -71 0.688044 0.141
NP_440821.1_4 Forward -72 -62 -0.41329 0.257
NP_441239.1_9 Reverse -59 -71 6.33216 0.193
NP_441239.1_9 Forward -114 -102 5.05386 0.231
NP_441951.1_4 Forward -23 -4 6.88262 0.273
NP_440156.1_4 Forward -374 -364 15.2208 0.176
NP_442568.1_8 Forward -328 -314 11.5043 0.257
NP_442568.1_8 Reverse -149 -163 10.9143 0.257
NP_440604.1_6 Forward -256 -237 -2.36049 0.221
NP_442044.1_1 Reverse -74 -93 -13.8652 0.28
NP_442193.1_8 Reverse -58 -77 9.63507 0.292
NP_442270.1_9 Forward -81 -62 4.42435 0.131
NP_441508.1_4 Reverse -171 -185 13.7625 0.293
NP_441017.1_8 Forward -224 -209 10.108 0.203
NP_441874.1_1 Forward -179 -165 13.6676 0.211
NP_442216.1_4 Reverse -214 -222 8.1805 0.255
NP_442216.1_4 Forward -364 -356 8.08217 0.255
NP_440949.1_7 Reverse -80 -99 11.995 0.217
NP_440354.1_7 Forward -103 -85 8.67227 0.232
NP_441617.1_6 Reverse -357 -376 8.06259 0.121
NP_441782.1_5 Forward -105 -86 6.39097 0.289
NP_440546.1_2 Forward -88 -69 13.6675 0.237
NP_440546.1_4 Forward -70 -60 10.4338 0.109
NP_440546.1_4 Forward -311 -301 9.75513 0.121
NP_440546.1_6 Forward -287 -268 7.7676 0.267
NP_442340.1_3 Forward -198 -179 1.0811 0.144
NP_442611.1_1 Reverse -98 -117 -2.55715 0.292
NP_440868.1_4 Forward -74 -62 5.93884 0.0879
NP_440868.1_4 Reverse -57 -69 0.0389777 0.234
NP_440868.1_6 Reverse -267 -286 12.6841 0.261
NP_441497.1_3 Reverse -148 -167 -0.688862 0.2
NP_441474.1_1 Reverse -237 -256 -3.04956 0.29
NP_442402.1_4 Forward -247 -228 -5.60616 0.245
NP_442402.1_10 Reverse -179 -189 11.6809 0.241
NP_442402.1_10 Reverse -216 -226 10.9926 0.272
NP_441848.1_4 Reverse -203 -219 13.1847 0.195
NP_439942.1_7 Forward -254 -235 2.26107 0.19
NP_442039.1_4 Reverse -62 -69 11.3472 0.086
NP_442039.1_7 Reverse -360 -370 10.9931 0.257
NP_442039.1_7 Reverse -24 -34 10.8948 0.257
NP_441811.1_8 Forward -76 -62 6.29277 0.28
NP_442679.1_1 Forward -332 -313 1.96607 0.169
NP_440825.1_6 Forward -168 -149 8.94757 0.285
NP_442837.1_3 Reverse -62 -69 6.52896 0.2
NP_442837.1_3 Forward -69 -62 6.0373 0.25
NP_442053.1_1 Forward -70 -61 13.9627 0.0153
NP_442053.1_1 Forward -46 -37 8.84951 0.072
NP_442053.1_1 Reverse -61 -70 6.5879 0.124
NP_442053.1_3 Forward -211 -192 18.7807 0.104
NP_442053.1_5 Forward -244 -225 22.1239 0.0877
NP_440914.1_4 Reverse -380 -396 14.4141 0.265
NP_441011.1_8 Forward -87 -78 7.57121 0.17
NP_442533.1_6 Forward -112 -103 3.04799 0.228
NP_440263.1_5 Reverse -360 -374 10.0294 0.294
NP_442232.1_3 Forward -78 -59 -14.3569 0.288
NP_442232.1_3 Forward -260 -241 -14.4552 0.288
NP_442322.1_4 Reverse -239 -256 -9.59824 0.295
NP_442229.1_1 Forward -72 -58 5.70218 0.255
NP_441028.1_6 Reverse -180 -190 10.6976 0.197
NP_441028.1_6 Forward -35 -25 5.78111 0.243
NP_441028.1_6 Reverse -217 -227 4.30615 0.278
NP_440116.1_8 Reverse -62 -81 -6.78538 0.216
NP_441527.1_4 Forward -330 -311 -2.14899 0.154
NP_441527.1_4 Forward -333 -314 -8.92892 0.253
NP_441527.1_4 Forward -327 -308 -9.59736 0.26
NP_441527.1_4 Forward -326 -307 -12.7486 0.293
NP_440115.1_6 Reverse -188 -198 7.45319 0.147
NP_441602.1_3 Forward -117 -98 -0.4922 0.224
NP_441602.1_3 Forward -93 -74 -4.32711 0.263
NP_441825.1_4 Forward -252 -242 17.5813 0.185
NP_439903.1_6 Forward -203 -184 0.392004 0.264
NP_442306.1_10 Reverse -279 -298 -13.1769 0.197
NP_442306.1_10 Forward -396 -377 -21.83 0.291
NP_441286.1_1 Forward -71 -59 4.66053 0.031
NP_440670.1_8 Forward -70 -61 5.80125 0.134
NP_441930.1_2 Reverse -357 -367 12.5664 0.258
NP_440886.1_7 Forward -71 -61 4.7978 0.218
NP_440886.1_7 Reverse -7 -17 3.22451 0.291
NP_442614.1_2 Forward -70 -56 10.226 0.234
NP_442072.1_9 Reverse -258 -276 -13.4522 0.112
NP_440907.2_8 Reverse -285 -295 4.20782 0.273
NP_440326.1_4 Forward -387 -368 16.8539 0.273
NP_441626.1_2 Reverse -62 -69 6.0373 0.212
NP_441626.1_2 Forward -69 -62 5.93897 0.231
NP_441460.1_3 Forward -166 -147 16.5674 0.247
NP_442238.1_4 Forward -225 -206 18.584 0.117
NP_442794.1_1 Reverse -57 -69 2.39892 0.29
NP_442615.1_1 Forward -79 -61 -1.75081 0.132
NP_442615.1_1 Forward -26 -8 -5.78238 0.223
NP_441431.1_1 Forward -352 -334 7.16388 0.245
NP_441431.1_2 Reverse -280 -294 5.60385 0.294
NP_442020.1_1 Forward -375 -356 -1.08295 0.291
NP_441488.1_8 Forward -75 -61 7.17714 0.268
NP_440358.1_8 Forward -225 -206 0.196116 0.263
NP_440114.1_10 Reverse -31 -45 5.89945 0.292
NP_441510.2_10 Reverse -281 -300 13.3725 0.242
NP_441237.1_9 Forward -39 -29 10.1081 0.248
NP_441237.1_9 Forward -199 -189 9.81313 0.265
NP_442743.1_4 Forward -234 -215 -0.197208 0.174
NP_440457.1_1 Reverse -353 -365 -0.944332 0.285
NP_442680.1_5 Forward -334 -315 2.4168 0.237
NP_441436.1_2 Forward -308 -289 -5.9004 0.294
NP_442509.1_9 Reverse -284 -294 9.321 0.192
NP_442509.1_9 Forward -70 -60 6.76441 0.254
NP_442862.1_3 Reverse -320 -337 6.03703 0.267
NP_441885.1_5 Reverse -61 -71 1.35667 0.11
NP_441428.1_8 Forward -120 -101 7.07928 0.206
NP_442341.1_7 Reverse -78 -92 1.27789 0.295
NP_441173.1_9 Forward -370 -362 11.4254 0.226
NP_440409.1_1 Reverse -23 -42 1.0811 0.207
NP_443000.1_7 Forward -72 -62 0.668351 0.293
NP_442451.1_2 Forward -300 -281 -7.08038 0.232
NP_442451.1_2 Reverse -235 -254 -8.752 0.253
NP_441190.1_2 Forward -343 -324 1.47442 0.239
NP_441207.1_7 Forward -328 -314 12.7407 0.24
NP_440149.1_8 Reverse -61 -80 1.86774 0.117
NP_440216.1_1 Forward -70 -56 -11.8985 0.228
NP_440216.1_9 Reverse -294 -303 6.39124 0.289
NP_440172.1_1 Forward -70 -60 15.418 0.00945
NP_440172.1_1 Forward -268 -258 5.38824 0.145
NP_440172.1_1 Reverse -191 -201 4.0116 0.208
NP_440172.1_1 Reverse -31 -41 1.74999 0.299
NP_441226.1_7 Reverse -68 -75 8.29857 0.205
NP_441111.1_7 Reverse -62 -70 8.96754 0.0463
NP_442379.1_10 Forward -77 -60 -3.50107 0.263
NP_441766.1_2 Reverse -61 -70 8.55452 0.054
NP_441766.1_2 Forward -70 -61 5.3096 0.131
NP_440416.1_9 Forward -77 -58 -18.7818 0.264
NP_440072.1_5 Reverse -22 -40 0.609134 0.236
NP_442154.1_1 Forward -25 -7 -17.4838 0.257
NP_442564.1_10 Reverse -165 -179 19.0758 0.165
NP_440261.1_5 Forward -69 -56 -1.35735 0.0733
NP_440261.1_5 Reverse -284 -297 -2.73398 0.0924
NP_440261.1_5 Forward -39 -26 -3.12731 0.115
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CAGGGGGCAGTCAATCCCTGTACCAAAAAATTTCGCCAATTCCCCGACTATGTGAAGAATAATCTAGACCAGCAAAAAAACAAAAAAGTAGCGATGTTTTGCACTGGGGGGATTCGCTGCGAAAAAGCTAGTGCCTATCTCTTGGAGGAGGGATTTGCGGAGGTTTACCATCTCCGGGGGGGAATTTTGCATTACCTAGAAACCATTGCCCCGGAGGAAAGTTTGTGGCAGGGGGAATGTTTTGTCTTTGATGAAAGGGTAGCGGTGCAAGAAGGCTTAAAAGTTGGCTCCCATGCCCTCTGTGACCATTGTGGTTATCCCCTTAGGGTTGGCGATCTCGCAGAGATCCGCTACGCGGTGCGCCATTGTCCCCAGTGCGGTTTAACGGTGGCGGTAAGCA

CDS

ATGAGTTATAGCCTGAGAATTGCCGATCTACCGGAGGATGAACGCCCCAGGGAAAAATTGCTCAAATACGGGGCCAAGCATCTGGGGAATGCTGAATTGATCGCCATTCTCTTGGCCACAGGTCAAGGCAAAGGCAAGCTGTCGGCGGTGGGTCTGGGGCAATATATTTTGCAACAGTTGGGACAAAATCGTCAGGACCCCATGGACGTGTTGCGTAATATCCACCCTCAGGAATTGATTGCTTTTCCCGGCATTGGTCCCGCTAAGGCCACCACGATTTTAGCGGCGGTAGAATTGGGTAAACGGGTGTTCCAGAGTCGTCCCTTGGAAAAAATGGTGGTGGATAGTCCCGAAGCGGCGGCGATCGCCTTGAGCCAGGATTTGATGTGGCAGACCCAGGAACATTTTGCCATTGTCATGCTAGACGTAAAAAACCGTTTGCTGGCGACCAAAGTGATTACCATTGGCACCGCCACAGAGACCCTAATTCACCCCAGGGAAATCTTTCGGGAGGTGATCAAACAGGGTGCCACCAGGCTGATTGTGGCCCATAACCATCCCTCCGGTGGGCTAGAGCCGAGCCCGGAAGATATCAGGCTGACAGAATTCCTACTCCAGGGGGCCCAATACTTGCAAATTCCGGTATTGGACCATCTCATTTTGGGCCACGGCAAGCACCAAAGTTTGCGGCAATGCACAGATCTGTGGGAGCGTTTTCCCCAGGGAGATTAG

Protein

MSYSLRIADLPEDERPREKLLKYGAKHLGNAELIAILLATGQGKGKLSAVGLGQYILQQLGQNRQDPMDVLRNIHPQELIAFPGIGPAKATTILAAVELGKRVFQSRPLEKMVVDSPEAAAIALSQDLMWQTQEHFAIVMLDVKNRLLATKVITIGTATETLIHPREIFREVIKQGATRLIVAHNHPSGGLEPSPEDIRLTEFLLQGAQYLQIPVLDHLILGHGKHQSLRQCTDLWERFPQGD