Your browser is old and dusty. Try Google Chrome!

Details for sll0709

ORF sll0709
Accession NP_439987.1
Symbol
Category putative endonuclease
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Forward -60 -41 -0.295539 0.269
NP_441623.1_1 Forward -378 -360 -2.83245 0.248
NP_442173.1_1 Forward -87 -79 7.59091 0.163
NP_442975.1_10 Reverse -130 -144 3.8339 0.252
NP_441995.1_8 Forward -144 -127 21.6717 0.0337
NP_441859.1_3 Forward -89 -70 3.04693 0.25
NP_440365.1_1 Reverse -95 -114 12.0793 0.29
NP_441149.1_7 Reverse -69 -88 4.22769 0.267
NP_441149.1_9 Reverse -288 -307 14.3549 0.0962
NP_442570.1_3 Reverse -366 -385 -8.85033 0.294
NP_441716.1_2 Reverse -46 -65 -0.759618 0.277
NP_441327.1_1 Reverse -316 -335 2.29119 0.298
NP_442687.1_7 Forward -68 -58 10.3048 0.0994
NP_442687.1_7 Reverse -278 -288 4.89658 0.23
NP_441077.1_6 Forward -126 -110 8.29706 0.209
NP_440571.1_5 Reverse -315 -334 21.2389 0.198
NP_442544.1_2 Reverse -383 -397 9.63603 0.089
NP_440318.1_1 Forward -85 -66 9.0459 0.162
NP_440995.1_8 Forward -247 -228 0.196116 0.284
NP_439990.1_8 Reverse -138 -157 -0.983855 0.283
NP_442690.1_1 Forward -336 -317 -7.4737 0.175
NP_442690.1_1 Forward -64 -45 -10.0303 0.209
NP_442911.1_2 Reverse -326 -345 -7.86702 0.221
NP_440993.1_3 Forward -95 -76 -2.36125 0.299
NP_442002.1_9 Forward -384 -377 12.2322 0.185
NP_441654.1_5 Reverse -317 -336 17.1488 0.203
NP_440345.1_3 Reverse -119 -133 10.3247 0.285
NP_441547.1_2 Forward -242 -224 9.75391 0.193
NP_439966.1_9 Forward -81 -72 6.29291 0.253
NP_442941.1_3 Forward -142 -132 5.38824 0.115
NP_440260.1_8 Reverse -381 -399 -5.88071 0.279
NP_441678.1_9 Reverse -358 -377 -5.40875 0.297
NP_442281.1_1 Reverse -74 -88 4.32555 0.199
NP_440375.1_9 Forward -196 -177 14.9314 0.271
NP_442313.1_3 Reverse -358 -377 6.78429 0.256
NP_441758.1_10 Forward -113 -94 -2.65624 0.293
NP_441020.2_6 Reverse -77 -94 6.43035 0.262
NP_441612.1_2 Forward -385 -375 7.19391 0.26
NP_442808.1_1 Forward -288 -278 2.63453 0.26
NP_440385.1_8 Forward -116 -97 13.6072 0.198
NP_440558.1_2 Forward -387 -368 -5.01543 0.251
NP_440558.1_2 Forward -82 -63 -5.40875 0.258
NP_441308.1_8 Reverse -132 -142 9.02648 0.236
NP_441458.1_8 Reverse -105 -124 7.00151 0.233
NP_441458.1_8 Reverse -102 -121 4.11821 0.267
NP_441458.1_8 Forward -169 -150 1.81158 0.295
NP_441866.1_4 Reverse -319 -332 13.9257 0.273
NP_442993.1_1 Reverse -279 -295 -9.47957 0.186
NP_441750.1_1 Forward -398 -379 -8.85033 0.3
NP_442240.1_2 Forward -206 -187 -6.39206 0.116
NP_440027.1_8 Reverse -381 -400 4.03023 0.294
NP_439977.1_5 Forward -79 -60 0.982764 0.197
NP_442493.1_6 Reverse -314 -332 14.7688 0.261
NP_442114.1_8 Reverse -141 -155 4.91554 0.246
NP_442262.1_10 Forward -87 -80 7.90559 0.266
NP_442262.1_10 Forward -218 -211 7.21728 0.281
NP_440999.1_9 Reverse -75 -89 -2.45868 0.27
NP_440888.1_2 Forward -400 -386 10.422 0.0946
NP_441543.1_2 Reverse -67 -76 7.37455 0.127
NP_442966.1_7 Reverse -316 -333 15.385 0.242
NP_440673.1_2 Forward -83 -64 11.17 0.186
NP_441052.1_2 Reverse -66 -76 1.06167 0.252
NP_441733.1_10 Reverse -76 -89 5.23083 0.223
NP_441004.1_1 Forward -313 -294 -9.73531 0.211
NP_439949.1_10 Forward -338 -319 18.5069 0.106
NP_443054.1_2 Forward -289 -275 2.16287 0.245
NP_442843.1_1 Forward -96 -77 -6.1954 0.244
NP_440474.1_8 Reverse -71 -85 7.17714 0.207
NP_441432.1_9 Forward -164 -151 9.08315 0.282
NP_439900.1_4 Reverse -287 -301 20.9434 0.131
NP_440847.1_8 Reverse -364 -383 11.7008 0.281
NP_441047.1_2 Forward -399 -380 -1.18052 0.267
NP_440594.1_5 Forward -259 -240 5.01354 0.293
NP_440219.1_1 Reverse -316 -335 14.2738 0.216
NP_442629.1_3 Forward -83 -64 16.8141 0.0751
NP_441537.1_4 Forward -338 -319 22.6789 0.069
NP_442465.1_9 Reverse -47 -61 13.9626 0.208
NP_441249.1_8 Forward -190 -171 6.39097 0.247
NP_441848.1_4 Forward -123 -107 9.556 0.277
NP_440160.1_2 Forward -384 -365 7.66927 0.167
NP_440160.1_2 Forward -385 -366 -8.65367 0.286
NP_441959.1_8 Forward -113 -100 8.42007 0.295
NP_442533.1_6 Reverse -391 -400 2.26134 0.266
NP_442322.1_4 Reverse -383 -400 -9.7949 0.297
NP_442269.1_10 Reverse -199 -218 3.53937 0.248
NP_440816.1_2 Forward -130 -111 8.37121 0.246
NP_441527.1_4 Reverse -40 -59 -6.44613 0.218
NP_440115.1_6 Forward -386 -376 5.38824 0.25
NP_441059.1_2 Forward -383 -364 -6.09707 0.265
NP_442928.1_3 Forward -386 -367 12.3233 0.265
NP_440326.1_9 Forward -107 -88 13.2733 0.274
NP_442365.1_7 Reverse -66 -85 -0.295539 0.177
NP_442794.1_1 Forward -77 -65 2.30059 0.296
NP_441962.1_4 Reverse -65 -84 1.76941 0.103
NP_440387.1_3 Forward -398 -384 16.2242 0.228
NP_440855.1_5 Reverse -291 -310 2.75194 0.288
NP_441431.1_1 Reverse -318 -336 4.29912 0.265
NP_440143.1_1 Forward -387 -368 13.9625 0.265
NP_441858.1_2 Forward -106 -87 11.9854 0.249
NP_440287.1_5 Reverse -278 -297 10.6184 0.286
NP_442635.1_1 Forward -124 -105 16.4067 0.219
NP_442930.1_1 Forward -114 -104 12.0743 0.242
NP_440213.1_5 Forward -66 -47 13.1758 0.19
NP_440142.1_7 Forward -398 -379 6.29264 0.26
NP_442862.1_3 Reverse -353 -370 5.54538 0.271
NP_442341.1_7 Forward -255 -241 3.73617 0.214
NP_442395.2_4 Forward -384 -365 -0.00131823 0.28
NP_442015.1_10 Forward -147 -134 -1.06236 0.293
NP_441485.1_9 Reverse -373 -392 18.0924 0.217
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AGGCACTGCCAGAGGGGGGCAAACCAAGTGCCAAGTTCTGAAAGTCTTACGATTAGGCACTTTCAATAATTAATCCTAAAATATCTCTCTTGGTTTGACGGAAGAGGGATACAGCGGATACCCTATTAGTTAGGCACATATAAAATGCCTGTAACCACTGTTTTACAATGACTTTGGTATACCAGATGGAAAGCATGACCGCTGTAGGTTGATTATAGATTTGAAGGGTGGTTAATAACTACCCATTTTTTGTTGTGTGGGATAACCTTTTTAGATATAATATGAATAATTATTCACTAATACTGACATTTCGCAGATTGCTGCTATTGATAGCGCAATAGTTTTTGCTTATACTGTGTTTACTGCGCATTTATTTATACTGCTACGCTCCATATAGCGT

CDS

GTGCGGAATGTGAGTAATATTATATTAAGTAAGTGGCTCAAAACGGATCTACAAAAGCAACAACCATACGAAACTATGGAAGATTTTGAATCTCTTAAGCGGAGAGATTTTATAGCTAAAACCAATAAAGAGTTTGAACGTTTAAGATGGAGGCAATCAGAGCAGTACAACTATATTCGCAAGACTTACGGGCAAATAGTCCGCGATAAACTTACTGATGAACAGTTATTAGATTTACTTGATCGCTTGCAGCATCAAGGCAATGATAAAAGCAAAGGTCATTACAAAGTTATGAATAGTCCAATTCAAAAAATATTTTTCGGTTGTCCTGGTACTGGCAAAAGCCATAAGATTTCTAATGATGATGATGGTGGAATTGTTAAACAAGTTTTAGGTATTGATAAAAATATTCATCCTGAAAATTTAATTAAGACTGTTTTTCATCCCGAATACACCTATGGCGATTTTATGGGAAAATTAATGCCAATGACTATGAATGATGATAAAGATAAGAGTGTTTATTATCAATTTTATGAAGGACATTTTTTGAAGGCACTAGCACAAGCGTATAAAAATATTATCATTGCTCAGAAGGAAGGTGTACAAGCTCAAAACGTTGCCTTAGTAATTGATGAAATTAATCGAGGTAATTCTTCTGCAATTTTTGGGACAGTTTTTCAACTTTTAGATCGAGGTCGAGATGGTTGGTCAGCTTATGGTATTAATATTTCCGATTTAGAATTTAGAAAAATGGTTGAACTAATAGGCTTTCAACAAACGGGAATAGATGATGGTAATCCTACATACAAATATCAAAATAAAGGTTCGTCTAACGTGCTAGAAAAATTTACTGTATTTGAGGAAATTAAAATTAAAGTAAAAGTTAATACAGCAGTAGGTAGTTCAATTCGTATTCCTTACAATCTTTCCATTTTTGGAACAATGAATACTTCTGATAATTCTATATATTTTATGGATAATGCCTTTAAAAGACGTTGGGAGTGGGAATACGTAGATTGGAAACAAGATAATGATCAAGAAATAAATAATGTTATTTTAATAGATTATGGAAATGTTAATTTAAAGTGGACAGATTTAGTAGAAAAATTTAACAACTTCATTAAAGATAATCATAATTCTGTGAGAAGTGGCAGAATAGAAGATATGCAAATAGGCTATCATTTCATAAATACAGCAATAGTTACAGAAGATCAAATAAAAAATAAATTGATGTTTTTTGTTTGGGATAGTGTTTTTAACCGAGACAAAAATCCACTTCGAGAACTTTTAGGATTTAACAAAAATGATAAAAAATTAGTAACTTTTGGAGACTTTATTACACATCATGAAGCTTTTGTAATGAATCTCATAAATTATCAATCAAAATAA

Protein

MRNVSNIILSKWLKTDLQKQQPYETMEDFESLKRRDFIAKTNKEFERLRWRQSEQYNYIRKTYGQIVRDKLTDEQLLDLLDRLQHQGNDKSKGHYKVMNSPIQKIFFGCPGTGKSHKISNDDDGGIVKQVLGIDKNIHPENLIKTVFHPEYTYGDFMGKLMPMTMNDDKDKSVYYQFYEGHFLKALAQAYKNIIIAQKEGVQAQNVALVIDEINRGNSSAIFGTVFQLLDRGRDGWSAYGINISDLEFRKMVELIGFQQTGIDDGNPTYKYQNKGSSNVLEKFTVFEEIKIKVKVNTAVGSSIRIPYNLSIFGTMNTSDNSIYFMDNAFKRRWEWEYVDWKQDNDQEINNVILIDYGNVNLKWTDLVEKFNNFIKDNHNSVRSGRIEDMQIGYHFINTAIVTEDQIKNKLMFFVWDSVFNRDKNPLRELLGFNKNDKKLVTFGDFITHHEAFVMNLINYQSK