Your browser is old and dusty. Try Google Chrome!

Details for sll0459

ORF sll0459
Accession NP_442239.1
Symbol uvrB
Category excinuclease ABC subunit B
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Forward -233 -214 -29.2048 0.219
NP_441418.1_6 Forward -368 -349 -29.4998 0.228
NP_441418.1_6 Forward -276 -257 -30.4831 0.28
NP_441480.1_10 Reverse -306 -325 9.63589 0.207
NP_441453.1_7 Forward -361 -354 11.6422 0.298
NP_442877.1_3 Reverse -204 -223 10.52 0.25
NP_441818.1_9 Forward -233 -214 0.982764 0.191
NP_441818.1_9 Forward -257 -238 0.392778 0.191
NP_441818.1_9 Forward -242 -223 -8.45701 0.277
NP_441818.1_9 Forward -227 -208 -10.0303 0.292
NP_441225.1_1 Forward -246 -227 -9.44032 0.296
NP_440110.1_8 Forward -370 -351 -1.7705 0.25
NP_440761.1_4 Forward -373 -354 -2.95047 0.132
NP_440761.1_4 Forward -262 -243 -14.7502 0.271
NP_440304.1_4 Forward -278 -268 4.60159 0.258
NP_439918.1_2 Forward -239 -220 -3.44213 0.254
NP_439918.1_2 Forward -257 -238 -4.91709 0.291
NP_441082.1_10 Forward -361 -348 16.4406 0.154
NP_441082.1_10 Forward -232 -219 7.88576 0.293
NP_440300.1_5 Forward -172 -154 13.1799 0.271
NP_441925.1_4 Reverse -205 -224 -6.29447 0.185
NP_441925.1_4 Reverse -206 -225 -6.58946 0.185
NP_441925.1_4 Reverse -208 -227 -10.916 0.243
NP_442827.1_4 Reverse -238 -257 10.9134 0.149
NP_442889.1_1 Forward -374 -355 -11.6036 0.218
NP_442889.1_1 Forward -326 -307 -14.2585 0.272
NP_440410.1_10 Reverse -240 -259 1.96607 0.296
NP_442570.1_3 Forward -370 -351 -5.99873 0.253
NP_442111.1_4 Reverse -254 -268 5.1128 0.176
NP_440343.1_9 Forward -231 -212 11.2092 0.225
NP_442634.1_4 Forward -244 -230 -4.13031 0.184
NP_441014.1_8 Reverse -226 -245 -1.57384 0.224
NP_441014.1_8 Forward -76 -57 -9.44032 0.295
NP_441014.1_10 Forward -249 -230 0.686995 0.239
NP_442848.1_5 Reverse -241 -259 3.65739 0.276
NP_441012.1_4 Reverse -263 -276 8.08242 0.272
NP_443018.1_3 Reverse -378 -385 6.62729 0.168
NP_441634.1_8 Reverse -357 -371 -3.44199 0.295
NP_441634.1_8 Forward -65 -51 -4.13031 0.295
NP_441182.1_10 Reverse -263 -282 19.469 0.199
NP_440376.1_1 Forward -356 -347 2.16301 0.233
NP_440376.1_1 Forward -221 -212 0.983037 0.258
NP_440580.1_1 Forward -259 -240 9.0459 0.189
NP_440571.1_5 Reverse -153 -172 13.2741 0.248
NP_441422.1_7 Reverse -375 -392 -7.63097 0.26
NP_440667.1_2 Forward -245 -226 -3.44213 0.232
NP_440667.1_2 Forward -311 -292 -7.4737 0.275
NP_441950.1_7 Forward -230 -211 -6.09707 0.243
NP_441950.1_7 Reverse -113 -132 -6.39206 0.251
NP_442782.1_2 Forward -257 -243 1.17956 0.282
NP_442782.1_2 Forward -227 -213 -0.000409212 0.297
NP_440651.1_10 Reverse -309 -323 18.5835 0.271
NP_440203.1_2 Forward -231 -212 12.6841 0.295
NP_440984.1_7 Reverse -49 -63 4.81781 0.287
NP_440153.1_5 Forward -220 -206 2.75286 0.219
NP_440993.1_4 Reverse -353 -370 2.49712 0.3
NP_440138.1_1 Reverse -281 -299 10.1465 0.197
NP_441099.1_3 Forward -251 -232 -3.24547 0.299
NP_441294.1_7 Reverse -208 -222 9.15464 0.256
NP_440411.1_10 Forward -370 -351 14.8485 0.194
NP_441646.1_1 Forward -228 -209 2.16274 0.221
NP_442771.1_1 Reverse -265 -283 -8.73231 0.204
NP_441916.1_7 Reverse -373 -383 3.12662 0.227
NP_441916.1_7 Forward -276 -266 1.06167 0.294
NP_441916.1_10 Reverse -210 -229 4.03102 0.224
NP_441916.1_10 Reverse -351 -370 0.687771 0.278
NP_440569.1_6 Forward -371 -352 6.58763 0.228
NP_441725.1_4 Reverse -152 -166 2.16228 0.291
NP_441725.1_5 Reverse -268 -278 -0.806614 0.271
NP_440983.1_5 Reverse -212 -231 -0.787193 0.228
NP_440983.1_5 Reverse -347 -366 -3.63879 0.24
NP_440260.1_8 Forward -273 -255 -3.12744 0.249
NP_440260.1_8 Reverse -302 -320 -3.52077 0.252
NP_441678.1_9 Forward -367 -348 -4.32711 0.292
NP_440437.1_1 Reverse -353 -372 -5.80207 0.292
NP_442012.1_5 Forward -264 -245 4.42435 0.261
NP_442982.1_5 Reverse -349 -368 -1.7705 0.269
NP_441644.1_6 Reverse -267 -277 4.60114 0.233
NP_441795.1_5 Forward -232 -213 9.53756 0.245
NP_442215.1_2 Forward -322 -306 -5.84132 0.26
NP_440469.1_8 Reverse -351 -370 9.53756 0.295
NP_441751.2_8 Reverse -328 -342 -6.39192 0.265
NP_442554.1_9 Forward -261 -242 13.4551 0.279
NP_442142.1_4 Forward -317 -304 3.95196 0.239
NP_442142.1_4 Reverse -185 -198 2.28034 0.295
NP_441525.1_1 Forward -123 -110 14.4739 0.215
NP_441523.1_6 Reverse -354 -373 3.34271 0.274
NP_442301.1_2 Reverse -238 -257 9.43841 0.204
NP_442301.1_2 Reverse -208 -227 3.53858 0.293
NP_440357.1_6 Reverse -221 -240 10.6192 0.272
NP_441198.1_8 Reverse -357 -367 10.4392 0.271
NP_440379.1_5 Reverse -350 -369 -6.78538 0.238
NP_441569.1_7 Reverse -61 -75 16.8135 0.296
NP_441020.2_6 Forward -310 -293 6.82368 0.251
NP_441015.1_10 Forward -367 -348 -11.1119 0.291
NP_441015.1_10 Forward -226 -207 -11.6036 0.298
NP_441826.1_5 Forward -263 -244 2.16274 0.276
NP_441612.1_2 Reverse -179 -189 17.8433 0.189
NP_442775.1_6 Forward -232 -213 12.0942 0.277
NP_440031.1_10 Forward -232 -213 0.491109 0.276
NP_442542.1_9 Forward -264 -250 4.52221 0.294
NP_440558.1_2 Reverse -239 -258 -0.590531 0.204
NP_440558.1_2 Reverse -209 -228 -2.85214 0.231
NP_442789.1_4 Reverse -54 -73 4.62101 0.153
NP_441878.1_6 Reverse -113 -123 -7.19813 0.21
NP_441878.1_6 Forward -277 -267 -7.88644 0.278
NP_441445.1_1 Forward -230 -211 3.14605 0.218
NP_441590.1_4 Reverse -214 -233 9.24175 0.249
NP_441590.1_4 Reverse -217 -236 5.11187 0.279
NP_441590.1_4 Reverse -200 -219 2.85027 0.293
NP_441590.1_4 Reverse -220 -239 1.96529 0.299
NP_442183.1_9 Forward -230 -220 17.2863 0.206
NP_442183.1_9 Forward -245 -235 10.6981 0.296
NP_440356.1_1 Reverse -237 -256 13.5683 0.247
NP_441574.1_1 Forward -257 -238 -5.40875 0.26
NP_440276.1_8 Forward -268 -249 7.86593 0.27
NP_441549.1_9 Forward -372 -354 -10.8956 0.291
NP_440414.1_8 Forward -247 -228 11.6025 0.175
NP_441467.1_9 Reverse -111 -125 17.4042 0.142
NP_442347.1_2 Reverse -312 -321 4.0313 0.284
NP_442317.1_6 Forward -26 -7 8.65258 0.216
NP_441633.1_3 Forward -45 -32 -0.570702 0.148
NP_440899.1_2 Reverse -348 -367 8.94676 0.187
NP_440299.1_1 Forward -280 -267 3.7553 0.232
NP_440977.1_4 Forward -171 -152 -0.590531 0.1
NP_441435.1_10 Reverse -263 -282 19.2723 0.155
NP_442333.2_5 Reverse -238 -257 -11.6036 0.246
NP_440256.1_1 Reverse -320 -339 -5.50708 0.184
NP_442007.1_3 Reverse -319 -338 17.5998 0.137
NP_441559.1_8 Reverse -354 -368 -6.98191 0.281
NP_441270.1_5 Forward -237 -218 16.3124 0.191
NP_441270.1_5 Forward -234 -215 14.263 0.211
NP_440915.1_6 Reverse -110 -124 -0.492064 0.197
NP_440915.1_6 Forward -372 -358 -2.55701 0.276
NP_442069.1_1 Reverse -250 -269 16.4199 0.289
NP_442069.1_4 Reverse -283 -302 4.81767 0.254
NP_441464.1_10 Forward -229 -215 7.47274 0.296
NP_440677.1_6 Forward -317 -298 7.47261 0.298
NP_442386.1_9 Forward -369 -360 5.9975 0.23
NP_440327.1_6 Forward -257 -238 11.1109 0.188
NP_439976.1_4 Reverse -47 -66 5.30853 0.278
NP_441160.1_5 Forward -253 -234 9.53756 0.271
NP_440586.1_1 Forward -231 -212 -4.22878 0.278
NP_440586.1_1 Forward -261 -242 -4.72043 0.278
NP_440586.1_1 Forward -249 -230 -5.01543 0.28
NP_440586.1_1 Forward -246 -227 -5.9004 0.291
NP_442959.1_5 Reverse -152 -171 12.5858 0.222
NP_442959.1_7 Reverse -223 -242 -5.40875 0.299
NP_440027.1_3 Reverse -218 -236 7.19654 0.214
NP_440027.1_3 Reverse -212 -230 5.22993 0.245
NP_440027.1_3 Forward -69 -51 2.08335 0.293
NP_440027.1_8 Forward -335 -316 13.3716 0.19
NP_439937.1_9 Reverse -211 -228 -16.7764 0.287
NP_443039.1_7 Reverse -243 -257 7.76712 0.19
NP_440408.1_7 Forward -270 -251 7.7676 0.284
NP_442239.1_3 Forward -382 -364 23.7169 0.0258
NP_442239.1_4 Forward -29 -10 28.3188 0.0000391
NP_442239.1_8 Forward -231 -212 19.764 0.146
NP_442239.1_9 Forward -205 -186 26.0563 0.00682
NP_439943.1_1 Forward -251 -232 6.58763 0.0987
NP_441789.1_7 Reverse -223 -242 5.50519 0.193
NP_441789.1_7 Reverse -349 -368 -5.50783 0.298
NP_440267.1_2 Forward -128 -114 7.27547 0.202
NP_442384.1_10 Reverse -311 -324 9.2624 0.0557
NP_440364.1_10 Forward -232 -213 16.2241 0.244
NP_441018.1_7 Forward -231 -212 13.6675 0.132
NP_441018.1_7 Forward -232 -213 6.29264 0.294
NP_442262.1_10 Reverse -378 -385 10.1672 0.162
NP_440282.1_10 Reverse -349 -368 -7.17871 0.251
NP_440531.1_8 Forward -242 -223 3.44104 0.269
NP_441060.1_4 Reverse -222 -240 2.77242 0.252
NP_442832.1_2 Forward -128 -109 12.7825 0.243
NP_441965.1_10 Forward -371 -355 2.91013 0.28
NP_442693.1_6 Forward -129 -110 3.6377 0.278
NP_442556.1_10 Forward -249 -230 7.68492 0.299
NP_440297.1_9 Reverse -268 -278 0.0783647 0.282
NP_440894.1_10 Forward -38 -19 6.4893 0.215
NP_441917.1_2 Forward -371 -353 4.54237 0.288
NP_440982.1_1 Reverse -212 -231 5.11187 0.294
NP_441548.1_7 Reverse -238 -257 18.6823 0.258
NP_443064.1_6 Reverse -198 -208 9.65817 0.205
NP_442337.1_6 Forward -228 -209 12.4701 0.291
NP_442337.1_8 Forward -301 -282 2.94938 0.217
NP_440519.1_8 Forward -257 -241 8.61333 0.199
NP_442872.1_1 Reverse -222 -241 -11.3086 0.241
NP_442428.1_4 Reverse -53 -72 5.01433 0.222
NP_442120.1_10 Forward -245 -226 -8.26035 0.23
NP_441052.1_2 Reverse -311 -321 3.22496 0.182
NP_441052.1_2 Reverse -359 -369 2.43831 0.204
NP_440992.1_2 Forward -257 -238 10.1275 0.273
NP_440689.1_1 Reverse -238 -256 6.01734 0.3
NP_440314.1_9 Reverse -234 -253 -9.93197 0.281
NP_441004.1_1 Forward -257 -238 -10.522 0.221
NP_441004.1_1 Forward -269 -250 -15.6352 0.276
NP_442813.1_5 Forward -219 -200 6.29264 0.213
NP_439949.1_7 Reverse -31 -45 14.2576 0.226
NP_442873.1_5 Reverse -241 -260 10.1267 0.248
NP_443054.1_2 Reverse -357 -371 -0.492064 0.295
NP_442208.1_5 Reverse -297 -316 -7.08038 0.27
NP_441195.1_1 Reverse -222 -241 7.7676 0.087
NP_442622.1_1 Forward -22 -3 -3.3438 0.177
NP_442856.1_7 Reverse -302 -321 -3.93378 0.254
NP_441396.1_5 Forward -232 -223 8.45619 0.224
NP_440593.1_3 Reverse -250 -269 -4.6221 0.251
NP_440432.1_9 Forward -20 -5 -5.32998 0.245
NP_442843.1_1 Forward -385 -366 -11.9969 0.296
NP_439960.1_6 Reverse -242 -261 10.9142 0.208
NP_442168.1_5 Reverse -208 -227 -2.45882 0.264
NP_440588.1_2 Forward -323 -304 -5.99873 0.266
NP_440954.1_1 Forward -257 -238 -11.6036 0.295
NP_441570.1_1 Forward -336 -318 -15.8121 0.234
NP_442443.1_1 Forward -229 -210 -4.6221 0.275
NP_440526.1_3 Reverse -360 -371 0.156538 0.297
NP_441732.1_2 Reverse -355 -371 -15.9694 0.164
NP_441732.1_2 Reverse -175 -191 -17.4444 0.258
NP_442797.1_7 Reverse -352 -370 -0.570838 0.284
NP_441057.1_4 Forward -243 -225 4.24738 0.231
NP_440913.1_1 Forward -125 -107 3.3624 0.299
NP_442727.1_1 Forward -234 -220 12.7826 0.256
NP_443011.1_4 Forward -231 -212 9.83255 0.216
NP_440713.1_4 Forward -231 -212 11.7992 0.113
NP_440713.1_4 Forward -330 -311 2.16274 0.27
NP_441659.2_8 Reverse -267 -277 2.24165 0.207
NP_440426.1_7 Reverse -363 -382 -0.39387 0.297
NP_442913.1_10 Reverse -259 -278 -3.93378 0.221
NP_441040.1_2 Forward -229 -210 -3.73712 0.149
NP_439956.1_7 Forward -263 -244 6.4893 0.257
NP_439956.1_7 Forward -374 -355 3.24438 0.257
NP_441800.1_7 Reverse -207 -225 -2.73412 0.265
NP_440486.1_6 Forward -321 -302 6.88262 0.278
NP_441653.1_3 Forward -251 -237 14.9459 0.254
NP_442551.1_4 Forward -370 -355 -3.75668 0.295
NP_442603.1_9 Reverse -352 -370 0.21581 0.293
NP_443026.1_5 Forward -232 -213 -4.52377 0.283
NP_441044.1_4 Reverse -213 -231 3.06741 0.238
NP_440204.1_1 Forward -257 -238 6.29264 0.278
NP_442691.1_2 Reverse -235 -254 8.35759 0.161
NP_440400.1_1 Reverse -224 -243 -0.39464 0.285
NP_441892.1_1 Reverse -258 -275 -1.53445 0.208
NP_440665.1_2 Reverse -351 -370 3.14605 0.18
NP_440604.1_6 Reverse -299 -318 -0.983855 0.192
NP_442044.1_1 Reverse -354 -373 -12.1936 0.271
NP_442193.1_1 Forward -257 -239 11.9172 0.223
NP_440675.1_4 Reverse -21 -40 11.4058 0.299
NP_440868.1_4 Forward -390 -378 -0.354346 0.263
NP_442696.1_6 Reverse -239 -258 -4.6221 0.171
NP_439994.1_1 Forward -227 -208 7.57094 0.271
NP_440505.1_7 Forward -225 -206 5.50599 0.183
NP_441701.1_3 Forward -230 -213 6.82368 0.275
NP_442471.1_10 Reverse -245 -264 16.8141 0.0858
NP_442533.1_1 Forward -230 -211 -14.3569 0.242
NP_442533.1_6 Forward -368 -359 6.09625 0.118
NP_442533.1_6 Reverse -359 -368 6.09625 0.118
NP_442533.1_6 Forward -63 -54 4.42462 0.179
NP_442533.1_6 Reverse -212 -221 2.75299 0.241
NP_442541.1_10 Reverse -212 -226 1.47397 0.286
NP_442322.1_4 Reverse -241 -258 -9.69657 0.296
NP_442322.1_4 Reverse -351 -368 -9.99156 0.297
NP_442269.1_10 Forward -226 -207 12.5858 0.176
NP_441170.1_2 Reverse -352 -371 -1.47551 0.295
NP_441972.1_5 Forward -319 -300 -6.39206 0.229
NP_441216.1_5 Reverse -246 -265 13.9616 0.188
NP_442588.1_1 Forward -260 -241 7.27595 0.259
NP_442058.1_9 Forward -168 -154 17.0108 0.252
NP_442614.1_2 Forward -356 -342 9.63603 0.242
NP_442213.1_5 Forward -301 -282 -0.590531 0.292
NP_442213.1_5 Forward -235 -216 -1.47551 0.293
NP_442022.1_4 Forward -257 -238 13.3725 0.166
NP_441463.1_6 Reverse -357 -371 10.5712 0.242
NP_441796.1_8 Forward -369 -351 10.3439 0.24
NP_442020.1_2 Forward -335 -316 9.43923 0.141
NP_440293.1_3 Forward -259 -240 -4.13045 0.258
NP_439988.1_3 Forward -366 -352 4.12949 0.295
NP_441979.1_5 Reverse -258 -277 -18.3884 0.295
NP_440457.1_1 Reverse -110 -122 -1.04266 0.289
NP_441984.1_1 Reverse -19 -37 5.82068 0.288
NP_442509.1_5 Reverse -263 -280 16.4593 0.164
NP_442784.1_3 Reverse -194 -213 15.2408 0.264
YP_003858595.1_6 Reverse -335 -354 6.39016 0.279
NP_442341.1_7 Forward -321 -307 3.8345 0.21
NP_442534.1_7 Forward -333 -314 6.29264 0.272
NP_442373.1_2 Forward -233 -214 -1.37718 0.198
NP_440172.1_1 Forward -242 -232 5.48657 0.143
NP_442015.1_10 Reverse -307 -320 2.57589 0.19
NP_443052.1_9 Reverse -214 -233 -1.7705 0.231
NP_443052.1_9 Reverse -238 -257 -2.65548 0.241
NP_443052.1_9 Forward -213 -194 -5.31042 0.266
NP_442403.1_9 Reverse -255 -274 7.66927 0.191
NP_442154.1_1 Forward -256 -238 5.23069 0.0591
NP_442154.1_1 Forward -232 -214 -14.1405 0.217
NP_442154.1_1 Forward -259 -241 -15.4188 0.218
NP_442154.1_1 Forward -241 -223 -15.4188 0.218
NP_442154.1_1 Reverse -111 -129 -16.0088 0.229
NP_442154.1_1 Forward -235 -217 -17.6804 0.262
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGGATCTTGCTGGCTTCAATCGGTCGATTAGTGGGCATGCCCTTGGGGGTAGGCAGTAGATCAAGACCACCGATATGCTTGGGCTTCACCAAGGCGGACTCATCTTTGCTGGAACCGGCTCTAGGACGACGGCTCCGGTTAGCGGCAGTGGTTTTGCTGGCGGTTTCTTCGTTGGGGGTGGTGTTGGGCCCCTGCTGTTCCTCAGTCATGCTGTTTATCTCCTTAATATAAATATTCGATTAATTGATCAACAATAAAGCACTGTGCGAGACAGACAGGCCACCCACCGTGTTTTGTTAGCATTACTCTGCTTGTCTTCAAAGATACACCGCTGAATGGCCAGCCACGATAGTTATCTTTAATCAGCCCTATTATCCCAGACTATAGCTCCTTTGCCGCC

CDS

ATGACTTCTGACCTCTTTTCCCTCCATGCGCCCTTTCGTCCTACCGGAGATCAACCCACGGCGATCGCCAGTTTGATCGAGTCTTTGCAGGGAGAGCACAAGTTTCAAACCCTGCTGGGGGCAACGGGAACGGGGAAAACCTTCACCATGGCTTCGGTTATTGCGGAGTTGGGACGACCAACATTGGTATTAGCCCACAATAAAACCTTGGCGGCCCAATTATGTAATGAATTGCGGCAATTTTTTCCCGAAAACGCGGTTGAATACTTCATTAGTTATTACGACTATTACCAGCCAGAAGCCTATATTCCCGTCACCGATACCTATATCGAAAAAACGGCTTCTATCAACGATGAGATTGATATGTTGCGTCACTCCGCCACCCGTTCTCTGTTTGAACGACGGGATGTAATTGTGGTAGCTTCCATCAGTTGCATTTACGGTTTGGGTATTCCCAGCCAATATCTCAAAGCGGCCGTTCCTCTGCAAGTGGGTGCCGAATATGATCCCCGCCTAGTAATTCGGGATTTGGTCAATGTGCAATATAGCCGCAACGATGTGGAATTACAACGGGGACGATTTCGCCTCAAAGGAGATGTGTTGGAAATTGTGCCGGCCTATGAAGATCGGGTGATTCGCATCGAATTTTTTGGTGACGAAGTGGAAGCTCTACGGTTAATTGATCCGGTCAGCGGCGAAATTTTGCAAAGTTTAGACAGAATCAGCATTTATCCCGCCCGTCACTTTGTCACCCCAGAAGAAACCCTAGAAAAAGCCTGTCAGCAAATTCAAACGGAAATGGAACAACAGGTAGCTTTTTTAGAAAAAAATAATCTGTTGGTAGAAGCTCAAAGATTAAGTCAACGCACCCGTTATGACTTGGAAATGCTCCGAGAAGTGGGCTATTGCAACGGAGTAGAAAATTATTCCCGCTATCTAGCCGATCGCCAGGCGGGGGAACCACCGGAATGTTTAGTGGATTATTTTCCCGAAGATTGGTTATTAGTAATTGATGAATCCCATGTGACTATTCCCCAATTGCGGGGTATGTATAATGGCGACCAGGCCAGAAAAAAAGTTTTAATTGACCATGGCTTTCGTCTGCCCAGTGCGGCGGATAATCGCCCCCTAAAAGCAGAAGAATTTTGGCAAAAAGTTAAACAGTGTGTGTTTGTTTCTGCCACTCCGGGAGTTTGGGAAATAGAGCAATCGGAAGCAAGGGTAATTGAGCAGGTAATTCGCCCCACTGGAGTTCTTGATCCGGAAATTTTTGTCCGTCCCACCACCGGCCAGGTGGATGATTTATACGGGGAAATTCAAACCAGGGTAAAGCTGAAAGAACGGGTATTAATCACAACTTTAACTAAACGGATGGCGGAGGATTTAACCGATTATTTTTCTGAACGGGGCATCAAGGTTCAATATCTCCATTCCGAGATTCAATCTATTCAACGTATTGAGATTTTACAAGCTTTACGAGACGGGGAATTTGATGTGTTAATTGGGGTAAATTTATTGCGGGAAGGGTTAGATTTACCGGAAGTTTCCCTAGTAGCTATTATGGATGCAGATAAAGAAGGCTTTTTGCGGGCAGAGCGTTCTTTAATTCAAACCATTGGCCGGGCCGCCCGTCATATTCGGGGACAGGCGATTTTATATGCTGATAATTTCACCGACAGTATGCAAAAGGCAATCGCCGAAACGGAAAGGAGGCGGAAAATCCAACAAGAATATAACGAAAAGCACGGTATTACCCCTCAACCGATTAATAAACGGGCTAACAATGCCATTTTGCAATTTCTTGATATTTCCCGTCGTTTAAACAGTCAACAGTTGGAGGAAGTATATGAACAAGCCCAGGATTTACCCCTAGAAAAAATCCCCGATTTAATTCAACAATTGGAGGAAAAAATGCAAGAAGCGGCCAAAAAACAGGAATTTGAAGTAGCTGCCATCTACCGAGACCGCATTCAACATTTGCGTGATCGGCTTTTGGGCCACAAAAAGTAA

Protein

MTSDLFSLHAPFRPTGDQPTAIASLIESLQGEHKFQTLLGATGTGKTFTMASVIAELGRPTLVLAHNKTLAAQLCNELRQFFPENAVEYFISYYDYYQPEAYIPVTDTYIEKTASINDEIDMLRHSATRSLFERRDVIVVASISCIYGLGIPSQYLKAAVPLQVGAEYDPRLVIRDLVNVQYSRNDVELQRGRFRLKGDVLEIVPAYEDRVIRIEFFGDEVEALRLIDPVSGEILQSLDRISIYPARHFVTPEETLEKACQQIQTEMEQQVAFLEKNNLLVEAQRLSQRTRYDLEMLREVGYCNGVENYSRYLADRQAGEPPECLVDYFPEDWLLVIDESHVTIPQLRGMYNGDQARKKVLIDHGFRLPSAADNRPLKAEEFWQKVKQCVFVSATPGVWEIEQSEARVIEQVIRPTGVLDPEIFVRPTTGQVDDLYGEIQTRVKLKERVLITTLTKRMAEDLTDYFSERGIKVQYLHSEIQSIQRIEILQALRDGEFDVLIGVNLLREGLDLPEVSLVAIMDADKEGFLRAERSLIQTIGRAARHIRGQAILYADNFTDSMQKAIAETERRRKIQQEYNEKHGITPQPINKRANNAILQFLDISRRLNSQQLEEVYEQAQDLPLEKIPDLIQQLEEKMQEAAKKQEFEVAAIYRDRIQHLRDRLLGHKK