Your browser is old and dusty. Try Google Chrome!

Details for sll0729

ORF sll0729
Accession NP_442941.1
Symbol
Category probable DNA methyltransferase
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -347 -361 10.3243 0.0635
NP_441061.1_2 Reverse -240 -254 6.29277 0.121
NP_441061.1_2 Reverse -341 -355 4.32615 0.151
NP_440795.1_7 Forward -247 -240 14.6904 0.0123
NP_440795.1_7 Reverse -240 -247 14.6904 0.0123
NP_441418.1_6 Reverse -239 -258 -10.817 0.0397
NP_441418.1_6 Forward -248 -229 -21.4367 0.149
NP_441418.1_6 Forward -395 -376 -28.4182 0.205
NP_441418.1_6 Forward -361 -342 -28.9099 0.213
NP_441418.1_6 Forward -355 -336 -30.7781 0.296
NP_440815.1_5 Forward -167 -148 5.80098 0.275
NP_441453.1_1 Reverse -232 -250 2.77167 0.286
NP_441453.1_4 Reverse -239 -247 16.539 0.00633
NP_441453.1_4 Forward -248 -240 16.539 0.00633
NP_441453.1_4 Forward -349 -341 6.80426 0.121
NP_441453.1_4 Reverse -340 -348 6.11594 0.121
NP_441960.1_3 Reverse -239 -258 13.2234 0.289
NP_442151.1_6 Forward -248 -234 13.3726 0.0528
NP_442151.1_6 Forward -349 -335 10.9143 0.113
NP_442151.1_6 Reverse -340 -354 6.3911 0.236
NP_442151.1_6 Forward -355 -341 5.99778 0.253
NP_440226.1_1 Reverse -239 -258 16.0274 0.022
NP_440226.1_1 Forward -349 -330 10.1275 0.0654
NP_440226.1_1 Forward -248 -229 7.96426 0.0959
NP_442623.1_3 Reverse -240 -259 -18.6834 0.263
NP_440348.1_6 Forward -46 -27 11.1109 0.122
NP_442173.1_1 Forward -247 -239 15.4574 0.00633
NP_442173.1_1 Reverse -240 -248 15.4574 0.00633
NP_442173.1_1 Reverse -341 -349 12.0158 0.0316
NP_442173.1_1 Forward -348 -340 4.83764 0.241
NP_442752.1_4 Forward -349 -342 13.8055 0.0199
NP_442752.1_4 Forward -248 -241 13.8055 0.0199
NP_442752.1_4 Reverse -239 -246 13.8055 0.0199
NP_442752.1_4 Forward -388 -381 9.47889 0.109
NP_443027.1_4 Reverse -237 -247 16.2046 0.0437
NP_443027.1_4 Forward -250 -240 13.943 0.0452
NP_441812.1_3 Forward -249 -235 16.2242 0.0755
NP_442975.1_10 Forward -252 -238 21.3367 0.00107
NP_442975.1_10 Reverse -336 -350 9.6354 0.0661
NP_440784.1_7 Forward -247 -240 15.9687 0.0123
NP_440784.1_7 Reverse -240 -247 15.9687 0.0123
NP_440784.1_7 Forward -348 -341 6.23397 0.241
NP_440784.1_7 Reverse -341 -348 6.13563 0.241
NP_442909.1_7 Reverse -341 -355 18.5835 0.0491
NP_442909.1_7 Reverse -161 -175 10.5204 0.136
NP_441054.1_4 Reverse -229 -247 -0.374176 0.182
NP_441476.1_5 Reverse -294 -313 -1.67217 0.205
NP_442062.1_8 Reverse -239 -249 19.4496 0.000558
NP_442062.1_8 Forward -248 -238 10.3048 0.0493
NP_440761.1_4 Forward -253 -234 -13.7669 0.257
NP_441859.1_3 Reverse -238 -257 5.11187 0.206
NP_441859.1_3 Forward -249 -230 4.32522 0.226
NP_441859.1_3 Reverse -339 -358 2.55527 0.258
NP_441859.1_7 Forward -52 -33 5.40766 0.245
NP_441802.1_1 Reverse -80 -99 7.47261 0.248
NP_440304.1_4 Reverse -237 -247 19.9412 0.00364
NP_440304.1_4 Forward -250 -240 9.91146 0.051
NP_442242.1_4 Forward -247 -240 14.3954 0.0124
NP_442242.1_4 Reverse -240 -247 14.3954 0.0124
NP_441781.1_7 Forward -167 -148 0.687771 0.242
NP_439918.1_2 Forward -367 -348 7.37428 0.154
NP_439918.1_2 Forward -361 -342 -3.63879 0.258
NP_439918.1_3 Forward -251 -232 7.96426 0.252
NP_441935.1_1 Reverse -240 -259 5.30933 0.293
NP_441619.1_8 Forward -361 -347 9.14375 0.234
NP_441619.1_9 Forward -380 -361 7.37428 0.203
NP_441208.1_9 Reverse -236 -250 8.25939 0.219
NP_441208.1_9 Forward -251 -237 5.70279 0.262
NP_441594.1_6 Forward -245 -226 3.44104 0.23
NP_442110.1_2 Reverse -154 -167 22.5609 0.0213
NP_442110.1_7 Forward -355 -341 6.19444 0.151
NP_442110.1_7 Forward -248 -234 2.85119 0.222
NP_442110.1_7 Reverse -164 -178 2.2612 0.222
NP_440300.1_1 Reverse -373 -392 15.0432 0.113
NP_441925.1_4 Reverse -370 -389 0.293673 0.155
NP_441925.1_4 Reverse -371 -390 -15.4392 0.264
NP_441925.1_4 Reverse -362 -381 -17.4058 0.294
NP_440856.1_4 Reverse -232 -251 -1.67217 0.202
NP_441083.1_5 Reverse -340 -350 17.7779 0.00336
NP_441083.1_5 Reverse -239 -249 11.3864 0.0159
NP_441083.1_5 Forward -248 -238 11.2881 0.0159
NP_441083.1_5 Reverse -346 -356 -0.216628 0.261
NP_441083.1_5 Forward -349 -339 -1.00328 0.289
NP_442827.1_8 Forward -256 -237 -3.04956 0.296
NP_441738.1_2 Reverse -342 -349 15.28 0.0102
NP_441738.1_2 Forward -246 -239 15.28 0.0102
NP_441738.1_2 Reverse -241 -248 15.28 0.0102
NP_441558.1_5 Reverse -237 -256 5.211 0.257
NP_441558.1_5 Reverse -344 -363 3.73603 0.299
NP_440209.1_1 Reverse -239 -247 18.1123 0.00295
NP_440209.1_1 Forward -248 -240 18.1123 0.00295
NP_440209.1_1 Forward -349 -341 8.57422 0.0425
NP_440209.1_1 Reverse -340 -348 5.52596 0.0821
NP_442889.1_8 Forward -251 -237 11.1104 0.0748
NP_442889.1_8 Reverse -337 -351 5.80051 0.213
NP_441713.1_1 Reverse -233 -252 -12.6852 0.248
NP_440178.1_5 Reverse -245 -254 18.3876 0.137
NP_440178.1_7 Reverse -238 -257 -1.96717 0.0334
NP_440178.1_7 Reverse -163 -182 -11.8986 0.107
NP_442570.1_3 Reverse -149 -168 -5.40875 0.243
NP_442570.1_3 Forward -364 -345 -7.96535 0.279
NP_441716.1_1 Forward -248 -234 4.52282 0.255
NP_441716.1_1 Forward -355 -341 4.03116 0.259
NP_441327.1_1 Reverse -50 -69 2.86785 0.279
NP_442111.1_4 Reverse -339 -353 7.07942 0.105
NP_442111.1_4 Forward -249 -235 1.86788 0.293
NP_441163.1_1 Forward -336 -319 5.64298 0.271
NP_441163.1_1 Reverse -345 -362 4.26636 0.291
NP_440906.1_5 Forward -247 -240 15.8704 0.0124
NP_440906.1_5 Reverse -240 -247 15.8704 0.0124
NP_440906.1_5 Forward -348 -341 6.23397 0.234
NP_440906.1_5 Reverse -341 -348 6.13563 0.241
NP_440747.1_10 Reverse -236 -248 7.80712 0.00223
NP_440747.1_10 Forward -251 -239 -2.02597 0.0196
NP_440747.1_10 Forward -352 -340 -4.48425 0.101
NP_441130.1_10 Reverse -237 -251 11.0127 0.107
NP_441486.1_1 Forward -251 -237 3.34284 0.0619
NP_441486.1_1 Reverse -343 -357 2.35953 0.0844
NP_441486.1_1 Forward -352 -338 -2.26202 0.175
NP_441486.1_1 Reverse -337 -351 -3.93365 0.184
NP_441486.1_1 Reverse -236 -250 -4.81863 0.209
NP_441486.1_1 Forward -358 -344 -5.90027 0.266
NP_441880.2_10 Reverse -240 -258 17.9154 0.111
NP_442634.1_4 Forward -250 -236 15.6342 0.0115
NP_442634.1_4 Reverse -237 -251 -3.54032 0.161
NP_440403.1_10 Reverse -239 -258 9.3409 0.189
NP_440403.1_10 Reverse -167 -186 8.06259 0.205
NP_440403.1_10 Forward -388 -369 4.916 0.251
NP_441014.1_10 Reverse -238 -257 1.37531 0.229
NP_442848.1_1 Forward -355 -341 -2.06536 0.263
NP_442848.1_1 Forward -254 -240 -3.63866 0.268
NP_442848.1_5 Reverse -345 -363 -3.32411 0.291
NP_442848.1_5 Forward -99 -81 -3.71743 0.297
NP_442848.1_9 Reverse -158 -177 1.67108 0.255
NP_443018.1_3 Forward -247 -240 14.8871 0.0123
NP_443018.1_3 Reverse -240 -247 14.8871 0.0123
NP_443018.1_3 Reverse -341 -348 11.7405 0.0655
NP_443018.1_3 Forward -348 -341 5.44732 0.193
NP_443018.1_3 Forward -354 -347 4.26735 0.267
NP_443018.1_3 Reverse -347 -354 4.16902 0.278
NP_441316.1_7 Forward -250 -235 13.5496 0.0486
NP_441634.1_8 Reverse -237 -251 12.291 0.0529
NP_441634.1_8 Reverse -156 -170 -2.45868 0.295
NP_441634.1_8 Reverse -155 -169 -2.85201 0.295
NP_440376.1_1 Forward -248 -239 19.4693 0.000692
NP_440376.1_1 Reverse -239 -248 19.4693 0.000692
NP_440376.1_1 Forward -349 -340 5.99792 0.111
NP_440376.1_1 Forward -173 -164 5.50626 0.131
NP_440376.1_1 Forward -355 -346 4.62128 0.154
NP_440376.1_1 Forward -362 -353 -0.0986038 0.285
NP_440376.1_1 Reverse -340 -349 -0.196935 0.285
NP_441588.1_4 Reverse -342 -352 8.92815 0.14
NP_441588.1_4 Reverse -241 -251 6.96153 0.178
NP_441588.1_4 Reverse -348 -358 6.37155 0.2
NP_442687.1_7 Forward -249 -239 15.8113 0.0125
NP_442687.1_7 Reverse -238 -248 9.02648 0.0994
NP_441846.1_10 Forward -398 -379 -12.4886 0.19
NP_441846.1_10 Forward -389 -370 -20.4534 0.256
NP_441846.1_10 Forward -387 -368 -21.4367 0.256
NP_441846.1_10 Forward -396 -377 -22.3217 0.259
NP_441846.1_10 Forward -379 -360 -22.8133 0.266
NP_441422.1_7 Reverse -338 -355 -5.66436 0.247
NP_441029.1_3 Forward -184 -165 11.2092 0.277
NP_440533.1_6 Reverse -160 -179 13.7658 0.238
NP_441763.1_10 Reverse -228 -247 5.50519 0.284
NP_442658.1_1 Forward -250 -240 18.7607 0.00222
NP_442658.1_1 Reverse -237 -247 13.0576 0.04
NP_442658.1_1 Reverse -285 -295 8.73102 0.181
NP_440141.1_8 Forward -377 -358 8.65258 0.23
NP_440656.1_8 Forward -259 -240 -7.86702 0.27
NP_442544.1_6 Reverse -232 -251 -7.76869 0.298
NP_441414.1_9 Reverse -239 -258 -2.65548 0.12
NP_441414.1_9 Forward -248 -229 -6.88371 0.206
NP_439968.1_2 Reverse -360 -379 15.6332 0.252
NP_443061.1_4 Forward -171 -152 9.0459 0.205
NP_441487.1_9 Reverse -238 -257 1.27776 0.205
NP_442937.1_5 Forward -253 -234 10.1275 0.17
NP_442937.1_5 Forward -354 -335 6.4893 0.278
NP_441958.1_5 Reverse -238 -248 21.2195 0.000805
NP_441958.1_5 Forward -249 -239 12.2714 0.00183
NP_441958.1_5 Reverse -339 -349 1.55333 0.095
NP_441958.1_5 Forward -350 -340 0.865012 0.12
NP_442836.1_5 Forward -152 -133 4.03102 0.22
NP_440203.1_5 Reverse -343 -353 13.3526 0.116
NP_440203.1_5 Forward -245 -235 12.5659 0.146
NP_443001.1_7 Forward -367 -348 1.86774 0.279
NP_440984.1_7 Forward -253 -239 6.88276 0.195
NP_439990.1_5 Reverse -234 -247 14.2773 0.0889
NP_442911.1_2 Reverse -229 -248 5.30933 0.0341
NP_442911.1_2 Forward -258 -239 1.0811 0.0618
NP_442911.1_2 Reverse -336 -355 -6.29373 0.18
NP_441580.1_6 Forward -145 -126 -2.65548 0.229
NP_440153.1_5 Reverse -240 -254 0.392915 0.299
NP_440369.1_10 Reverse -158 -177 14.6508 0.298
NP_443055.1_3 Forward -257 -238 13.6054 0.163
NP_443055.1_6 Forward -256 -238 8.47483 0.142
NP_443055.1_6 Reverse -371 -389 5.32826 0.179
NP_440993.1_2 Reverse -234 -250 3.59845 0.256
NP_440827.1_3 Reverse -141 -160 17.994 0.101
NP_440138.1_1 Reverse -320 -338 8.76983 0.197
NP_440138.1_6 Reverse -341 -360 0.686995 0.294
NP_441099.1_5 Forward -258 -239 6.39097 0.0458
NP_442002.1_1 Forward -397 -379 2.77242 0.173
NP_442002.1_9 Forward -249 -242 10.7572 0.185
NP_440809.1_9 Reverse -230 -248 10.8356 0.0692
NP_441294.1_7 Reverse -336 -350 15.5859 0.0229
NP_441294.1_7 Forward -252 -238 13.7621 0.0568
NP_441646.1_1 Reverse -157 -176 5.99764 0.175
NP_441646.1_1 Forward -356 -337 1.57275 0.231
NP_442438.1_10 Forward -253 -239 3.04785 0.166
NP_442431.1_10 Forward -367 -349 1.49411 0.253
NP_441292.1_2 Forward -157 -138 -7.86702 0.263
NP_441000.1_6 Reverse -238 -252 5.1128 0.0933
NP_441000.1_6 Reverse -385 -399 1.17956 0.177
NP_442771.1_1 Forward -193 -175 -10.1089 0.242
NP_440147.1_4 Reverse -237 -250 11.819 0.0326
NP_440147.1_4 Forward -250 -237 2.77255 0.202
NP_440147.1_4 Forward -351 -338 -0.275709 0.279
NP_441175.1_10 Reverse -240 -258 12.1139 0.165
NP_441550.1_8 Forward -351 -341 13.3526 0.0252
NP_441550.1_8 Reverse -237 -247 13.0576 0.0273
NP_441550.1_8 Reverse -338 -348 10.6976 0.0648
NP_441550.1_8 Forward -250 -240 10.501 0.066
NP_441916.1_7 Forward -248 -238 18.9579 0.00144
NP_441916.1_7 Reverse -239 -249 18.4663 0.00144
NP_440206.1_4 Reverse -366 -385 0.686995 0.289
NP_440465.1_10 Forward -176 -157 1.76941 0.275
NP_441041.1_4 Reverse -239 -258 -1.08219 0.1
NP_441041.1_4 Forward -248 -229 -1.27885 0.1
NP_441041.1_4 Reverse -141 -160 -9.63698 0.219
NP_441041.1_4 Forward -361 -342 -10.6203 0.235
NP_441041.1_7 Forward -251 -239 19.5648 0.00277
NP_441041.1_7 Reverse -236 -248 6.34865 0.211
NP_441041.1_7 Reverse -337 -349 5.37687 0.26
NP_442004.1_6 Reverse -340 -354 10.4227 0.14
NP_442004.1_6 Forward -248 -234 5.30946 0.191
NP_441725.1_5 Forward -247 -237 11.1898 0.0247
NP_441725.1_5 Reverse -240 -250 9.02648 0.0553
NP_439966.1_7 Forward -250 -240 17.4824 0.00636
NP_439966.1_7 Reverse -237 -247 14.8275 0.0177
NP_439966.1_7 Reverse -377 -387 7.55106 0.15
NP_439966.1_7 Reverse -338 -348 5.97777 0.199
NP_439966.1_9 Forward -250 -241 10.7178 0.0863
NP_440736.1_3 Reverse -237 -256 10.6192 0.145
NP_440736.1_4 Forward -274 -255 15.3382 0.122
NP_442941.1_1 Forward -198 -179 20.5781 0.095
NP_442941.1_3 Forward -247 -237 19.9412 0.00262
NP_442941.1_3 Reverse -240 -250 2.53664 0.14
NP_442941.1_3 Reverse -341 -351 1.25834 0.15
NP_442941.1_4 Forward -272 -253 24.7789 0.0134
NP_440289.1_2 Forward -251 -238 12.9006 0.0132
NP_440289.1_2 Reverse -236 -249 -2.83231 0.262
NP_440983.1_5 Reverse -340 -359 -8.65367 0.295
NP_440260.1_8 Forward -371 -353 -6.56903 0.293
NP_442281.1_1 Forward -253 -239 18.7801 0.00389
NP_442281.1_1 Reverse -234 -248 8.25877 0.0832
NP_442281.1_1 Reverse -335 -349 7.86545 0.0907
NP_442281.1_1 Forward -165 -151 3.63724 0.224
NP_442281.1_1 Reverse -348 -362 2.06395 0.278
NP_440437.1_1 Reverse -233 -252 1.86774 0.143
NP_442012.1_1 Reverse -370 -389 -1.47551 0.289
NP_442049.1_6 Forward -370 -351 5.11266 0.234
NP_441457.1_7 Reverse -237 -256 10.4225 0.126
NP_441556.1_10 Forward -354 -340 10.4165 0.27
NP_440498.1_1 Reverse -230 -248 2.77242 0.172
NP_440498.1_1 Forward -257 -239 -4.20908 0.296
NP_440375.1_8 Reverse -240 -259 -1.57384 0.288
NP_441644.1_6 Forward -248 -238 19.0557 0.000803
NP_441644.1_6 Reverse -340 -350 14.4342 0.0126
NP_441644.1_6 Reverse -239 -249 10.1076 0.0628
NP_441644.1_6 Forward -349 -339 5.68278 0.18
NP_441644.1_6 Reverse -346 -356 3.51951 0.277
NP_443049.1_6 Forward -350 -340 14.4711 0.114
NP_443049.1_6 Forward -356 -346 11.153 0.278
NP_442215.1_2 Forward -250 -234 0.648521 0.148
NP_442215.1_2 Forward -169 -153 -3.38305 0.214
NP_442215.1_2 Reverse -344 -360 -7.31629 0.291
NP_442177.1_5 Forward -358 -344 11.0127 0.22
NP_440253.1_2 Reverse -239 -257 19.9803 0.00546
NP_440929.1_8 Forward -248 -239 19.2726 0.000701
NP_440929.1_8 Reverse -239 -248 19.2726 0.000701
NP_440929.1_8 Reverse -340 -349 7.07956 0.0713
NP_442933.1_10 Forward -248 -239 17.601 0.00325
NP_442933.1_10 Reverse -239 -248 17.601 0.00325
NP_441751.2_8 Forward -247 -233 13.5693 0.0166
NP_441751.2_8 Reverse -240 -254 -3.93365 0.157
NP_441751.2_8 Reverse -347 -361 -6.78525 0.283
NP_442554.1_8 Forward -247 -237 16.9913 0.0065
NP_442554.1_8 Reverse -240 -250 16.008 0.0065
NP_442554.1_8 Reverse -341 -351 5.48657 0.146
NP_442554.1_8 Reverse -347 -357 4.79825 0.173
NP_442554.1_8 Forward -348 -338 4.50326 0.184
NP_441762.1_7 Reverse -238 -250 12.527 0.0142
NP_441762.1_7 Forward -396 -384 3.57889 0.0676
NP_441762.1_7 Forward -249 -237 2.20226 0.0676
NP_441762.1_7 Forward -350 -338 -7.33585 0.287
NP_442142.1_4 Reverse -236 -249 17.4232 0.0264
NP_442142.1_4 Forward -251 -238 14.4733 0.0311
NP_442142.1_4 Reverse -383 -396 4.93527 0.206
NP_442142.1_4 Reverse -337 -350 4.44361 0.222
NP_442292.1_1 Forward -247 -238 17.5026 0.00435
NP_442292.1_1 Reverse -240 -249 9.63616 0.0183
NP_442292.1_1 Reverse -341 -350 8.65285 0.0335
NP_442292.1_1 Reverse -347 -356 6.09625 0.116
NP_440895.1_6 Forward -355 -342 9.16406 0.228
NP_441523.1_6 Forward -177 -158 8.75091 0.188
NP_443009.1_5 Reverse -238 -249 19.626 0.00102
NP_443009.1_5 Forward -249 -238 7.82632 0.118
NP_442301.1_2 Reverse -369 -388 17.4032 0.0906
NP_442301.1_8 Forward -388 -369 14.2574 0.205
NP_441715.1_4 Forward -247 -237 14.238 0.0295
NP_441715.1_4 Reverse -240 -250 9.32148 0.097
NP_441715.1_4 Reverse -387 -397 5.19158 0.224
NP_441448.1_1 Forward -325 -306 10.8159 0.191
NP_440183.1_9 Reverse -372 -391 -12.5869 0.256
NP_441198.1_8 Reverse -237 -247 13.2713 0.108
NP_440379.1_5 Forward -149 -130 -4.91709 0.219
NP_440379.1_5 Reverse -143 -162 -9.93197 0.27
NP_440379.1_5 Reverse -239 -258 -10.4236 0.28
NP_440379.1_5 Forward -230 -211 -10.522 0.28
NP_441468.1_1 Forward -247 -240 15.8704 0.0124
NP_441468.1_1 Reverse -240 -247 15.8704 0.0124
NP_441468.1_1 Forward -348 -341 6.13563 0.209
NP_441468.1_1 Reverse -341 -348 6.0373 0.223
NP_441468.1_1 Forward -354 -347 4.36568 0.237
NP_441020.2_6 Reverse -237 -254 17.1484 0.0211
NP_441015.1_10 Forward -360 -341 -2.0655 0.178
NP_441015.1_10 Forward -388 -369 -2.36049 0.178
NP_441015.1_10 Forward -397 -378 -8.06369 0.272
NP_441015.1_10 Forward -391 -372 -8.752 0.277
NP_441015.1_10 Forward -354 -335 -9.63698 0.282
NP_441673.1_1 Forward -248 -239 20.8459 0.000698
NP_441673.1_1 Reverse -239 -248 20.8459 0.000698
NP_441673.1_1 Forward -349 -340 1.37636 0.114
NP_441673.1_1 Reverse -340 -349 1.1797 0.163
NP_441673.1_1 Forward -173 -164 -7.86675 0.187
NP_441673.1_1 Reverse -164 -173 -7.96508 0.206
NP_441426.1_7 Forward -389 -372 17.5418 0.282
NP_441826.1_2 Reverse -340 -354 2.94952 0.117
NP_441826.1_2 Forward -254 -240 1.57289 0.147
NP_441826.1_2 Forward -355 -341 -4.4253 0.296
NP_442490.1_9 Reverse -227 -246 -6.39206 0.273
NP_442490.1_9 Forward -361 -342 -9.047 0.299
NP_442868.1_6 Forward -250 -240 8.53483 0.0555
NP_442868.1_6 Reverse -237 -247 1.06167 0.205
NP_442868.1_6 Forward -351 -341 0.0783647 0.248
NP_442227.1_2 Reverse -379 -398 1.76941 0.243
NP_442227.1_2 Reverse -369 -388 -3.63879 0.294
NP_443058.1_7 Forward -249 -230 2.26107 0.293
NP_442808.1_1 Forward -249 -239 18.4657 0.00201
NP_442808.1_1 Reverse -339 -349 9.71433 0.0481
NP_442808.1_1 Reverse -238 -248 8.73102 0.0481
NP_442808.1_1 Forward -168 -158 5.48612 0.151
NP_442808.1_1 Reverse -371 -381 5.38779 0.155
NP_442808.1_1 Reverse -352 -362 5.38779 0.155
NP_442808.1_1 Reverse -345 -355 5.19112 0.168
NP_442808.1_1 Reverse -378 -388 4.7978 0.19
NP_442808.1_1 Forward -83 -73 4.01116 0.212
NP_441101.1_2 Reverse -363 -382 14.1583 0.239
NP_441101.1_10 Reverse -371 -390 -7.17871 0.29
NP_440145.1_3 Reverse -330 -349 -2.36049 0.168
NP_442542.1_2 Forward -250 -237 12.3107 0.114
NP_442050.1_5 Reverse -237 -247 18.0724 0.00365
NP_442050.1_5 Forward -250 -240 8.23937 0.234
NP_442342.1_9 Forward -250 -234 10.285 0.137
NP_440342.1_1 Reverse -290 -309 14.8474 0.19
NP_440342.1_2 Forward -149 -130 8.25926 0.284
NP_441114.1_3 Reverse -354 -363 7.37455 0.239
NP_440558.1_2 Forward -170 -151 0.0977854 0.194
NP_442789.1_4 Reverse -141 -160 -5.9004 0.281
NP_441518.1_3 Forward -258 -239 4.71934 0.05
NP_441878.1_6 Reverse -238 -248 10.5014 0.0176
NP_441878.1_6 Forward -249 -239 10.4031 0.0176
NP_441878.1_6 Forward -356 -346 -7.29646 0.217
NP_441878.1_6 Reverse -163 -173 -7.98478 0.285
NP_441036.1_8 Forward -249 -239 17.7779 0.000554
NP_441036.1_8 Reverse -238 -248 15.713 0.00724
NP_442650.1_2 Reverse -340 -354 4.32615 0.18
NP_441557.1_5 Forward -248 -239 19.9609 0.000699
NP_441557.1_5 Reverse -239 -248 19.9609 0.000699
NP_441557.1_5 Forward -349 -340 1.08137 0.0794
NP_441557.1_5 Reverse -340 -349 0.589713 0.134
NP_441445.1_1 Reverse -230 -249 10.4225 0.0952
NP_442267.1_4 Reverse -156 -175 11.2092 0.088
NP_442066.2_9 Forward -252 -239 8.47575 0.185
NP_442777.1_3 Reverse -331 -349 5.22993 0.26
NP_442962.1_5 Forward -199 -180 14.1591 0.129
NP_441308.1_8 Reverse -237 -247 13.353 0.218
NP_441308.1_8 Forward -250 -240 9.22315 0.226
NP_441381.1_6 Reverse -81 -100 12.8808 0.199
NP_440101.1_3 Forward -373 -354 9.0459 0.145
NP_441458.1_10 Forward -32 -13 5.11266 0.224
NP_442469.1_8 Forward -383 -369 19.3708 0.167
NP_442183.1_1 Reverse -239 -253 18.8791 0.00656
NP_442183.1_1 Forward -248 -234 10.521 0.0829
NP_442166.1_7 Forward -159 -145 8.94771 0.21
NP_442397.1_9 Forward -362 -343 11.0125 0.246
NP_439980.1_1 Forward -360 -341 14.8577 0.286
NP_441574.1_1 Forward -361 -342 -1.37718 0.216
NP_441574.1_2 Reverse -323 -342 17.5998 0.226
NP_442170.1_5 Forward -349 -330 2.94938 0.173
NP_442347.1_2 Reverse -240 -249 11.1111 0.056
NP_442347.1_2 Reverse -341 -350 10.3245 0.058
NP_442347.1_2 Forward -247 -238 3.34298 0.284
NP_440547.1_1 Forward -307 -288 9.04509 0.252
NP_441037.1_4 Forward -250 -240 16.2838 0.0168
NP_441037.1_4 Reverse -237 -247 7.31769 0.237
NP_442594.1_8 Forward -388 -369 5.211 0.252
NP_442594.1_8 Forward -389 -370 3.53937 0.28
NP_442317.1_6 Reverse -234 -253 8.06259 0.216
NP_441633.1_3 Reverse -237 -250 3.95252 0.0699
NP_441633.1_3 Forward -250 -237 -3.91395 0.177
NP_440136.1_2 Forward -247 -240 15.9687 0.0123
NP_440136.1_2 Reverse -240 -247 15.9687 0.0123
NP_440136.1_2 Forward -348 -341 6.23397 0.171
NP_440136.1_2 Reverse -341 -348 6.13563 0.193
NP_442590.1_10 Reverse -164 -183 8.75091 0.204
NP_442590.1_10 Reverse -340 -359 5.80098 0.258
NP_442998.1_10 Reverse -342 -349 15.5754 0.0102
NP_442998.1_10 Forward -246 -239 15.5754 0.0102
NP_442998.1_10 Reverse -241 -248 15.5754 0.0102
NP_440299.1_1 Reverse -235 -248 3.46031 0.243
NP_441799.1_1 Reverse -235 -249 17.8952 0.00999
NP_441799.1_1 Forward -252 -238 10.0287 0.0797
NP_441799.1_1 Reverse -336 -350 7.76712 0.133
NP_441007.1_10 Reverse -234 -247 3.65753 0.182
NP_441007.1_10 Forward -253 -240 3.26421 0.182
NP_441007.1_10 Forward -360 -347 2.18257 0.195
NP_441449.1_8 Forward -63 -44 15.1471 0.21
NP_442333.2_5 Forward -171 -152 -4.42544 0.214
NP_442333.2_5 Reverse -375 -394 -12.4886 0.249
NP_440256.1_1 Reverse -236 -255 5.80098 0.0334
NP_440256.1_1 Forward -365 -346 -5.60541 0.187
NP_442904.1_4 Forward -144 -126 19.6853 0.0878
NP_441512.1_4 Reverse -336 -355 11.1109 0.237
NP_441559.1_8 Reverse -234 -248 1.17956 0.156
NP_441559.1_8 Reverse -222 -236 -7.17857 0.287
NP_440915.1_6 Forward -252 -238 15.4376 0.0183
NP_440915.1_6 Forward -353 -339 3.44117 0.101
NP_440915.1_6 Forward -385 -371 -3.44199 0.296
NP_442785.1_7 Reverse -338 -352 8.75105 0.291
NP_441464.1_1 Reverse -360 -379 9.0459 0.246
NP_441464.1_8 Reverse -239 -253 7.9644 0.204
NP_441464.1_10 Forward -364 -350 13.2743 0.199
NP_441464.1_10 Forward -390 -376 9.73436 0.262
NP_440702.1_2 Forward -397 -378 -8.16202 0.287
NP_440695.1_5 Forward -248 -229 0.58944 0.284
NP_440695.1_6 Reverse -228 -242 11.0901 0.265
NP_441199.1_6 Reverse -368 -387 4.52268 0.164
NP_441199.1_6 Reverse -235 -254 -1.67217 0.296
NP_442993.1_1 Forward -248 -232 -2.00642 0.105
NP_442993.1_1 Reverse -239 -255 -7.90627 0.148
NP_442386.1_9 Forward -249 -240 15.7322 0.0144
NP_442386.1_9 Reverse -345 -354 12.2907 0.0676
NP_442386.1_9 Reverse -238 -247 6.39082 0.219
NP_442386.1_9 Forward -168 -159 4.62087 0.294
NP_442386.1_9 Reverse -339 -348 4.52254 0.297
NP_442386.1_10 Forward -379 -366 5.42749 0.262
NP_442054.1_3 Reverse -30 -49 -6.09707 0.297
NP_441340.1_5 Forward -247 -240 15.6737 0.0124
NP_441340.1_5 Reverse -240 -247 15.6737 0.0124
NP_441340.1_5 Forward -348 -341 13.5105 0.0314
NP_441340.1_5 Reverse -341 -348 5.84064 0.208
NP_441340.1_5 Reverse -347 -354 4.07068 0.239
NP_441271.1_1 Reverse -233 -251 11.6214 0.239
NP_439976.1_4 Reverse -17 -36 6.29183 0.278
NP_441676.1_9 Forward -94 -77 12.2311 0.253
NP_440161.1_3 Forward -250 -231 16.2241 0.084
NP_440586.1_8 Forward -247 -240 13.2151 0.026
NP_440586.1_8 Reverse -240 -247 13.2151 0.026
NP_440586.1_8 Reverse -341 -348 9.47853 0.146
NP_440586.1_8 Reverse -347 -354 7.70858 0.227
NP_440586.1_8 Reverse -387 -394 7.41359 0.251
NP_440586.1_8 Reverse -191 -198 7.02027 0.279
NP_440586.1_8 Forward -348 -341 5.74197 0.283
NP_442251.1_6 Forward -247 -240 15.2804 0.0124
NP_442251.1_6 Reverse -240 -247 15.2804 0.0124
NP_440684.1_9 Forward -361 -347 9.04604 0.221
NP_440684.1_9 Forward -355 -341 7.86607 0.249
NP_441262.1_3 Reverse -239 -246 14.7888 0.0223
NP_441262.1_3 Forward -349 -342 14.7888 0.0223
NP_441262.1_3 Forward -248 -241 14.7888 0.0223
NP_440027.1_3 Forward -179 -161 5.22993 0.245
NP_440027.1_3 Reverse -364 -382 4.73828 0.253
NP_440027.1_3 Reverse -376 -394 3.16499 0.278
NP_443051.1_1 Reverse -238 -247 19.5676 0.00335
NP_443051.1_1 Forward -249 -240 10.4228 0.00754
NP_443051.1_1 Forward -350 -341 7.47288 0.0571
NP_443051.1_1 Reverse -339 -348 0.29472 0.195
NP_439937.1_9 Forward -249 -232 -6.94332 0.157
NP_440439.1_1 Reverse -236 -249 16.2439 0.0128
NP_440439.1_1 Forward -251 -238 9.36073 0.0465
NP_440439.1_1 Forward -176 -163 3.06754 0.121
NP_440439.1_1 Forward -386 -373 0.805932 0.175
NP_440372.1_2 Forward -247 -240 16.3621 0.0124
NP_440372.1_2 Reverse -240 -247 16.3621 0.0124
NP_440372.1_2 Forward -348 -341 13.8055 0.0214
NP_440372.1_2 Reverse -341 -348 6.52896 0.188
NP_441789.1_7 Reverse -354 -373 4.22689 0.193
NP_441789.1_7 Reverse -351 -370 -1.96793 0.257
NP_441789.1_7 Reverse -362 -381 -4.52452 0.283
NP_440819.1_5 Reverse -181 -189 7.8859 0.266
NP_440316.1_10 Forward -380 -370 9.02648 0.236
NP_441803.1_2 Forward -178 -159 8.55425 0.114
NP_441803.1_2 Reverse -234 -253 1.76941 0.226
NP_439977.1_5 Forward -167 -148 0.884433 0.199
NP_440139.1_1 Forward -254 -235 1.08032 0.272
NP_442384.1_10 Forward -248 -235 13.589 0.0195
NP_442384.1_10 Reverse -340 -353 6.90245 0.092
NP_442114.1_4 Reverse -239 -250 12.1534 0.107
NP_440364.1_6 Forward -249 -236 13.6867 0.275
NP_441018.1_7 Forward -359 -340 14.4541 0.119
NP_441018.1_7 Forward -366 -347 12.2908 0.163
NP_442790.1_4 Forward -358 -339 2.0644 0.0729
NP_442790.1_4 Reverse -151 -170 -11.3086 0.224
NP_442790.1_4 Forward -57 -38 -14.6519 0.278
NP_442262.1_10 Forward -247 -240 14.1988 0.0123
NP_442262.1_10 Reverse -240 -247 14.1988 0.0123
NP_442262.1_10 Reverse -341 -348 13.2155 0.0213
NP_442262.1_10 Reverse -107 -114 8.20058 0.25
NP_441689.1_5 Reverse -237 -247 17.8758 0.0158
NP_440344.1_10 Reverse -232 -249 0.628827 0.0349
NP_440344.1_10 Forward -255 -238 -1.0428 0.0491
NP_440282.1_2 Reverse -353 -372 6.19431 0.295
NP_440531.1_6 Forward -154 -135 -2.16383 0.246
NP_440531.1_6 Reverse -231 -250 -5.40875 0.297
NP_442123.1_3 Reverse -239 -258 11.3075 0.249
NP_441965.1_10 Forward -251 -235 18.3481 0.0307
NP_442529.1_4 Forward -257 -238 11.7008 0.175
NP_442693.1_6 Reverse -211 -230 1.67108 0.278
NP_440297.1_9 Forward -247 -237 9.22315 0.0917
NP_440297.1_9 Reverse -240 -250 -0.216628 0.282
NP_442187.1_3 Forward -350 -340 15.6147 0.105
NP_441592.1_4 Reverse -346 -365 5.30933 0.135
NP_441896.1_3 Reverse -137 -156 -2.95047 0.294
NP_440894.1_10 Reverse -348 -367 10.4225 0.155
NP_440937.1_5 Forward -368 -349 11.7008 0.275
NP_440999.1_9 Forward -252 -238 11.6026 0.0438
NP_440999.1_9 Reverse -223 -237 -1.27871 0.232
NP_440888.1_2 Reverse -239 -253 15.6336 0.00976
NP_440888.1_2 Forward -248 -234 11.307 0.0705
NP_440888.1_2 Reverse -340 -354 6.98048 0.212
NP_440888.1_2 Reverse -164 -178 5.21053 0.288
NP_440792.1_5 Reverse -240 -259 15.6341 0.113
NP_440491.1_1 Forward -398 -379 12.0823 0.157
NP_441345.1_9 Reverse -177 -196 17.5024 0.0926
NP_439969.1_1 Forward -186 -167 4.22769 0.171
NP_442033.1_10 Forward -250 -231 -9.14533 0.212
NP_442033.1_10 Forward -172 -153 -12.7836 0.277
NP_441123.1_4 Reverse -340 -354 16.3219 0.289
NP_441949.1_2 Forward -258 -239 7.37428 0.261
NP_441543.1_2 Reverse -240 -249 18.486 0.00236
NP_441543.1_2 Forward -247 -238 15.9293 0.00518
NP_441543.1_2 Reverse -341 -350 7.07956 0.131
NP_441543.1_2 Reverse -347 -356 5.21127 0.209
NP_442845.1_2 Forward -355 -341 17.6992 0.0608
NP_442845.1_2 Reverse -233 -247 12.8809 0.102
NP_442845.1_2 Forward -361 -347 8.06273 0.195
NP_441551.1_5 Forward -252 -236 12.2509 0.157
NP_441469.1_8 Forward -249 -240 16.126 0.00797
NP_441469.1_8 Reverse -238 -247 6.5879 0.227
NP_443064.1_6 Forward -248 -238 10.8217 0.13
NP_442578.1_7 Forward -247 -240 14.5921 0.026
NP_442578.1_7 Reverse -240 -247 14.5921 0.026
NP_442578.1_7 Forward -348 -341 6.0373 0.18
NP_441462.1_2 Forward -248 -238 20.2362 0.000805
NP_441462.1_2 Forward -349 -339 16.2046 0.00406
NP_441462.1_2 Reverse -239 -249 11.5831 0.00406
NP_441462.1_2 Reverse -164 -174 -0.511621 0.236
NP_441462.1_2 Forward -173 -163 -0.511621 0.236
NP_441621.1_7 Forward -250 -236 13.9626 0.0266
NP_441621.1_7 Reverse -237 -251 -3.24533 0.188
NP_441621.1_7 Forward -259 -245 -4.81863 0.246
NP_443062.1_1 Reverse -239 -257 18.6867 0.022
NP_443062.1_1 Forward -248 -230 8.83844 0.145
NP_443062.1_1 Forward -349 -331 6.10824 0.209
NP_443062.1_6 Reverse -231 -250 12.6841 0.0972
NP_440519.1_3 Forward -380 -361 7.66927 0.285
NP_440519.1_8 Forward -385 -369 4.68009 0.218
NP_442204.1_1 Reverse -235 -246 9.40011 0.0786
NP_442204.1_1 Forward -353 -342 6.94184 0.144
NP_442204.1_5 Reverse -154 -173 8.94757 0.109
NP_441560.1_8 Reverse -234 -253 12.7787 0.248
NP_440516.1_8 Forward -349 -340 18.9776 0.00442
NP_440516.1_8 Forward -248 -239 16.9127 0.00442
NP_440516.1_8 Reverse -239 -248 16.9127 0.00442
NP_440516.1_8 Reverse -340 -349 5.01461 0.118
NP_440516.1_8 Forward -355 -346 -0.295266 0.232
NP_440516.1_8 Forward -395 -386 -0.590259 0.283
NP_441785.1_1 Reverse -239 -253 12.4475 0.245
NP_441033.1_2 Forward -258 -239 -10.227 0.293
NP_442428.1_5 Forward -247 -240 15.8704 0.0124
NP_442428.1_5 Reverse -240 -247 15.8704 0.0124
NP_442428.1_5 Forward -348 -341 6.13563 0.209
NP_442428.1_5 Reverse -341 -348 6.0373 0.212
NP_442428.1_5 Forward -354 -347 4.66067 0.244
NP_440783.1_5 Forward -400 -381 -6.09707 0.29
NP_441790.1_3 Reverse -240 -259 4.42435 0.113
NP_442120.1_10 Reverse -221 -240 -16.1268 0.296
NP_442120.1_10 Forward -254 -235 -16.3235 0.3
NP_441867.1_2 Forward -396 -377 -17.7985 0.291
NP_440673.1_3 Forward -246 -239 12.4288 0.0426
NP_440673.1_3 Reverse -342 -349 12.4288 0.0426
NP_440673.1_3 Reverse -241 -248 12.4288 0.0426
NP_440673.1_7 Forward -184 -165 11.0125 0.111
NP_440673.1_7 Forward -259 -240 1.47442 0.248
NP_440865.1_9 Forward -329 -310 -1.86883 0.179
NP_441052.1_2 Reverse -340 -350 10.6981 0.0285
NP_441052.1_2 Reverse -239 -249 10.5014 0.0285
NP_441052.1_2 Forward -248 -238 10.4031 0.0285
NP_441052.1_2 Reverse -346 -356 8.04317 0.0533
NP_442219.1_8 Reverse -304 -323 10.5829 0.202
NP_442219.1_9 Reverse -240 -249 8.35786 0.0681
NP_442219.1_9 Forward -247 -238 8.25953 0.0681
NP_442219.1_9 Reverse -341 -350 7.96454 0.0696
NP_442219.1_9 Forward -354 -345 5.70292 0.135
NP_440436.1_4 Reverse -240 -249 18.1905 0.00233
NP_440436.1_4 Forward -247 -238 9.24241 0.0871
NP_440436.1_4 Reverse -341 -350 7.57079 0.124
NP_440436.1_4 Reverse -347 -356 4.81753 0.239
NP_441884.1_9 Forward -358 -339 -20.2567 0.178
NP_441884.1_9 Forward -326 -307 -21.4367 0.245
NP_441884.1_9 Forward -251 -232 -23.7966 0.284
NP_440648.1_1 Forward -248 -229 5.50599 0.214
NP_441719.1_4 Forward -247 -240 16.3621 0.0124
NP_441719.1_4 Reverse -240 -247 16.3621 0.0124
NP_441719.1_4 Forward -348 -341 6.82395 0.0855
NP_441719.1_4 Reverse -341 -348 6.52896 0.188
NP_441733.1_10 Forward -251 -238 10.5407 0.106
NP_441733.1_10 Forward -384 -371 8.27909 0.14
NP_441733.1_10 Reverse -236 -249 5.91914 0.203
NP_441004.1_1 Forward -367 -348 0.0977854 0.119
NP_441004.1_1 Forward -35 -16 -15.6352 0.276
NP_441004.1_1 Forward -361 -342 -16.5201 0.286
NP_441004.1_2 Forward -372 -353 -1.08219 0.259
NP_441004.1_4 Forward -364 -354 10.9931 0.254
NP_442366.1_3 Forward -249 -231 -3.52077 0.251
NP_442366.1_3 Reverse -238 -256 -4.01242 0.262
NP_442366.1_5 Forward -352 -342 17.2858 0.0141
NP_440129.1_4 Reverse -343 -361 15.8496 0.171
NP_440296.1_10 Forward -389 -370 5.50599 0.161
NP_441115.1_4 Forward -249 -231 14.473 0.0551
NP_442694.1_4 Forward -48 -39 10.8161 0.294
NP_442206.1_10 Forward -248 -233 7.25639 0.178
NP_442206.1_10 Forward -184 -169 2.33984 0.202
NP_442854.1_6 Reverse -158 -177 2.94938 0.272
NP_443054.1_2 Reverse -237 -251 21.7307 0.00482
NP_443054.1_2 Reverse -351 -365 7.47274 0.153
NP_443054.1_2 Reverse -370 -384 0.786239 0.254
NP_442308.1_8 Forward -173 -154 7.66927 0.296
NP_441851.1_10 Forward -249 -239 16.008 0.00552
NP_441851.1_10 Reverse -238 -248 8.53483 0.114
NP_442622.1_1 Reverse -238 -257 7.7676 0.0623
NP_442622.1_5 Forward -250 -231 -3.3438 0.171
NP_441501.1_2 Reverse -243 -262 19.6656 0.0743
NP_441668.1_4 Forward -371 -352 3.14605 0.187
NP_442515.1_1 Reverse -238 -252 -3.34366 0.29
NP_442515.1_1 Forward -170 -156 -4.03198 0.298
NP_442515.1_1 Forward -249 -235 -4.7203 0.298
NP_440593.1_3 Reverse -335 -354 2.55606 0.175
NP_440593.1_3 Forward -178 -159 -7.08038 0.285
NP_441982.1_6 Forward -333 -324 11.6259 0.288
NP_440463.1_8 Reverse -160 -179 10.3075 0.227
NP_441349.1_10 Reverse -229 -248 -8.85033 0.279
NP_441409.1_6 Reverse -233 -252 21.2389 0.0044
NP_440389.1_5 Reverse -232 -251 13.1865 0.261
NP_440432.1_9 Reverse -240 -255 17.8761 0.00961
NP_440432.1_9 Forward -348 -333 -5.82163 0.267
NP_442843.1_1 Forward -65 -46 -10.0303 0.274
NP_440474.1_8 Reverse -240 -254 17.3052 0.0432
NP_440726.1_2 Forward -183 -164 0.392778 0.288
NP_440431.1_3 Forward -249 -230 -4.52377 0.179
NP_442450.1_5 Reverse -237 -247 9.41981 0.115
NP_440588.1_2 Reverse -230 -249 3.34271 0.103
NP_440588.1_2 Forward -358 -339 -1.7705 0.157
NP_440040.1_8 Forward -217 -198 8.6416 0.203
NP_442006.1_2 Forward -257 -240 -8.22096 0.192
NP_442006.1_3 Forward -392 -374 -7.749 0.298
NP_441570.1_1 Reverse -67 -85 -9.22396 0.132
NP_441570.1_1 Reverse -239 -257 -9.61729 0.142
NP_441570.1_1 Forward -349 -331 -10.0106 0.156
NP_441570.1_1 Forward -395 -377 -11.8789 0.204
NP_441078.1_4 Forward -248 -239 19.6659 0.0007
NP_441078.1_4 Reverse -239 -248 19.6659 0.0007
NP_441078.1_4 Forward -349 -340 0.196389 0.205
NP_441078.1_4 Reverse -340 -349 -0.000272808 0.205
NP_441078.1_4 Reverse -164 -173 -1.86856 0.272
NP_441078.1_4 Forward -355 -346 -1.86856 0.272
NP_441663.1_7 Reverse -236 -255 5.211 0.238
NP_441663.1_8 Forward -254 -235 -2.85214 0.274
NP_441663.1_8 Forward -88 -69 -3.83545 0.298
NP_442348.1_2 Reverse -48 -57 11.6028 0.232
NP_442348.1_2 Forward -362 -353 10.6195 0.259
NP_442348.1_2 Reverse -256 -265 9.53783 0.28
NP_442443.1_1 Forward -394 -375 -4.03212 0.268
NP_440526.1_3 Reverse -240 -251 11.7595 0.0646
NP_440526.1_3 Reverse -347 -358 0.844851 0.267
NP_441432.1_8 Reverse -238 -247 16.8143 0.00595
NP_441432.1_8 Forward -350 -341 14.0611 0.0258
NP_441432.1_8 Forward -356 -347 11.3078 0.0569
NP_441432.1_8 Forward -249 -240 8.25953 0.0755
NP_442320.1_8 Forward -254 -240 14.1593 0.0138
NP_442344.1_7 Reverse -240 -259 -7.17871 0.18
NP_441732.1_2 Reverse -235 -251 1.92682 0.0254
NP_441732.1_2 Forward -177 -161 -15.9694 0.164
NP_441732.1_2 Reverse -336 -352 -16.8544 0.207
NP_440629.1_4 Forward -268 -249 15.0441 0.175
NP_440759.1_10 Forward -397 -378 4.916 0.249
NP_440760.1_1 Reverse -239 -258 -19.9617 0.22
NP_442797.1_1 Reverse -360 -379 -4.81876 0.286
NP_442797.1_7 Reverse -339 -357 2.87075 0.238
NP_442274.1_1 Forward -334 -315 19.6656 0.107
NP_442298.1_10 Forward -247 -228 10.7175 0.267
NP_440913.1_1 Reverse -145 -163 8.18062 0.19
NP_441072.1_2 Forward -360 -341 11.7008 0.187
NP_442400.1_2 Forward -142 -123 8.84924 0.249
NP_442400.1_10 Reverse -31 -44 8.0831 0.279
NP_440713.1_4 Forward -393 -374 2.3594 0.264
NP_442489.1_7 Forward -248 -239 20.1576 0.000695
NP_442489.1_7 Reverse -239 -248 20.1576 0.000695
NP_442489.1_7 Forward -349 -340 0.688044 0.152
NP_442489.1_7 Reverse -340 -349 0.688044 0.152
NP_442489.1_7 Forward -355 -346 -1.37691 0.195
NP_442079.1_6 Reverse -231 -250 12.9791 0.283
NP_442079.1_7 Forward -247 -228 13.4708 0.079
NP_440559.1_1 Reverse -240 -249 8.75118 0.0586
NP_440559.1_1 Forward -247 -238 8.65285 0.0586
NP_440559.1_1 Reverse -341 -350 7.76787 0.0918
NP_441659.2_8 Forward -248 -238 20.9245 0.000805
NP_441659.2_8 Reverse -239 -249 11.9764 0.0147
NP_441659.2_8 Reverse -340 -350 5.48657 0.106
NP_441659.2_8 Forward -349 -339 1.84832 0.224
NP_441092.1_3 Forward -246 -227 1.86774 0.192
NP_442913.1_10 Forward -257 -238 9.43923 0.0449
NP_439956.1_7 Forward -379 -360 2.94938 0.265
NP_442008.1_2 Reverse -337 -356 2.26107 0.295
NP_440442.1_10 Reverse -378 -395 17.5418 0.235
NP_441800.1_7 Reverse -341 -359 -3.42244 0.279
NP_442776.1_6 Forward -250 -231 10.3242 0.211
NP_440315.1_9 Reverse -144 -154 17.7779 0.0679
NP_440779.1_5 Reverse -239 -256 -4.97604 0.12
NP_442346.1_5 Reverse -238 -248 16.303 0.00248
NP_442346.1_5 Forward -249 -239 9.02648 0.118
NP_440545.1_3 Forward -252 -235 5.54538 0.0608
NP_440545.1_3 Reverse -160 -177 1.71047 0.114
NP_440545.1_3 Reverse -373 -390 -7.04099 0.295
NP_440545.1_5 Reverse -154 -171 19.41 0.108
NP_440545.1_5 Forward -392 -375 11.2486 0.21
NP_441856.1_3 Forward -251 -232 10.4225 0.101
NP_440459.1_2 Reverse -149 -166 15.4768 0.113
NP_440459.1_2 Forward -158 -141 9.97027 0.212
NP_441653.1_2 Forward -259 -240 6.81516 0.225
NP_440010.1_10 Forward -391 -372 1.57275 0.297
NP_442603.1_7 Forward -248 -234 7.66879 0.198
NP_441888.1_7 Forward -253 -239 2.35953 0.225
NP_441888.1_7 Forward -77 -63 1.86788 0.235
NP_440449.1_6 Reverse -156 -174 11.5628 0.129
NP_441948.1_4 Reverse -232 -250 -0.964162 0.14
NP_441833.1_4 Forward -247 -240 15.9687 0.0124
NP_441833.1_4 Reverse -240 -247 15.9687 0.0124
NP_441833.1_4 Reverse -341 -348 6.52896 0.0924
NP_441833.1_4 Forward -348 -341 6.23397 0.163
NP_442162.1_9 Forward -247 -240 16.2637 0.0124
NP_442162.1_9 Reverse -240 -247 16.2637 0.0124
NP_442162.1_9 Forward -348 -341 12.9205 0.0282
NP_442162.1_9 Reverse -341 -348 12.9205 0.0282
NP_440671.1_4 Reverse -233 -247 8.06273 0.204
NP_441973.1_5 Forward -255 -236 13.7658 0.198
NP_440772.1_6 Reverse -240 -259 12.2908 0.202
NP_442199.1_5 Reverse -231 -250 7.66927 0.0719
NP_442140.1_3 Reverse -240 -250 17.4829 0.0159
NP_442140.1_3 Reverse -341 -351 10.2065 0.0902
NP_440875.1_9 Reverse -241 -251 17.619 0.0104
NP_440875.1_9 Forward -246 -236 8.27469 0.233
NP_441813.1_5 Reverse -237 -247 15.9097 0.01
NP_441813.1_5 Forward -250 -240 10.0098 0.0208
NP_441813.1_5 Reverse -338 -348 5.48657 0.123
NP_440590.1_4 Reverse -341 -354 9.85238 0.0331
NP_440590.1_4 Reverse -240 -253 4.8375 0.0585
NP_440567.1_1 Reverse -240 -254 9.04604 0.0501
NP_440567.1_1 Forward -247 -233 6.3911 0.0837
NP_440567.1_1 Reverse -341 -355 4.81781 0.111
NP_440567.1_1 Forward -354 -340 2.85119 0.16
NP_440567.1_1 Reverse -159 -173 1.08123 0.219
NP_440567.1_1 Forward -348 -334 -0.492064 0.287
NP_442497.1_10 Forward -247 -238 17.601 0.00813
NP_442497.1_10 Reverse -240 -249 10.4228 0.0087
NP_442497.1_10 Reverse -341 -350 0.589713 0.153
NP_442497.1_10 Forward -348 -339 -1.18024 0.256
NP_440821.1_4 Forward -250 -240 18.7612 0.00422
NP_440821.1_4 Reverse -237 -247 11.0914 0.0146
NP_440821.1_4 Forward -351 -341 -0.314959 0.251
NP_441239.1_9 Forward -250 -238 16.0669 0.0175
NP_441239.1_9 Reverse -237 -249 14.6903 0.0258
NP_441239.1_9 Reverse -338 -350 9.57708 0.102
NP_441239.1_9 Reverse -377 -389 6.82381 0.175
NP_441239.1_9 Forward -169 -157 5.93884 0.202
NP_441239.1_9 Reverse -285 -297 2.98891 0.3
NP_442627.1_5 Forward -201 -182 17.0099 0.188
NP_441892.1_1 Forward -358 -341 -2.12444 0.218
NP_442105.1_9 Forward -85 -71 14.0605 0.294
NP_442270.1_9 Forward -366 -347 -1.67217 0.162
NP_440219.1_1 Reverse -198 -217 12.173 0.3
NP_442629.1_3 Forward -346 -327 -0.39387 0.294
NP_441874.1_1 Forward -359 -345 11.111 0.249
NP_442083.1_10 Forward -236 -217 9.0459 0.113
NP_440833.1_6 Reverse -28 -42 8.06211 0.277
NP_442216.1_4 Forward -90 -82 8.08217 0.255
NP_440876.1_5 Reverse -241 -260 5.50599 0.283
NP_442138.1_9 Forward -173 -154 7.96345 0.281
NP_442809.1_6 Forward -172 -153 1.17943 0.276
NP_440546.1_4 Forward -349 -339 15.6695 0.0459
NP_440546.1_4 Forward -248 -238 13.5365 0.0459
NP_440546.1_4 Reverse -239 -249 11.8882 0.0679
NP_441230.1_5 Reverse -335 -354 12.2908 0.0748
NP_441230.1_5 Forward -253 -234 4.42435 0.188
NP_440675.1_1 Forward -365 -346 4.03102 0.245
NP_440675.1_3 Reverse -239 -258 10.2259 0.186
NP_440462.1_6 Forward -250 -240 17.9746 0.00578
NP_440462.1_6 Reverse -237 -247 16.893 0.00853
NP_440462.1_6 Reverse -338 -348 6.56821 0.109
NP_442465.1_2 Reverse -247 -266 0.883656 0.259
NP_442340.1_3 Forward -312 -293 1.67108 0.144
NP_442611.1_1 Forward -184 -165 2.55606 0.216
NP_440868.1_4 Reverse -235 -247 15.1819 0.0164
NP_440868.1_4 Forward -252 -240 9.77374 0.043
NP_440868.1_4 Forward -353 -341 6.1355 0.0878
NP_442787.1_9 Reverse -77 -96 11.9958 0.296
NP_442402.1_9 Reverse -153 -172 11.8975 0.233
NP_442402.1_10 Reverse -323 -333 12.6642 0.204
NP_441084.1_6 Reverse -237 -251 12.1559 0.169
NP_440696.1_3 Forward -372 -354 1.00246 0.223
NP_440696.1_3 Reverse -167 -185 -3.91409 0.293
NP_442039.1_4 Forward -247 -240 15.1821 0.0124
NP_442039.1_4 Reverse -240 -247 15.1821 0.0124
NP_442039.1_4 Forward -348 -341 11.6422 0.0747
NP_442039.1_7 Forward -153 -143 12.8614 0.214
NP_441811.1_8 Forward -355 -341 7.27608 0.251
NP_441811.1_8 Reverse -179 -193 6.09611 0.287
NP_441926.1_3 Forward -349 -333 2.61514 0.263
NP_440825.1_7 Reverse -341 -351 10.9578 0.278
NP_442837.1_3 Forward -247 -240 15.7721 0.0124
NP_442837.1_3 Reverse -240 -247 15.7721 0.0124
NP_442837.1_3 Forward -348 -341 6.0373 0.25
NP_442837.1_3 Reverse -341 -348 6.0373 0.25
NP_442053.1_1 Forward -248 -239 18.3876 0.0007
NP_442053.1_1 Reverse -239 -248 18.3876 0.0007
NP_442053.1_1 Reverse -340 -349 14.4544 0.0114
NP_442053.1_1 Forward -349 -340 7.86621 0.0863
NP_442053.1_1 Forward -355 -346 4.52295 0.242
NP_440505.1_3 Reverse -237 -247 15.123 0.014
NP_440505.1_3 Forward -250 -240 14.1397 0.0235
NP_440505.1_3 Forward -351 -341 7.64985 0.151
NP_441203.1_1 Forward -247 -228 -12.3902 0.143
NP_442532.1_7 Reverse -239 -253 4.62115 0.171
NP_440914.1_1 Forward -248 -238 16.3248 0.00196
NP_440914.1_1 Reverse -340 -350 13.1043 0.0386
NP_440914.1_1 Forward -349 -339 10.8597 0.118
NP_440914.1_1 Reverse -239 -249 8.6151 0.186
NP_441011.1_8 Reverse -240 -249 16.9127 0.00602
NP_441011.1_8 Forward -247 -238 16.6177 0.00602
NP_441011.1_8 Forward -348 -339 11.5045 0.0778
NP_441011.1_8 Forward -394 -385 9.04618 0.141
NP_442533.1_1 Forward -398 -379 -3.73712 0.14
NP_442533.1_1 Forward -388 -369 -14.7502 0.247
NP_442533.1_1 Forward -386 -367 -16.6185 0.273
NP_442533.1_1 Forward -390 -371 -16.7168 0.275
NP_442533.1_6 Forward -248 -239 17.2076 0.00137
NP_442533.1_6 Reverse -239 -248 17.2076 0.00137
NP_442533.1_6 Reverse -164 -173 4.52295 0.179
NP_442533.1_6 Reverse -340 -349 4.42462 0.179
NP_442533.1_6 Reverse -163 -172 1.76968 0.289
NP_442322.1_4 Reverse -371 -388 -6.94332 0.278
NP_441482.1_7 Reverse -233 -247 -1.67204 0.0787
NP_439944.1_9 Forward -247 -237 17.6796 0.00347
NP_439944.1_9 Reverse -240 -250 10.4031 0.0887
NP_439944.1_9 Forward -354 -344 5.09324 0.277
NP_442269.1_2 Forward -160 -141 17.0107 0.0998
NP_440816.1_2 Forward -217 -198 6.82221 0.27
NP_440115.1_6 Forward -352 -342 8.33817 0.13
NP_440115.1_6 Reverse -236 -246 7.45319 0.147
NP_440007.1_9 Forward -359 -345 3.44117 0.269
NP_440007.1_9 Reverse -235 -249 0.589577 0.294
NP_439965.1_1 Reverse -230 -249 -6.1954 0.211
NP_443045.1_5 Forward -373 -360 17.1668 0.119
NP_441602.1_3 Reverse -165 -184 -3.54046 0.249
NP_441170.1_4 Reverse -154 -172 2.0841 0.289
NP_441972.1_5 Reverse -288 -307 0.982764 0.143
NP_441106.1_1 Reverse -238 -247 18.486 0.0028
NP_441106.1_1 Forward -249 -240 18.191 0.0028
NP_439903.1_6 Reverse -337 -356 5.99684 0.173
NP_442306.1_10 Reverse -234 -253 -1.08219 0.0484
NP_441286.1_1 Reverse -238 -250 5.34885 0.0259
NP_441286.1_1 Forward -249 -237 4.8572 0.0272
NP_441286.1_1 Forward -356 -344 1.12062 0.0972
NP_441286.1_1 Forward -350 -338 -4.48425 0.161
NP_440670.1_8 Forward -248 -239 18.3876 0.000699
NP_440670.1_8 Reverse -239 -248 18.3876 0.000699
NP_440670.1_8 Forward -349 -340 8.75118 0.0606
NP_440670.1_8 Reverse -340 -349 6.19458 0.124
NP_440886.1_7 Forward -249 -239 17.7774 0.0011
NP_440886.1_7 Reverse -238 -248 8.04271 0.0805
NP_440886.1_7 Reverse -339 -349 6.76441 0.114
NP_440886.1_7 Reverse -385 -395 6.56775 0.118
NP_440886.1_7 Reverse -378 -388 4.01116 0.255
NP_442614.1_2 Forward -248 -234 10.3243 0.234
NP_442072.1_9 Reverse -238 -256 -12.1739 0.0823
NP_442072.1_9 Forward -350 -332 -22.1053 0.22
NP_442072.1_9 Reverse -163 -181 -22.6953 0.253
NP_441753.1_10 Forward -257 -238 5.50599 0.186
NP_440907.2_8 Reverse -240 -250 17.4824 0.00685
NP_440907.2_8 Forward -247 -237 9.51767 0.103
NP_440907.2_8 Reverse -341 -351 5.87944 0.184
NP_440907.2_8 Reverse -373 -383 4.30615 0.269
NP_442264.1_2 Reverse -229 -246 4.56207 0.298
NP_441021.1_1 Reverse -341 -360 -6.68705 0.18
NP_441021.1_1 Reverse -240 -259 -10.522 0.24
NP_441463.1_3 Forward -258 -239 9.0459 0.0481
NP_441463.1_3 Reverse -229 -248 -1.18052 0.137
NP_441463.1_3 Reverse -342 -361 -6.98204 0.253
NP_441463.1_6 Reverse -237 -251 7.86544 0.25
NP_441626.1_2 Forward -247 -240 15.7721 0.0124
NP_441626.1_2 Reverse -240 -247 15.7721 0.0124
NP_441626.1_2 Forward -348 -341 12.2322 0.0511
NP_441626.1_2 Reverse -341 -348 5.93897 0.231
NP_442365.1_7 Reverse -235 -254 -2.75381 0.204
NP_442794.1_1 Forward -353 -341 2.69391 0.286
NP_442615.1_1 Reverse -230 -248 6.80398 0.0338
NP_442615.1_1 Forward -364 -346 -0.964162 0.123
NP_441962.1_4 Forward -322 -303 -14.7502 0.293
NP_440387.1_1 Reverse -239 -255 8.02334 0.0282
NP_440387.1_1 Forward -248 -232 -3.48138 0.16
NP_440387.1_1 Reverse -164 -180 -5.05468 0.212
NP_440387.1_1 Reverse -340 -356 -5.34967 0.227
NP_441431.1_2 Forward -170 -156 12.6836 0.11
NP_441431.1_2 Forward -251 -237 9.14375 0.192
NP_441431.1_2 Reverse -337 -351 7.17714 0.247
NP_441431.1_3 Forward -379 -360 6.98095 0.249
NP_441431.1_7 Forward -347 -328 15.2212 0.248
NP_441488.1_8 Forward -354 -340 19.8618 0.0247
NP_442647.1_7 Reverse -381 -394 13.3923 0.214
NP_441993.1_1 Forward -355 -336 9.25599 0.136
NP_441993.1_1 Forward -386 -367 4.87041 0.211
NP_441174.1_2 Reverse -236 -250 20.8458 0.00244
NP_440358.1_8 Reverse -222 -241 0.491109 0.263
NP_440814.1_8 Forward -23 -4 0.687771 0.269
NP_440114.1_10 Forward -349 -335 16.2242 0.0194
NP_440114.1_10 Reverse -239 -253 15.0442 0.0308
NP_440114.1_10 Forward -248 -234 7.86607 0.223
NP_441510.2_7 Reverse -347 -361 9.43874 0.281
NP_440287.1_6 Reverse -237 -256 0.0977854 0.298
NP_441272.1_4 Forward -358 -339 0.392778 0.258
NP_440293.1_10 Forward -364 -345 1.27776 0.219
NP_440766.1_4 Reverse -235 -249 6.6861 0.0991
NP_440766.1_4 Forward -353 -339 3.24451 0.151
NP_440422.1_10 Reverse -257 -276 7.59671 0.225
NP_441237.1_9 Reverse -347 -357 11.2881 0.189
NP_439910.1_2 Forward -256 -239 -11.6625 0.0788
NP_439910.1_2 Reverse -231 -248 -12.7442 0.0944
NP_439910.1_2 Reverse -332 -349 -22.6756 0.285
NP_440457.1_1 Forward -353 -341 2.39892 0.212
NP_440457.1_1 Reverse -235 -247 1.31728 0.241
NP_442940.1_2 Reverse -374 -393 -0.197208 0.296
NP_440798.1_6 Forward -348 -335 2.67422 0.166
NP_440798.1_6 Reverse -240 -253 2.47756 0.17
NP_441801.1_4 Forward -89 -79 21.9078 0.117
NP_442680.1_5 Forward -271 -252 1.24451 0.248
NP_441332.1_6 Reverse -169 -179 12.6149 0.221
NP_440473.1_9 Forward -259 -240 -1.37718 0.144
NP_442509.1_5 Reverse -372 -389 17.836 0.151
NP_442509.1_9 Reverse -239 -249 16.2041 0.00739
NP_442509.1_9 Forward -248 -238 8.04271 0.192
NP_440554.1_4 Forward -247 -237 16.1063 0.0189
NP_440554.1_4 Reverse -240 -250 13.943 0.0218
NP_440554.1_4 Reverse -387 -397 4.0116 0.205
NP_441885.1_5 Reverse -239 -249 11.4848 0.00668
NP_441885.1_5 Forward -248 -238 11.3864 0.00668
NP_441885.1_5 Reverse -340 -350 1.25834 0.11
NP_441885.1_5 Forward -349 -339 -0.0199663 0.186
NP_442341.1_7 Forward -249 -235 4.81781 0.177
NP_442341.1_7 Reverse -352 -366 3.93283 0.208
NP_442341.1_7 Reverse -238 -252 3.8345 0.21
NP_442341.1_7 Forward -363 -349 2.45787 0.256
NP_442341.1_9 Reverse -338 -352 11.4053 0.127
NP_442341.1_9 Forward -250 -236 8.06211 0.179
NP_442341.1_9 Forward -351 -337 7.07881 0.204
NP_441756.1_5 Reverse -368 -387 -3.83545 0.29
NP_440750.1_5 Forward -264 -250 5.21113 0.294
NP_440423.1_6 Forward -389 -370 -10.817 0.162
NP_440423.1_6 Forward -388 -369 -20.0601 0.251
NP_443000.1_7 Reverse -237 -247 17.4829 0.00719
NP_443000.1_7 Forward -250 -240 2.04498 0.226
NP_443000.1_7 Forward -351 -341 0.57002 0.294
NP_441842.1_1 Reverse -342 -355 12.9 0.18
NP_441842.1_3 Forward -346 -328 13.6872 0.276
NP_441842.1_10 Forward -356 -342 10.226 0.167
NP_441842.1_10 Forward -255 -241 7.76774 0.245
NP_440275.1_3 Forward -250 -240 17.9746 0.0082
NP_440275.1_3 Reverse -237 -247 9.12481 0.055
NP_440275.1_3 Forward -351 -341 5.48657 0.145
NP_440091.1_1 Forward -252 -240 20.1968 0.00953
NP_443010.1_10 Forward -251 -234 6.15298 0.192
NP_442451.1_2 Reverse -366 -385 -8.06369 0.241
NP_441207.1_4 Reverse -64 -83 6.4893 0.209
NP_439962.1_4 Reverse -162 -181 -0.0988766 0.197
NP_441105.1_3 Forward -360 -341 5.70265 0.0662
NP_441105.1_3 Forward -366 -347 -6.29373 0.232
NP_441105.1_3 Reverse -228 -247 -6.98204 0.243
NP_440216.1_1 Reverse -239 -253 6.29277 0.0156
NP_440216.1_1 Forward -248 -234 -2.45868 0.0513
NP_440216.1_1 Forward -349 -335 -3.54032 0.0833
NP_440216.1_9 Forward -241 -232 8.45619 0.286
NP_440172.1_1 Forward -248 -238 17.5813 0.00421
NP_440172.1_1 Forward -349 -339 8.82982 0.0586
NP_440172.1_1 Reverse -239 -249 8.73149 0.0586
NP_440172.1_1 Forward -355 -345 3.71661 0.219
NP_440172.1_1 Reverse -340 -350 2.24165 0.279
NP_442015.1_10 Reverse -307 -320 1.69091 0.204
NP_442015.1_10 Reverse -235 -248 1.39592 0.204
NP_442015.1_10 Forward -353 -340 1.00259 0.216
NP_442015.1_10 Reverse -342 -355 -0.177378 0.255
NP_441045.1_6 Reverse -342 -360 14.6697 0.295
NP_441226.1_7 Forward -247 -240 14.4934 0.0123
NP_441226.1_7 Reverse -240 -247 14.4934 0.0123
NP_441226.1_7 Forward -348 -341 12.7234 0.0312
NP_441226.1_7 Reverse -341 -348 11.5435 0.0757
NP_441226.1_7 Reverse -347 -354 11.2485 0.0971
NP_441111.1_7 Forward -247 -239 18.7023 0.00294
NP_441111.1_7 Reverse -240 -248 18.7023 0.00294
NP_441111.1_7 Reverse -341 -349 8.86921 0.0589
NP_441111.1_7 Reverse -347 -355 -0.570565 0.233
NP_442379.1_10 Forward -255 -238 4.6604 0.141
NP_441766.1_2 Forward -248 -239 17.5026 0.00297
NP_441766.1_2 Reverse -239 -248 17.5026 0.00297
NP_441766.1_2 Reverse -340 -349 14.7494 0.00772
NP_441766.1_2 Reverse -386 -395 5.50626 0.116
NP_440416.1_1 Reverse -239 -258 -5.40875 0.154
NP_440416.1_1 Forward -349 -330 -13.6686 0.281
NP_440416.1_9 Reverse -379 -398 -18.7818 0.264
NP_443052.1_8 Forward -258 -239 12.0942 0.0129
NP_442403.1_8 Forward -197 -178 -2.0655 0.263
NP_440591.1_9 Forward -380 -362 7.88563 0.193
NP_442154.1_1 Forward -363 -345 -5.88071 0.127
NP_442154.1_1 Forward -387 -369 -7.35568 0.141
NP_442154.1_1 Reverse -240 -258 -15.5171 0.22
NP_440261.1_5 Forward -247 -234 6.4108 0.0368
NP_440261.1_5 Reverse -240 -253 -10.6005 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGCACAGTGATCGGGGAGGGGGGCTCCGGGGGTGCATTGGGTATTGGCGTTGGCGATCGGGTATTGATGCTGGAAAATGCGGTGTACACCGTGGCTACTCCAGAGGCCTGTGCGGCTATTCTTTGGAAGGATGCGAAAAAGTCCGACAAAGCGGCGATCGCCTTGAAAATTACCGCCGATGATTTAGCGAAGTTACAAATCATTGATGGGATTATTCCCGAGCCGAAGGGGGCCGCCCACGCCAATCCATTGGGAGCCGCTGCTAAGTTGAAGGAAGCTTTATTGTTCCATCTCAATACCTTGGCTCAATTAACTCCCCAGGAACGCAAACAATTGCGGTACGACAAATTCCGGCATTTGGGTCAATTTTTAGAAACGGCGGTGTAAGACGAATAGAACT

CDS

ATGGAGGAAACCGGGGAAATAAATAAATCAGCAAATTCTGCGCCCAAAGGGGACCAAGTTAAAAGTCCTCTCCGTTATCCCGGCGGAAAATCCAAAGCCCTGAGACAAATTTTGCCCCATGTTCCTACTCAAATCAAAGAGTATCGGGAACCTTTTATCGGTGGAGGCTCTGTCTTTTTAGCCATCAAGCAAATTTTTGGTCAGCACATTAATAAGTATTGGATTAACGACTTAAATTTTGATTTATATTGTTTCTGGAAATACGCCCAGGAGGAAATTGAACGGCTAACTGATGCAGTCACAGTAATTAAACAACACCAAACCGACGGGAGAGAACTTTTTGCCAACTTAACAAAAGAAGGGTTAGAGTTGGACGAATTCCAGCGGGCAGTGCGTTTTTTTGTGCTGAATCGCATTACTTTTTCTGGCACGGTGGAATCTGGAGGCTATTCTCAACAGGCGTTTGAAAAACGTTTTACCGATTCTTCCATTGATAGATTAAAAACTCTGGGAACAATGTTAGCTAATACGACTGTTACCAATGGGGATTATCAACAATTAATTGAACAGCCAGGAGAGAACGTGTTTATTTTTCTTGATCCTCCCTATCTGAGCGCGACTAAATCGAAACTCTATGGTAAAAAGGGGGATTTACACACTTCTTTTGGTCATCAAAGATTTGCTGAAGTGATGGAAAATTGTTCTCATAAATGGCTGATTACCTATGATGATTCCGAGGAAATCAGAAAATTATTTAGTTTTGCCCAGATTATTGAATGGGATTTACAATATGGGATGAACAATTACAAACAAGACAAAGCTTCCAAAGGTAAAGAGTTAATGATCAAAAATTATTAA

Protein

MEETGEINKSANSAPKGDQVKSPLRYPGGKSKALRQILPHVPTQIKEYREPFIGGGSVFLAIKQIFGQHINKYWINDLNFDLYCFWKYAQEEIERLTDAVTVIKQHQTDGRELFANLTKEGLELDEFQRAVRFFVLNRITFSGTVESGGYSQQAFEKRFTDSSIDRLKTLGTMLANTTVTNGDYQQLIEQPGENVFIFLDPPYLSATKSKLYGKKGDLHTSFGHQRFAEVMENCSHKWLITYDDSEEIRKLFSFAQIIEWDLQYGMNNYKQDKASKGKELMIKNY