Your browser is old and dusty. Try Google Chrome!

Details for sll0377

ORF sll0377
Accession NP_442325.1
Symbol
Category transcription-repair coupling factor
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -281 -295 18.0925 0.0206
NP_441061.1_2 Forward -288 -274 6.98109 0.11
NP_441061.1_2 Forward -303 -289 5.1128 0.142
NP_440795.1_7 Forward -288 -281 14.6904 0.0123
NP_440795.1_7 Reverse -281 -288 14.6904 0.0123
NP_440795.1_7 Forward -294 -287 7.80726 0.232
NP_441418.1_6 Forward -289 -270 7.27595 0.00614
NP_441418.1_6 Reverse -280 -299 -21.535 0.153
NP_440815.1_2 Reverse -210 -224 16.3219 0.201
NP_442291.1_5 Forward -290 -274 3.10679 0.114
NP_440897.1_9 Reverse -84 -102 13.293 0.222
NP_441453.1_4 Reverse -280 -288 16.539 0.00633
NP_441453.1_4 Forward -289 -281 16.539 0.00633
NP_441453.1_7 Forward -228 -221 11.9372 0.298
NP_441960.1_3 Reverse -286 -305 13.2234 0.289
NP_442151.1_6 Reverse -280 -294 18.4858 0.0071
NP_441818.1_1 Reverse -281 -292 13.1362 0.0861
NP_441818.1_1 Forward -288 -277 9.69459 0.232
NP_440226.1_1 Forward -289 -270 18.289 0.0157
NP_440226.1_1 Reverse -280 -299 13.8641 0.0344
NP_442655.1_2 Forward -104 -85 7.07928 0.159
NP_442173.1_1 Forward -288 -280 15.4574 0.00633
NP_442173.1_1 Reverse -281 -289 15.4574 0.00633
NP_442752.1_4 Forward -289 -282 13.8055 0.0199
NP_442752.1_4 Reverse -280 -287 13.8055 0.0199
NP_442752.1_4 Reverse -304 -311 9.47889 0.109
NP_443027.1_4 Reverse -278 -288 14.828 0.0437
NP_443027.1_4 Forward -291 -281 13.1564 0.0521
NP_443027.1_4 Forward -375 -365 9.7148 0.153
NP_443027.1_4 Reverse -367 -377 8.73149 0.191
NP_441812.1_3 Forward -290 -276 17.8958 0.0479
NP_442975.1_10 Reverse -276 -290 22.32 0.000414
NP_442975.1_10 Forward -293 -279 3.04726 0.263
NP_440784.1_7 Forward -288 -281 15.9687 0.0123
NP_440784.1_7 Reverse -281 -288 15.9687 0.0123
NP_442909.1_7 Forward -294 -280 7.27547 0.221
NP_440061.1_9 Reverse -278 -292 16.9119 0.0201
NP_440061.1_9 Forward -316 -302 5.99717 0.264
NP_440061.1_9 Forward -315 -301 4.91554 0.3
NP_441476.1_5 Reverse -275 -294 -1.18052 0.2
NP_442062.1_2 Forward -86 -67 8.55425 0.284
NP_442062.1_3 Reverse -135 -154 -1.7705 0.264
NP_442062.1_8 Forward -289 -279 19.4496 0.000558
NP_442062.1_8 Reverse -280 -290 17.3846 0.00193
NP_441859.1_3 Reverse -279 -298 8.35677 0.139
NP_440304.1_4 Reverse -278 -288 10.8948 0.051
NP_440304.1_4 Forward -291 -281 9.91146 0.051
NP_440304.1_4 Forward -380 -370 7.55152 0.109
NP_440304.1_4 Forward -299 -289 3.32329 0.299
NP_442242.1_4 Forward -288 -281 14.3954 0.0124
NP_442242.1_4 Reverse -281 -288 14.3954 0.0124
NP_442762.1_10 Reverse -289 -308 -11.8003 0.275
NP_439918.1_2 Forward -100 -81 0.491109 0.225
NP_441935.1_1 Reverse -295 -314 5.30933 0.293
NP_441208.1_9 Forward -381 -367 8.75105 0.219
NP_441208.1_9 Forward -292 -278 5.40779 0.267
NP_441594.1_6 Forward -298 -279 8.75091 0.153
NP_440370.1_10 Forward -387 -368 9.73422 0.217
NP_442110.1_7 Reverse -280 -294 9.34103 0.0755
NP_442726.1_1 Forward -294 -275 12.0942 0.179
NP_442726.1_7 Forward -296 -278 -1.35749 0.294
NP_441925.1_4 Forward -312 -293 -11.506 0.252
NP_440856.1_1 Forward -293 -274 -4.52377 0.252
NP_441083.1_5 Reverse -280 -290 20.3345 0.00053
NP_441083.1_5 Forward -289 -279 11.3864 0.0159
NP_442827.1_8 Forward -297 -278 4.12856 0.139
NP_441141.1_8 Reverse -60 -79 23.2047 0.0687
NP_441738.1_2 Forward -287 -280 15.28 0.0102
NP_441738.1_2 Reverse -282 -289 15.28 0.0102
NP_441558.1_5 Reverse -367 -386 7.7676 0.17
NP_441558.1_5 Reverse -278 -297 5.60432 0.245
NP_441558.1_5 Forward -291 -272 4.916 0.267
NP_441955.1_8 Reverse -289 -306 10.0686 0.255
NP_440209.1_1 Reverse -280 -288 18.1123 0.00295
NP_440209.1_1 Forward -289 -281 18.1123 0.00295
NP_442889.1_8 Reverse -277 -291 13.4703 0.0588
NP_440178.1_5 Forward -283 -274 18.6826 0.137
NP_440178.1_7 Reverse -279 -298 -21.6334 0.232
NP_440178.1_7 Forward -290 -271 -22.42 0.265
NP_442706.1_5 Reverse -87 -106 14.6893 0.245
NP_442570.1_3 Forward -97 -78 -7.08038 0.265
NP_441716.1_1 Reverse -280 -294 3.8345 0.259
NP_442111.1_4 Reverse -176 -190 10.6193 0.0531
NP_442111.1_4 Reverse -279 -293 3.8345 0.229
NP_441163.1_4 Reverse -80 -99 15.4376 0.255
NP_440906.1_5 Forward -288 -281 15.8704 0.0124
NP_440906.1_5 Reverse -281 -288 15.8704 0.0124
NP_440747.1_10 Forward -292 -280 7.4138 0.00422
NP_440747.1_10 Reverse -277 -289 -2.02597 0.0196
NP_440747.1_10 Forward -33 -21 -12.0557 0.199
NP_441130.1_10 Reverse -278 -292 11.2093 0.107
NP_441130.1_10 Forward -291 -277 8.16106 0.14
NP_442973.1_7 Forward -294 -275 14.8474 0.209
NP_441486.1_1 Reverse -277 -291 13.1759 0.00897
NP_441486.1_1 Forward -292 -278 2.65453 0.079
NP_442634.1_4 Forward -380 -366 2.16287 0.144
NP_442634.1_4 Forward -291 -277 -3.63866 0.161
NP_440057.1_6 Reverse -313 -332 12.0376 0.284
NP_441014.1_10 Forward -290 -271 11.995 0.118
NP_442848.1_1 Forward -295 -281 6.58777 0.0791
NP_442848.1_1 Reverse -274 -288 -2.95034 0.263
NP_443018.1_3 Forward -288 -281 14.8871 0.0123
NP_443018.1_3 Reverse -281 -288 14.8871 0.0123
NP_443018.1_3 Forward -377 -370 4.26735 0.267
NP_443018.1_3 Reverse -370 -377 4.07068 0.299
NP_441316.1_7 Reverse -278 -293 -3.16669 0.273
NP_441634.1_8 Forward -291 -277 5.21113 0.114
NP_441182.1_6 Reverse -233 -252 11.3075 0.16
NP_440376.1_1 Forward -289 -280 19.4693 0.000692
NP_440376.1_1 Reverse -280 -289 19.4693 0.000692
NP_440376.1_1 Reverse -304 -313 0.688044 0.262
NP_440376.1_1 Forward -29 -20 -0.196935 0.285
NP_441002.1_3 Forward -78 -59 9.24175 0.293
NP_441588.1_4 Forward -287 -277 6.96153 0.178
NP_441588.1_4 Reverse -282 -292 6.37155 0.2
NP_442687.1_7 Reverse -279 -289 15.8113 0.0125
NP_442687.1_7 Forward -46 -36 10.5014 0.0994
NP_442687.1_7 Forward -290 -280 8.92815 0.0994
NP_442687.1_7 Forward -305 -295 3.61828 0.299
NP_442191.1_4 Reverse -295 -309 15.4531 0.0603
NP_442485.1_3 Forward -306 -287 -5.01543 0.287
NP_441846.1_1 Forward -83 -64 4.81767 0.28
NP_441846.1_10 Reverse -294 -313 -22.2233 0.257
NP_441846.1_10 Reverse -293 -312 -22.8133 0.266
NP_440642.1_1 Forward -308 -289 5.89931 0.294
NP_441013.1_2 Forward -308 -290 4.44404 0.226
NP_441422.1_7 Reverse -278 -295 0.137172 0.148
NP_440533.1_9 Reverse -280 -299 4.62101 0.22
NP_441950.1_7 Forward -274 -255 -8.85033 0.287
NP_441763.1_5 Reverse -240 -259 -2.65548 0.234
NP_442658.1_1 Reverse -278 -288 15.9091 0.00966
NP_442658.1_1 Forward -380 -370 11.6809 0.0768
NP_442658.1_1 Forward -291 -281 9.616 0.147
NP_440141.1_9 Forward -275 -256 0.786102 0.27
NP_442782.1_2 Forward -303 -289 2.16287 0.277
NP_442782.1_2 Forward -45 -31 0.491246 0.289
NP_440656.1_8 Reverse -269 -288 -3.63879 0.198
NP_441414.1_9 Forward -378 -359 -9.53865 0.262
NP_442937.1_5 Forward -294 -275 18.4857 0.0249
NP_442937.1_5 Reverse -275 -294 8.25926 0.229
NP_441958.1_1 Forward -158 -139 17.807 0.27
NP_441958.1_5 Forward -290 -280 12.2714 0.00183
NP_441958.1_5 Reverse -279 -289 12.2714 0.00183
NP_439905.1_1 Reverse -281 -294 7.49244 0.258
NP_439905.1_1 Reverse -370 -383 7.29578 0.263
NP_439990.1_5 Forward -294 -281 12.8023 0.106
NP_439990.1_5 Forward -35 -22 9.2624 0.147
NP_442911.1_2 Forward -299 -280 14.9458 0.0112
NP_442911.1_2 Reverse -359 -378 2.65439 0.0491
NP_442911.1_2 Reverse -270 -289 -0.0988766 0.0718
NP_441580.1_6 Reverse -353 -372 -8.65367 0.267
NP_440153.1_5 Reverse -370 -384 4.62115 0.199
NP_443055.1_6 Forward -321 -303 13.293 0.0989
NP_443055.1_6 Forward -297 -279 11.2281 0.114
NP_443055.1_6 Forward -303 -285 6.1149 0.172
NP_443055.1_6 Reverse -272 -290 5.1316 0.181
NP_443055.1_6 Reverse -287 -305 1.78836 0.224
NP_440993.1_2 Reverse -275 -291 6.05672 0.233
NP_440993.1_2 Reverse -364 -380 1.92682 0.272
NP_440602.1_8 Forward -289 -275 15.9292 0.115
NP_443044.1_1 Reverse -204 -223 5.60432 0.279
NP_441099.1_5 Forward -299 -280 -2.16383 0.118
NP_441099.1_5 Reverse -270 -289 -11.8003 0.29
NP_442002.1_1 Reverse -97 -115 -8.83064 0.272
NP_442002.1_9 Reverse -310 -317 11.1505 0.185
NP_442002.1_9 Reverse -279 -286 10.7572 0.185
NP_441294.1_7 Reverse -276 -290 16.6418 0.0133
NP_441646.1_1 Forward -296 -277 11.3075 0.103
NP_441646.1_1 Reverse -362 -381 0.392778 0.251
NP_442438.1_10 Forward -294 -280 10.3243 0.0547
NP_442438.1_10 Reverse -275 -289 1.76955 0.188
NP_442431.1_10 Forward -381 -363 0.117479 0.281
NP_441456.1_6 Reverse -18 -37 7.96426 0.294
NP_441000.1_6 Forward -290 -276 5.01447 0.0933
NP_442771.1_1 Reverse -278 -296 10.7372 0.0206
NP_440147.1_4 Reverse -278 -291 12.8023 0.0326
NP_440147.1_4 Forward -291 -278 0.805932 0.244
NP_441550.1_8 Forward -291 -281 16.7941 0.00906
NP_441550.1_8 Reverse -278 -288 6.0761 0.214
NP_441916.1_7 Forward -289 -279 18.4663 0.00144
NP_441916.1_7 Reverse -280 -290 10.3048 0.0261
NP_441916.1_10 Reverse -272 -291 8.16093 0.174
NP_440206.1_9 Forward -196 -177 7.57094 0.289
NP_441041.1_1 Forward -375 -356 6.39097 0.274
NP_441041.1_4 Forward -289 -270 -0.590531 0.0958
NP_441041.1_7 Reverse -277 -289 10.916 0.0864
NP_442396.1_5 Forward -238 -225 13.0973 0.0913
NP_440569.1_10 Reverse -88 -107 2.33913 0.293
NP_442004.1_6 Reverse -280 -294 9.2427 0.14
NP_440703.1_9 Reverse -211 -224 5.0336 0.293
NP_441725.1_5 Forward -288 -278 11.2881 0.0247
NP_441725.1_5 Reverse -281 -291 9.02648 0.0553
NP_439966.1_7 Reverse -278 -288 18.4657 0.00473
NP_439966.1_7 Forward -291 -281 14.8275 0.0177
NP_439966.1_7 Reverse -78 -88 8.3377 0.14
NP_439966.1_9 Reverse -278 -287 0.983037 0.253
NP_439966.1_9 Forward -291 -282 0.884706 0.253
NP_440736.1_4 Reverse -263 -282 11.11 0.258
NP_440202.1_8 Forward -312 -293 12.3352 0.272
NP_442941.1_3 Forward -288 -278 11.4848 0.0116
NP_442941.1_3 Reverse -281 -291 10.9931 0.0116
NP_440289.1_2 Reverse -277 -290 21.3571 0.00262
NP_440289.1_2 Forward -292 -279 -4.60227 0.29
NP_440260.1_8 Forward -298 -280 2.28076 0.182
NP_442281.1_1 Reverse -275 -289 20.7467 0.00192
NP_442281.1_1 Forward -294 -280 4.91554 0.176
NP_442281.1_1 Reverse -359 -373 1.67063 0.293
NP_442281.1_2 Reverse -291 -310 20.5506 0.124
NP_441334.1_7 Reverse -278 -297 -11.4069 0.122
NP_441334.1_7 Reverse -367 -386 -13.5702 0.217
NP_441079.1_1 Forward -45 -26 21.6323 0.0887
NP_440177.1_9 Forward -297 -278 16.0274 0.165
NP_442256.1_2 Forward -291 -273 0.0191479 0.131
NP_441457.1_9 Reverse -353 -372 11.7992 0.251
NP_441556.1_7 Forward -314 -295 -1.37794 0.3
NP_440498.1_1 Reverse -271 -289 -2.83245 0.248
NP_441644.1_6 Reverse -280 -290 17.3841 0.00127
NP_441644.1_6 Forward -289 -279 10.1076 0.0628
NP_441644.1_6 Forward -378 -368 6.0761 0.167
NP_441644.1_6 Reverse -369 -379 3.61784 0.272
NP_442215.1_2 Forward -261 -245 1.63183 0.13
NP_442215.1_2 Forward -291 -275 -4.95634 0.242
NP_442029.1_6 Reverse -295 -314 5.70265 0.249
NP_442247.1_6 Forward -304 -285 14.9458 0.14
NP_440253.1_2 Forward -289 -271 22.4386 0.0026
NP_440253.1_2 Reverse -280 -298 12.4089 0.0281
NP_440929.1_8 Forward -289 -280 19.2726 0.000701
NP_440929.1_8 Reverse -280 -289 19.2726 0.000701
NP_440780.1_1 Reverse -112 -131 7.49569 0.274
NP_442933.1_10 Forward -289 -280 17.601 0.00325
NP_442933.1_10 Reverse -280 -289 17.601 0.00325
NP_441751.2_8 Forward -288 -274 -2.55701 0.132
NP_441751.2_8 Reverse -281 -295 -4.22864 0.166
NP_441751.2_8 Forward -207 -193 -6.58858 0.273
NP_442554.1_8 Reverse -281 -291 18.0729 0.00543
NP_442554.1_8 Forward -288 -278 13.8447 0.0145
NP_442554.1_8 Reverse -370 -380 8.53483 0.074
NP_442554.1_8 Forward -377 -367 4.99491 0.163
NP_441762.1_7 Reverse -279 -291 11.8387 0.0142
NP_441762.1_7 Forward -290 -278 2.89058 0.0676
NP_442142.1_4 Reverse -277 -290 15.85 0.0264
NP_442142.1_4 Forward -292 -279 6.80355 0.154
NP_442292.1_1 Reverse -281 -290 18.486 0.00229
NP_442292.1_1 Forward -288 -279 9.63616 0.0183
NP_442292.1_1 Reverse -370 -379 4.71961 0.172
NP_442476.1_6 Reverse -281 -295 3.04785 0.165
NP_442381.1_8 Reverse -277 -296 4.03102 0.0708
NP_442381.1_8 Forward -292 -273 -14.9469 0.29
NP_441711.1_4 Reverse -271 -290 8.25926 0.144
NP_441711.1_4 Forward -298 -279 5.11266 0.182
NP_443009.1_5 Forward -290 -279 18.3477 0.00265
NP_441715.1_4 Forward -288 -278 16.303 0.0117
NP_441715.1_4 Reverse -281 -291 7.84651 0.107
NP_440015.1_9 Reverse -280 -298 0.707465 0.248
NP_441448.1_1 Forward -389 -370 3.44104 0.297
NP_441198.1_8 Forward -375 -365 11.0251 0.228
NP_440379.1_5 Forward -298 -279 -11.1119 0.288
NP_441468.1_1 Forward -288 -281 15.8704 0.0124
NP_441468.1_1 Reverse -281 -288 15.8704 0.0124
NP_441468.1_1 Forward -377 -370 4.07068 0.263
NP_442099.1_1 Forward -256 -238 17.2271 0.263
NP_441020.2_6 Forward -291 -274 18.7217 0.0111
NP_441020.2_6 Reverse -278 -295 12.1336 0.101
NP_441020.2_6 Reverse -301 -318 5.64371 0.293
NP_441673.1_1 Forward -289 -280 20.8459 0.000698
NP_441673.1_1 Reverse -280 -289 20.8459 0.000698
NP_441426.1_3 Reverse -213 -232 8.06178 0.259
NP_441826.1_2 Reverse -274 -288 1.27789 0.157
NP_441826.1_2 Forward -295 -281 -2.16369 0.267
NP_442490.1_10 Forward -314 -296 9.16393 0.244
NP_442868.1_6 Forward -291 -281 17.4829 0.012
NP_442868.1_6 Reverse -278 -288 0.963343 0.205
NP_442719.1_2 Forward -327 -309 -11.2896 0.291
NP_441612.1_2 Reverse -280 -290 8.54929 0.21
NP_442559.1_3 Forward -173 -154 9.0459 0.282
NP_442227.1_2 Reverse -149 -168 3.93269 0.209
NP_443058.1_7 Forward -290 -271 2.3594 0.292
NP_442361.1_3 Reverse -274 -287 7.88576 0.285
NP_442808.1_1 Reverse -279 -289 18.4657 0.00201
NP_442808.1_1 Forward -290 -280 8.63269 0.0481
NP_442808.1_1 Forward -305 -295 3.71617 0.227
NP_442808.1_1 Reverse -222 -232 2.73286 0.256
NP_441101.1_1 Forward -291 -273 10.0489 0.286
NP_440145.1_3 Forward -299 -280 2.0644 0.121
NP_442718.1_2 Forward -381 -362 -6.68705 0.295
NP_442542.1_2 Forward -297 -284 14.7689 0.107
NP_442542.1_2 Forward -291 -278 4.54251 0.3
NP_442542.1_9 Forward -304 -290 6.39049 0.239
NP_442050.1_5 Forward -291 -281 15.6142 0.01
NP_442050.1_5 Reverse -278 -288 9.12434 0.193
NP_442903.1_2 Reverse -117 -136 5.96782 0.185
NP_442342.1_9 Reverse -286 -302 12.2516 0.109
NP_442739.1_2 Forward -50 -31 12.9603 0.246
NP_440558.1_2 Reverse -366 -385 -7.57203 0.296
NP_442789.1_4 Reverse -278 -297 -7.86702 0.299
NP_441518.1_3 Reverse -270 -289 -5.70374 0.126
NP_441518.1_3 Forward -299 -280 -11.8986 0.261
NP_441878.1_6 Forward -290 -280 10.4031 0.0176
NP_441878.1_6 Reverse -279 -289 10.4031 0.0176
NP_441878.1_6 Forward -379 -369 -7.98478 0.285
NP_441036.1_8 Reverse -279 -289 17.7779 0.000554
NP_441036.1_8 Forward -290 -280 8.33817 0.174
NP_442650.1_2 Reverse -280 -294 7.17775 0.13
NP_441557.1_5 Forward -289 -280 19.9609 0.000699
NP_441557.1_5 Reverse -280 -289 19.9609 0.000699
NP_441557.1_6 Forward -313 -294 13.2741 0.187
NP_441557.1_8 Forward -312 -302 10.3043 0.289
NP_441445.1_1 Reverse -271 -290 8.35759 0.122
NP_442066.2_9 Forward -293 -280 10.2457 0.154
NP_442419.1_2 Forward -294 -275 9.14423 0.135
NP_441308.1_8 Reverse -278 -288 10.1081 0.22
NP_442192.1_5 Reverse -20 -39 14.1591 0.193
NP_442183.1_1 Forward -289 -275 19.4691 0.00583
NP_442183.1_1 Reverse -280 -294 16.0275 0.0167
NP_441467.1_5 Reverse -200 -210 14.6313 0.276
NP_442347.1_2 Reverse -281 -290 12.4878 0.056
NP_442347.1_2 Forward -288 -279 11.1111 0.056
NP_442645.1_2 Forward -297 -278 -10.7186 0.144
NP_440547.1_1 Reverse -284 -303 6.98015 0.297
NP_441037.1_4 Forward -291 -281 9.55921 0.21
NP_441037.1_4 Reverse -278 -288 7.02532 0.237
NP_442594.1_8 Forward -390 -371 7.66927 0.213
NP_441633.1_3 Reverse -278 -291 6.01747 0.0481
NP_441633.1_3 Forward -291 -278 1.29759 0.109
NP_441633.1_8 Forward -195 -176 15.0441 0.235
NP_440136.1_2 Forward -288 -281 15.9687 0.0123
NP_440136.1_2 Reverse -281 -288 15.9687 0.0123
NP_442998.1_5 Forward -47 -37 9.02648 0.256
NP_442998.1_5 Reverse -309 -319 8.23984 0.267
NP_442998.1_10 Forward -287 -280 15.5754 0.0102
NP_442998.1_10 Reverse -282 -289 15.5754 0.0102
NP_440299.1_1 Forward -293 -280 22.2414 0.000575
NP_440299.1_1 Reverse -365 -378 2.772 0.274
NP_440299.1_1 Reverse -276 -289 2.28034 0.292
NP_440299.1_5 Reverse -223 -242 10.9142 0.265
NP_441799.1_1 Reverse -276 -290 8.75042 0.106
NP_441799.1_1 Forward -293 -279 6.29216 0.176
NP_441007.1_10 Forward -294 -281 10.8357 0.0646
NP_441007.1_10 Forward -383 -370 0.510939 0.226
NP_440256.1_1 Forward -292 -273 -2.75381 0.122
NP_441090.1_6 Forward -175 -161 9.5377 0.261
NP_441512.1_4 Reverse -276 -295 7.27595 0.278
NP_441559.1_8 Forward -34 -20 -7.2769 0.289
NP_440915.1_6 Forward -293 -279 13.0776 0.0198
NP_440915.1_6 Forward -93 -79 5.89945 0.0879
NP_440915.1_6 Reverse -276 -290 -3.147 0.29
NP_440717.1_2 Reverse -295 -314 -10.227 0.245
NP_442785.1_1 Reverse -172 -191 17.3057 0.193
NP_441704.1_8 Forward -300 -281 10.2251 0.162
NP_440748.1_5 Reverse -93 -112 1.0811 0.24
NP_440748.1_5 Forward -286 -267 -2.85214 0.283
NP_440695.1_6 Reverse -97 -111 12.2535 0.264
NP_441939.1_3 Reverse -281 -300 9.24257 0.151
NP_441199.1_6 Reverse -276 -295 7.07928 0.12
NP_442993.1_1 Forward -289 -273 1.63183 0.0504
NP_440677.1_6 Reverse -102 -121 10.5209 0.265
NP_442386.1_9 Reverse -279 -288 15.7322 0.0144
NP_442386.1_9 Forward -290 -281 13.8639 0.0289
NP_442386.1_9 Reverse -223 -232 8.2591 0.205
NP_440570.1_4 Forward -304 -286 1.69077 0.238
NP_440570.1_5 Forward -299 -280 -2.75381 0.28
NP_441750.1_4 Forward -307 -288 11.4058 0.145
NP_441340.1_5 Forward -288 -281 15.6737 0.0124
NP_441340.1_5 Reverse -281 -288 15.6737 0.0124
NP_441340.1_5 Reverse -370 -377 3.97235 0.274
NP_441340.1_9 Reverse -30 -40 18.4743 0.194
NP_440186.1_2 Forward -63 -44 20.2654 0.0677
NP_442484.1_2 Reverse -290 -309 -1.67217 0.295
NP_440168.1_4 Forward -299 -280 -4.13045 0.255
NP_440161.1_3 Forward -291 -272 11.8975 0.196
NP_440586.1_8 Forward -288 -281 13.2151 0.026
NP_440586.1_8 Reverse -281 -288 13.2151 0.026
NP_440586.1_8 Reverse -370 -377 9.57686 0.146
NP_442251.1_6 Forward -288 -281 15.2804 0.0124
NP_442251.1_6 Reverse -281 -288 15.2804 0.0124
NP_440684.1_9 Reverse -274 -288 8.94771 0.221
NP_441262.1_3 Reverse -280 -287 14.7888 0.0223
NP_441262.1_3 Forward -289 -282 14.7888 0.0223
NP_440027.1_8 Reverse -151 -170 4.91521 0.285
NP_443051.1_1 Reverse -279 -288 10.4228 0.00754
NP_443051.1_1 Forward -290 -281 10.4228 0.00754
NP_443051.1_1 Forward -379 -370 0.0980582 0.226
NP_439996.1_6 Forward -284 -265 6.1641 0.298
NP_441595.1_5 Forward -296 -278 8.86894 0.217
NP_440439.1_1 Forward -292 -279 1.29759 0.157
NP_440439.1_1 Reverse -277 -290 1.19926 0.159
NP_440439.1_1 Reverse -301 -314 0.215946 0.199
NP_440372.1_2 Forward -288 -281 16.3621 0.0124
NP_440372.1_2 Reverse -281 -288 16.3621 0.0124
NP_441138.1_5 Forward -273 -260 6.8417 0.261
NP_441138.1_5 Forward -276 -263 2.92653 0.297
NP_441181.1_6 Reverse -218 -236 2.47742 0.295
NP_441789.1_7 Forward -312 -293 0.490334 0.245
NP_440316.1_10 Forward -296 -286 7.15819 0.251
NP_440316.1_10 Forward -298 -288 6.56821 0.257
NP_441803.1_2 Forward -378 -359 9.73422 0.095
NP_441803.1_2 Reverse -275 -294 2.75272 0.204
NP_439977.1_5 Forward -295 -276 3.44104 0.159
NP_439977.1_5 Reverse -274 -293 -1.57384 0.256
NP_440139.1_1 Reverse -274 -293 12.3883 0.0774
NP_441572.1_1 Forward -291 -272 -1.18052 0.212
NP_440267.1_2 Reverse -275 -289 9.43874 0.156
NP_442384.1_10 Reverse -280 -293 11.6223 0.0341
NP_442384.1_10 Forward -259 -246 3.36254 0.193
NP_442114.1_8 Reverse -204 -218 7.17714 0.234
NP_441877.1_5 Forward -44 -25 -0.197208 0.276
NP_441877.1_7 Reverse -275 -294 16.9115 0.0595
NP_441018.1_7 Forward -99 -80 14.9458 0.118
NP_441018.1_7 Forward -218 -199 7.7676 0.265
NP_442790.1_4 Forward -298 -279 -8.94866 0.176
NP_442262.1_10 Forward -288 -281 14.1988 0.0123
NP_442262.1_10 Reverse -281 -288 14.1988 0.0123
NP_441689.1_5 Reverse -278 -288 8.53436 0.132
NP_441689.1_5 Forward -291 -281 5.87944 0.197
NP_440163.1_10 Reverse -277 -287 15.2213 0.0762
NP_440344.1_10 Reverse -273 -290 9.57695 0.00836
NP_440344.1_10 Forward -296 -279 -1.63279 0.0557
NP_442123.1_3 Forward -378 -359 14.2574 0.148
NP_442529.1_4 Reverse -360 -379 9.53756 0.235
NP_442529.1_9 Reverse -238 -257 15.8307 0.234
NP_442556.1_10 Forward -217 -198 12.173 0.217
NP_440297.1_9 Forward -288 -278 9.32148 0.0917
NP_440297.1_9 Reverse -281 -291 -0.216628 0.282
NP_441896.1_3 Forward -298 -279 17.699 0.0308
NP_442067.1_4 Forward -300 -281 2.75272 0.289
NP_440999.1_9 Reverse -276 -290 4.62115 0.116
NP_440888.1_2 Reverse -280 -294 20.4518 0.000632
NP_440888.1_2 Forward -289 -275 14.5519 0.0168
NP_440888.1_2 Reverse -288 -302 6.78381 0.22
NP_440491.1_1 Reverse -277 -296 16.7602 0.0587
NP_442033.1_10 Reverse -278 -297 -5.60541 0.179
NP_441949.1_2 Reverse -270 -289 4.03102 0.261
NP_441543.1_2 Forward -288 -279 18.486 0.00236
NP_441543.1_2 Reverse -281 -290 16.9127 0.00359
NP_441543.1_2 Reverse -370 -379 4.22796 0.267
NP_442845.1_2 Forward -295 -281 8.06273 0.195
NP_441834.1_7 Forward -301 -282 17.404 0.209
NP_441304.1_10 Forward -159 -150 12.5861 0.297
NP_440982.1_1 Reverse -80 -99 8.06178 0.294
NP_441469.1_8 Reverse -279 -288 16.126 0.00797
NP_441469.1_8 Forward -290 -281 6.48957 0.227
NP_443064.1_6 Reverse -280 -290 12.5669 0.0796
NP_442578.1_7 Forward -288 -281 14.5921 0.026
NP_442578.1_7 Reverse -281 -288 14.5921 0.026
NP_441462.1_2 Forward -289 -279 11.5831 0.00406
NP_441462.1_2 Reverse -280 -290 11.5831 0.00406
NP_441621.1_7 Reverse -278 -292 -3.147 0.188
NP_441621.1_7 Forward -291 -277 -3.44199 0.188
NP_441621.1_7 Reverse -367 -381 -6.09693 0.275
NP_443062.1_1 Forward -289 -271 9.22847 0.138
NP_443062.1_1 Reverse -80 -98 3.67056 0.289
NP_443062.1_6 Reverse -272 -291 3.34271 0.239
NP_442204.1_1 Forward -251 -240 0.94365 0.281
NP_441560.1_8 Forward -294 -275 16.9664 0.06
NP_440516.1_8 Forward -289 -280 16.9127 0.00442
NP_440516.1_8 Reverse -280 -289 16.9127 0.00442
NP_441785.1_1 Forward -289 -275 14.3866 0.161
NP_442080.1_7 Forward -146 -127 -1.18052 0.287
NP_442080.1_7 Forward -227 -208 -3.73712 0.291
NP_442428.1_4 Reverse -279 -298 2.26107 0.266
NP_442428.1_5 Forward -288 -281 15.8704 0.0124
NP_442428.1_5 Reverse -281 -288 15.8704 0.0124
NP_442428.1_5 Reverse -365 -372 7.90559 0.0969
NP_442428.1_5 Forward -377 -370 4.46401 0.267
NP_440673.1_3 Forward -287 -280 12.4288 0.0426
NP_440673.1_3 Reverse -282 -289 12.4288 0.0426
NP_441052.1_2 Reverse -280 -290 19.9412 0.00106
NP_441052.1_2 Forward -289 -279 10.5014 0.0285
NP_442219.1_8 Forward -299 -280 16.1877 0.0921
NP_442219.1_8 Reverse -276 -295 8.84354 0.241
NP_442219.1_9 Reverse -281 -290 17.7976 0.00718
NP_442219.1_9 Forward -288 -279 8.35786 0.0681
NP_440436.1_4 Forward -288 -279 18.1905 0.00233
NP_440436.1_4 Reverse -281 -290 17.2072 0.00233
NP_440436.1_4 Reverse -324 -333 4.22755 0.277
NP_441884.1_9 Reverse -277 -296 -3.3438 0.0594
NP_440314.1_9 Reverse -281 -300 -7.17871 0.237
NP_440314.1_9 Reverse -206 -225 -8.26035 0.246
NP_441719.1_4 Forward -288 -281 16.3621 0.0124
NP_441719.1_4 Reverse -281 -288 16.3621 0.0124
NP_441719.1_6 Reverse -284 -303 5.40686 0.29
NP_441733.1_10 Forward -292 -279 16.9322 0.0382
NP_441004.1_1 Forward -295 -276 -12.7836 0.251
NP_441004.1_5 Forward -293 -279 7.07942 0.292
NP_442813.1_4 Reverse -286 -305 -6.29373 0.299
NP_442366.1_3 Forward -290 -272 4.05072 0.101
NP_442366.1_3 Reverse -279 -297 -5.38906 0.287
NP_441034.1_4 Forward -378 -359 15.6155 0.208
NP_440129.1_10 Reverse -273 -287 3.8345 0.189
NP_442873.1_9 Forward -299 -280 19.5664 0.0651
NP_441115.1_4 Reverse -368 -386 17.2262 0.0197
NP_440328.1_4 Reverse -370 -389 -0.0988766 0.267
NP_443054.1_2 Forward -291 -277 3.34284 0.24
NP_443054.1_2 Reverse -278 -292 3.14618 0.24
NP_441851.1_10 Reverse -279 -289 16.008 0.00552
NP_441851.1_10 Forward -290 -280 15.8113 0.00552
NP_442622.1_1 Reverse -285 -304 3.24438 0.177
NP_442515.1_1 Reverse -279 -293 4.91614 0.107
NP_442515.1_1 Forward -290 -276 2.75286 0.13
NP_441683.1_7 Reverse -192 -211 -5.31042 0.255
NP_440940.1_7 Reverse -270 -288 3.65664 0.274
NP_440432.1_9 Forward -288 -273 8.33803 0.0427
NP_440432.1_9 Reverse -287 -302 -2.67504 0.175
NP_440474.1_8 Forward -288 -274 14.7486 0.0595
NP_440474.1_8 Forward -377 -363 7.96378 0.196
NP_441124.1_5 Forward -136 -126 11.7668 0.245
NP_442450.1_5 Reverse -278 -288 9.32148 0.115
NP_442450.1_5 Reverse -19 -29 6.17489 0.197
NP_442168.1_5 Reverse -365 -384 3.53937 0.23
NP_442006.1_2 Forward -304 -287 -7.43431 0.173
NP_440483.1_1 Forward -302 -283 -0.197208 0.199
NP_441570.1_1 Forward -289 -271 -9.51896 0.139
NP_441078.1_4 Forward -289 -280 19.6659 0.0007
NP_441078.1_4 Reverse -280 -289 19.6659 0.0007
NP_441078.1_4 Forward -378 -369 -2.06522 0.295
NP_442729.1_8 Forward -293 -280 18.2105 0.0325
NP_441663.1_7 Forward -292 -273 4.62101 0.266
NP_440526.1_3 Reverse -281 -292 10.7762 0.0646
NP_440526.1_3 Reverse -81 -92 8.4163 0.125
NP_440526.1_3 Forward -288 -277 1.92649 0.267
NP_440526.1_3 Reverse -370 -381 0.746521 0.271
NP_441432.1_8 Forward -290 -281 16.8143 0.00595
NP_441432.1_8 Reverse -279 -288 8.25953 0.0755
NP_441432.1_8 Forward -379 -370 4.32629 0.223
NP_442320.1_8 Forward -295 -281 15.4376 0.0102
NP_442320.1_8 Reverse -274 -288 12.8809 0.016
NP_441732.1_2 Reverse -276 -292 -6.7263 0.0495
NP_440760.1_1 Reverse -280 -299 5.50599 0.0121
NP_442797.1_7 Reverse -279 -297 4.9357 0.217
NP_440199.1_10 Reverse -277 -287 14.533 0.0861
NP_442727.1_1 Reverse -294 -308 12.8809 0.256
NP_442400.1_10 Forward -104 -91 7.60564 0.284
NP_440713.1_4 Forward -99 -80 4.22769 0.231
NP_440713.1_4 Reverse -294 -313 2.75272 0.257
NP_442489.1_7 Forward -289 -280 20.1576 0.000695
NP_442489.1_7 Reverse -280 -289 20.1576 0.000695
NP_442489.1_7 Forward -378 -369 -1.37691 0.195
NP_440559.1_1 Reverse -281 -290 17.4043 0.00658
NP_440559.1_1 Forward -288 -279 8.75118 0.0586
NP_441659.2_8 Reverse -280 -290 18.1713 0.00133
NP_441659.2_8 Forward -289 -279 11.9764 0.0147
NP_441659.2_8 Reverse -369 -379 5.97822 0.0909
NP_441022.1_1 Forward -43 -34 15.0954 0.183
NP_442913.1_10 Forward -387 -368 -0.590531 0.161
NP_442913.1_10 Forward -20 -1 -2.26216 0.183
NP_442913.1_10 Forward -298 -279 -5.80207 0.279
NP_440442.1_3 Forward -296 -282 18.5841 0.162
NP_441800.1_7 Reverse -81 -99 -3.81576 0.281
NP_440779.1_5 Reverse -286 -303 -14.5141 0.246
NP_440779.1_5 Forward -289 -272 -14.8091 0.274
NP_442346.1_5 Forward -290 -280 16.6963 0.00248
NP_442346.1_5 Reverse -279 -289 9.02648 0.118
NP_442346.1_5 Forward -379 -369 4.50326 0.286
NP_442346.1_5 Reverse -368 -378 4.3066 0.291
NP_440352.1_5 Reverse -300 -319 11.0983 0.267
NP_440545.1_3 Forward -382 -365 5.74204 0.0597
NP_440545.1_3 Reverse -365 -382 3.0871 0.089
NP_440545.1_3 Forward -293 -276 -4.18939 0.22
NP_441856.1_3 Reverse -18 -37 -2.95047 0.272
NP_440831.1_3 Forward -298 -279 8.71699 0.221
NP_440250.1_3 Reverse -117 -136 16.0265 0.17
NP_441653.1_2 Reverse -269 -288 3.14308 0.274
NP_441653.1_2 Forward -389 -370 2.65991 0.289
NP_440010.1_4 Reverse -276 -295 6.88182 0.197
NP_440010.1_4 Forward -299 -280 -1.67294 0.267
NP_440010.1_10 Forward -256 -237 4.52268 0.244
NP_442603.1_7 Reverse -280 -294 12.192 0.102
NP_441888.1_7 Reverse -275 -289 2.35953 0.225
NP_441948.1_4 Reverse -273 -291 -2.14413 0.16
NP_441833.1_4 Forward -288 -281 15.9687 0.0124
NP_441833.1_4 Reverse -281 -288 15.9687 0.0124
NP_440751.1_8 Reverse -281 -300 6.98095 0.233
NP_442436.1_4 Forward -218 -204 13.8643 0.218
NP_442162.1_9 Forward -288 -281 16.2637 0.0124
NP_442162.1_9 Reverse -281 -288 16.2637 0.0124
NP_440671.1_4 Reverse -274 -288 8.55439 0.195
NP_441915.1_4 Reverse -285 -304 9.93006 0.28
NP_442199.1_5 Reverse -272 -291 3.93269 0.117
NP_442140.1_3 Reverse -281 -291 13.5497 0.0542
NP_442140.1_3 Forward -288 -278 8.33817 0.119
NP_440875.1_9 Forward -287 -277 8.37203 0.233
NP_440875.1_9 Reverse -366 -376 7.88535 0.255
NP_440875.1_9 Forward -376 -366 6.91198 0.294
NP_441813.1_5 Reverse -278 -288 17.188 0.00979
NP_441813.1_5 Forward -291 -281 8.73149 0.0367
NP_441259.1_8 Reverse -238 -257 11.0117 0.264
NP_440590.1_4 Reverse -281 -294 19.4888 0.00651
NP_440590.1_4 Forward -288 -275 -3.81562 0.255
NP_440567.1_1 Reverse -281 -295 16.1259 0.0166
NP_440567.1_1 Forward -288 -274 5.80112 0.0959
NP_440719.1_1 Forward -305 -286 19.0757 0.0467
NP_442497.1_10 Forward -288 -279 10.4228 0.0087
NP_442497.1_10 Reverse -281 -290 10.4228 0.0087
NP_440821.1_4 Reverse -278 -288 19.0562 0.00399
NP_440821.1_4 Forward -291 -281 17.9746 0.00497
NP_441239.1_9 Reverse -278 -290 13.3137 0.037
NP_441239.1_9 Forward -291 -279 9.67541 0.0987
NP_441239.1_9 Reverse -367 -379 5.64384 0.213
NP_441951.1_4 Forward -295 -276 2.3594 0.283
NP_441951.1_9 Reverse -10 -29 3.44104 0.254
NP_442643.1_1 Reverse -14 -33 -6.88371 0.231
NP_441017.1_6 Reverse -276 -290 12.487 0.217
NP_441769.1_3 Forward -339 -320 0.785326 0.22
NP_440949.1_7 Reverse -272 -291 17.2065 0.144
NP_440949.1_7 Reverse -251 -270 10.2251 0.242
NP_440354.1_7 Forward -295 -277 18.6037 0.167
NP_442138.1_10 Forward -289 -270 1.67108 0.121
NP_442052.1_8 Forward -53 -43 12.8614 0.253
NP_440546.1_4 Forward -289 -279 11.8882 0.0679
NP_440546.1_4 Reverse -280 -290 10.046 0.109
NP_440546.1_4 Forward -297 -287 6.74945 0.282
NP_440675.1_3 Forward -259 -240 5.70265 0.277
NP_440462.1_6 Reverse -278 -288 15.418 0.0142
NP_440462.1_6 Forward -291 -281 10.3048 0.0396
NP_442611.1_1 Reverse -280 -299 -2.95047 0.295
NP_440868.1_4 Reverse -276 -288 8.49544 0.0602
NP_440868.1_4 Forward -293 -281 0.333971 0.217
NP_442499.1_3 Reverse -279 -297 13.0972 0.199
NP_442479.1_9 Forward -42 -23 -13.5702 0.288
NP_441848.1_4 Forward -52 -36 13.1847 0.195
NP_441084.1_6 Reverse -321 -335 9.8289 0.263
NP_442039.1_4 Forward -288 -281 15.1821 0.0124
NP_442039.1_4 Reverse -281 -288 15.1821 0.0124
NP_441811.1_4 Forward -383 -364 1.17943 0.29
NP_441811.1_8 Forward -295 -281 13.8643 0.175
NP_441926.1_3 Forward -289 -273 6.9417 0.17
NP_440825.1_6 Forward -44 -25 11.7008 0.277
NP_442837.1_3 Forward -288 -281 15.7721 0.0124
NP_442837.1_3 Reverse -281 -288 15.7721 0.0124
NP_442053.1_1 Forward -289 -280 18.3876 0.0007
NP_442053.1_1 Reverse -280 -289 18.3876 0.0007
NP_440505.1_3 Forward -291 -281 16.598 0.00683
NP_440505.1_3 Reverse -278 -288 13.8447 0.0247
NP_442532.1_7 Forward -378 -364 11.2093 0.132
NP_442532.1_7 Reverse -280 -294 7.9644 0.171
NP_442009.1_5 Reverse -286 -305 18.7807 0.153
NP_440914.1_1 Reverse -280 -290 17.5935 0.000537
NP_440914.1_1 Forward -378 -368 11.3477 0.097
NP_440914.1_1 Forward -289 -279 8.6151 0.186
NP_441011.1_8 Forward -288 -279 16.9127 0.00602
NP_441011.1_8 Reverse -281 -290 8.25953 0.144
NP_442101.1_10 Forward -297 -278 -9.24366 0.245
NP_442533.1_6 Forward -289 -280 17.2076 0.00137
NP_442533.1_6 Reverse -280 -289 17.2076 0.00137
NP_442533.1_6 Forward -313 -304 4.52295 0.179
NP_442533.1_6 Reverse -250 -259 2.458 0.255
NP_442229.1_1 Forward -291 -277 8.94708 0.184
NP_443016.1_1 Forward -319 -300 -0.000545616 0.208
NP_441219.1_1 Reverse -286 -305 0.0977854 0.239
NP_441482.1_7 Forward -295 -281 -0.885388 0.0612
NP_441482.1_7 Reverse -274 -288 -10.9151 0.222
NP_439944.1_9 Reverse -281 -291 19.1546 0.00329
NP_439944.1_9 Forward -288 -278 10.3048 0.0887
NP_439944.1_9 Reverse -370 -380 6.17489 0.192
NP_441028.1_6 Forward -119 -109 3.71617 0.281
NP_441527.1_4 Reverse -60 -79 -3.1994 0.164
NP_441527.1_4 Reverse -262 -281 -7.87851 0.239
NP_441527.1_4 Reverse -259 -278 -11.8892 0.284
NP_441527.1_4 Reverse -260 -279 -12.3666 0.285
NP_441527.1_8 Reverse -260 -279 2.3594 0.279
NP_440115.1_6 Forward -292 -282 9.7148 0.115
NP_441602.1_3 Forward -294 -275 4.42435 0.153
NP_441106.1_1 Reverse -279 -288 18.191 0.0028
NP_441106.1_1 Forward -379 -370 11.9961 0.0311
NP_441106.1_1 Forward -290 -281 9.63616 0.0311
NP_441420.1_1 Reverse -279 -298 -5.99873 0.297
NP_441216.1_5 Reverse -284 -303 12.9783 0.224
NP_439903.1_6 Reverse -277 -296 2.06362 0.233
NP_439903.1_6 Reverse -33 -52 -1.37794 0.299
NP_441286.1_1 Forward -290 -278 14.4936 0.00418
NP_441286.1_1 Reverse -279 -291 12.1337 0.0104
NP_440670.1_8 Forward -289 -280 18.3876 0.000699
NP_440670.1_8 Reverse -280 -289 18.3876 0.000699
NP_440670.1_8 Forward -378 -369 4.91628 0.179
NP_440670.1_8 Forward -11 -2 3.14632 0.296
NP_441647.1_8 Forward -317 -298 12.9783 0.258
NP_442463.1_3 Forward -259 -240 15.1424 0.222
NP_440886.1_7 Reverse -279 -289 17.7774 0.0011
NP_440886.1_7 Forward -290 -280 7.94438 0.0805
NP_440828.1_1 Forward -311 -292 -0.00131823 0.269
NP_440197.1_8 Reverse -284 -303 14.6508 0.289
NP_440404.1_9 Reverse -113 -132 13.5117 0.2
NP_442072.1_9 Forward -290 -272 -12.5672 0.0852
NP_442072.1_9 Reverse -368 -386 -22.892 0.266
NP_442401.1_2 Reverse -279 -298 10.1267 0.186
NP_441753.1_10 Reverse -271 -290 14.3558 0.0803
NP_440907.2_8 Reverse -281 -291 10.8943 0.0969
NP_440907.2_8 Forward -288 -278 7.84605 0.117
NP_442264.1_2 Forward -299 -282 9.57695 0.196
NP_439967.1_3 Reverse -214 -232 13.4906 0.295
NP_441021.1_1 Reverse -281 -300 -0.590531 0.104
NP_441021.1_1 Forward -288 -269 -7.67036 0.187
NP_440666.1_2 Reverse -248 -267 10.8159 0.21
NP_441463.1_3 Reverse -270 -289 10.3242 0.0481
NP_441463.1_3 Reverse -359 -378 5.11266 0.0778
NP_441463.1_6 Reverse -278 -292 8.63851 0.25
NP_441626.1_2 Forward -288 -281 15.7721 0.0124
NP_441626.1_2 Reverse -281 -288 15.7721 0.0124
NP_440107.1_5 Reverse -279 -298 7.47261 0.139
NP_442794.1_1 Forward -293 -281 10.1671 0.0721
NP_442615.1_1 Forward -298 -280 -1.75081 0.132
NP_441962.1_4 Forward -294 -275 11.2092 0.0495
NP_440387.1_1 Reverse -280 -296 23.8546 0.00136
NP_440387.1_1 Forward -289 -273 7.13836 0.0282
NP_441431.1_2 Forward -307 -293 6.98048 0.255
NP_441431.1_2 Reverse -277 -291 5.70218 0.291
NP_441993.1_1 Forward -295 -276 5.74752 0.195
NP_441993.1_1 Forward -303 -284 5.65007 0.198
NP_441993.1_1 Reverse -280 -299 1.55686 0.274
NP_442224.1_1 Reverse -278 -297 -2.36049 0.233
NP_440467.1_3 Reverse -370 -389 15.5533 0.128
NP_440467.1_8 Reverse -357 -376 13.3725 0.192
NP_440114.1_10 Forward -289 -275 15.7325 0.0234
NP_440114.1_10 Forward -378 -364 7.47274 0.235
NP_441510.2_7 Reverse -274 -288 12.3887 0.28
NP_440766.1_4 Forward -293 -279 9.34103 0.0871
NP_440766.1_5 Reverse -164 -176 7.75128 0.288
NP_439988.1_7 Forward -376 -362 16.2235 0.292
NP_440422.1_10 Forward -280 -261 19.5047 0.0998
NP_441237.1_9 Reverse -281 -291 14.9263 0.0242
NP_439910.1_2 Reverse -272 -289 7.217 0.00636
NP_442867.1_8 Reverse -296 -315 7.66927 0.242
NP_440457.1_1 Forward -293 -281 5.34885 0.141
NP_440457.1_1 Forward -93 -81 2.20226 0.216
NP_440457.1_1 Reverse -276 -288 0.0389777 0.25
NP_440798.1_6 Reverse -370 -383 1.49425 0.212
NP_441984.1_3 Reverse -276 -294 5.82068 0.276
NP_442509.1_9 Forward -289 -279 16.2041 0.00739
NP_442509.1_9 Reverse -280 -290 8.14104 0.192
NP_442936.1_7 Forward -225 -206 9.93088 0.19
NP_440554.1_4 Forward -288 -278 14.6313 0.02
NP_440554.1_4 Reverse -281 -291 6.37155 0.123
NP_440554.1_4 Reverse -370 -380 2.63497 0.258
NP_442737.1_5 Forward -203 -184 11.2307 0.294
NP_441885.1_5 Reverse -280 -290 20.9245 0.000538
NP_441885.1_5 Forward -289 -279 11.4848 0.00668
NP_440649.2_8 Reverse -300 -314 8.94771 0.282
NP_442341.1_7 Reverse -279 -293 19.6658 0.00719
NP_442341.1_7 Forward -290 -276 10.0294 0.0682
NP_441756.1_5 Forward -306 -287 -3.83545 0.29
NP_442395.2_4 Reverse -279 -298 4.62021 0.18
NP_443000.1_7 Forward -291 -281 10.4031 0.0345
NP_443000.1_7 Reverse -278 -288 8.73149 0.0437
NP_440507.2_3 Forward -298 -279 23.4013 0.00495
NP_440507.2_3 Forward -382 -363 9.24175 0.227
NP_442513.1_5 Forward -297 -278 10.3234 0.266
NP_441842.1_10 Forward -296 -282 15.0442 0.0474
NP_442122.1_9 Forward -297 -278 19.9606 0.108
NP_440275.1_3 Forward -291 -281 17.6796 0.0102
NP_440275.1_3 Reverse -278 -288 8.4365 0.0602
NP_440275.1_3 Forward -380 -370 6.07655 0.126
NP_440091.1_1 Reverse -276 -288 18.3285 0.0114
NP_440091.1_1 Forward -293 -281 1.41561 0.197
NP_442275.1_1 Forward -313 -294 11.5042 0.222
NP_441902.1_1 Reverse -65 -84 12.4867 0.282
NP_441122.1_1 Reverse -38 -53 3.32315 0.281
NP_439962.1_4 Forward -297 -278 1.37609 0.197
NP_440149.1_8 Reverse -280 -299 -1.18052 0.157
NP_440149.1_8 Forward -289 -270 -6.78538 0.261
NP_441105.1_3 Forward -300 -281 -1.27885 0.147
NP_441730.1_3 Forward -148 -130 15.0428 0.224
NP_440216.1_1 Forward -289 -275 6.29277 0.0156
NP_440216.1_1 Reverse -280 -294 -10.7185 0.146
NP_440216.1_1 Reverse -369 -383 -12.0951 0.24
NP_440216.1_9 Reverse -28 -37 6.19458 0.289
NP_440172.1_1 Reverse -280 -290 15.0247 0.00945
NP_440172.1_1 Forward -289 -279 8.73149 0.0586
NP_442015.1_10 Forward -293 -280 3.5592 0.179
NP_442015.1_10 Reverse -276 -289 0.904263 0.216
NP_441226.1_7 Forward -288 -281 14.4934 0.0123
NP_441226.1_7 Reverse -281 -288 14.4934 0.0123
NP_441226.1_7 Reverse -81 -88 8.29857 0.205
NP_441111.1_7 Forward -288 -280 18.7023 0.00294
NP_441111.1_7 Reverse -281 -289 18.7023 0.00294
NP_440244.1_8 Forward -332 -313 1.86774 0.297
NP_441766.1_2 Forward -289 -280 17.5026 0.00297
NP_441766.1_2 Reverse -280 -289 17.5026 0.00297
NP_442252.1_3 Reverse -273 -291 11.1305 0.185
NP_440416.1_9 Forward -296 -277 -15.2418 0.187
NP_443052.1_8 Reverse -270 -289 8.25926 0.0256
NP_440845.1_1 Forward -157 -138 -3.24547 0.205
NP_440591.1_9 Forward -296 -278 7.88563 0.193
NP_442154.1_1 Forward -297 -279 -15.2222 0.218
NP_442154.1_1 Reverse -287 -305 -17.0904 0.249
NP_442154.1_1 Forward -303 -285 -17.3854 0.254
NP_442154.1_1 Forward -83 -65 -18.2704 0.279
NP_440261.1_5 Reverse -281 -294 -10.4038 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGTAGATTCCTACGATACGGGAGACGATGGCATCACTGATGCAGCCCGTAGATATTGGTTGCAGTTCCAACAATGGTTTGATAATTTGCCCCTCCCCGCCAAAGGCGCTGTGGCGATCGCCGTTTTGTTTGTTGCTTTTTCGGTGCTGACCCAGGTGCTGAAGTTTGTGGCTTCCCTGGTCACTTTGGCTATTTTGCTCGTCATTCTCTACGGAGTTTATCGGGTCTTTCTGCGCCAGGATAAGGGTAATTGAACTTTGTCTAATTGCAGAATTTGTTTAGCTTCCCTCCACCCTGAAATTTGCTAGGAGTTGGGATGGGGTTCTTGCTGTACCTGTTTTTGATAACTGAACAAGGGCAAAAGTTTTCCTAGGGGTCGACCTTACTAGGGATGATTGGCC

CDS

ATGGCTGAGCCTAGGGCTGTCCTCAAACAGGGCAATCGGAATAGGGACAAGGATTCTGTCGGGCTGGGGAACAGGCTAAGATTTGTTAGTATCTCCTCTGCTCTGAACCCAATGACCTTTTCCTCCATACTCCGCCATCTGCAAACCTTACCGTTGAGCAAAGACCTGCGGGAAAAATTGCAAAAGCGGGGCCATGTGCAACTCAGTGGCCTACCCCGGTTACCCAAAGGCCTAATCGTTTCCAGTTTGGCCCAGTCCCTGGAGAAAAATCTTTTGGTCATCACTGCCACGTTGGAGGAAGCGGGGCGCTGGACAGCCCAGTTGGAACTGATGGGTTGGCAAACCGTTAATTTTTACCCCACTTCTGAAGCTTCCCCCTATGACCCTGGGCGACTAGAGTCGGAAATGGTTTGGGGACAAATGCAGGTGTTGGCAGAATTAATCCAGGGCCATCAGGTTAAGGGCAAGGCGATCGTCGCTACAGAAAAGGCCCTACAGCCCCATTTACCCCCGGTGGCAACCTTACGGGAATACTGTTTGGCCCTACGACGCGGTCAGGAGATGGATAGCAAAAGTCTGGAGCTTACCCTAGCGAGGTTGGGCTACGAGCGTGGCAGTACGGTGGAAACAGAGGGGCAATGGAGTCGGCGGGGGGATATTGTTGATATTTTCCCAGTGTCGGCGGAGCTACCGGTGCGGCTGGAATGGTTTGGTGATGAGTTGGAAAAAATCCGGGAGTTTGATCCTGCTAGCCAGCGTTCCTTGGATGACTTAACTGGTTTGGTGCTGACCCCCACCAGTTTTGATCAGGTGATCGAACCGGCGTTAAATGCCCAGGCCATTGATCTCTCTGCTTGGGGAGAAGATGCGGAAACGGAGCAATTATTCGGCAAAGAGGGATTACAGCGATTTTTGGGTCTCGCCTTTACTGAACCGGCTTGTTTATTAGATTATTTACCGACAGAAACAGTCTGTGTACTGGATGAACCAGAGCAATGTGCGGCCCACAGTGAACGGTGGTTTGAGGCGGTGGCCCAGGATTGGTCAGCTTTGCAGTTACCGAATTTACCCCAATTACATCGAAATTTTTCGGCCCTTGGCGATCGCCTAAAAACAGATTTTCAATACATTACCCTGTCAGAAATCCACGAAGCGAATGGGGATAGTTTAGATATTTCAGCTCGACCCATCCCCACCATGCCCCACCAGTTTGCTAAGTTGGCAGAAATTTTACGGGGGAAACGGGAAATTTATAGCGGTTTGACGTTGGGACAATACAGCACTTGGTTGATTTCAGCCCAGCCCAGTCGTACTGTTTCTTTGTTGCAGGAACATGATTGTGCGGTGCAATTTATTGCCAATCCGAGGGATTATCCTGCCATTGAAAAAAGTCAGATTCAACGGACAGCGGTGACGTTAAAGTATTCAGGATTAGCGGAATTAGAAGGGTTTATCTTACCGACCTTTCGTTTAGTTTTAGTCACGGATCGAGAATTATTTGGTCAGCATGCTTTAGCTACACCGGAATATGTGCGGAAACGGCGACGGGCTACGTCTAAACAAGTTGACATTAATAAACTTTCCCCTGGGGATTATGTAGTCCACAAAAGTCATGGCATTGGCAAATTTTTGAAGTTGGATGCGTTGGCTAATCGGGAATATTTAATGATCCAATATGCCGACGGCATTTTGCGGGTGCCCGCCGATAGTTTGGACAGTTTATCCCGCTTTCGCCATACGGGAACTAGACCTCCCGAACTGCATAAAATGGGCGGTAAAGTGTGGGAAGCCACCAAAAATAAAGTCCGCAAAGCAGTTAAAAAATTGGCCGTTGATTTGCTCAATCTTTATGCTAAGCGGGCAAAACAGGTGGGTTATGCCTATCCGCCGGATAGTCCCTGGCAACAGGAATTGGAAGATTCTTTCCCCTACCAACCCACCCCCGATCAACTAAAAGCAGTACAGGATGTGAAAAGGGATTTGGAAGGAGATCGCCCGATGGATAGATTAGTGTGTGGGGATGTGGGCTTTGGCAAAACAGAAGTGGCGGTGCGGGCCATTTTTAAGGCCGTGACCAGTGGCAATAAACAGGTGGCTTTACTAGCTCCCACCACGGTGTTAACCCAACAGCATTACCACACCCTTAAAGAAAGATTTGCTCCCTATCCCATCACCATTGGTTTACTGAATCGTTTTCGCACTGCTTCGGAGAAAAAGGAGATTTTAGCCAAGTTAAAAAGTGGTGAATTAGATATTGTGGTAGGTACCCAACAGGTATTAGGTACATCGGTAAAATTTAAAGATTTAGGACTTTTAGTTATTGACGAAGAACAGCGCTTTGGTGTTAACCAAAAGGAAAAAATTAAGACCCTGAAAACGGAAGTAGATGTATTAACCCTAACGGCAACTCCCATTCCCCGTACCCTTTATATGTCCCTTTCCGGCATTCGGGAAATGAGTCTGATTACCACACCGCCACCTTCCCGTCGCCCCATTAAAACCCATTTATCTCCCTACAATCCCGAAGTAATTCGCACCGCCATTCGTAACGAGCTAGACCGGGGTGGGCAGGTTTTTTATGTCGTGCCTCGCATTGAAGGTATTGAGGAATTGGGAGGACAACTGCGACAAATGGTGCCCAGTGCTCGCATTGCCATTGGTCATGGTCAAATGGAGGAATCTGAGTTGGAAAGTACTATGTTAGCTTTCAATGATGGTGAGGCGGACATTTTAGTTTGTACTACTATCATCGAAGCTGGTTTGGATATTCCCAGGGTAAACACAATTATTGTTGAAGATGCCCAAAAATTTGGCTTGGCCCAACTTTATCAACTGCGGGGTCGGGTAGGGCGATCGGGTATTCAAGCCCATGCTTGGTTGCTCTATCCTAACCAAAAACAGTTAACGGAAAAAGCTAGATTAAGACTGCGGGCATTGCAAGAATTCAGCCAACTTGGTTCCGGTTATCAACTGGCCACTAGGGATATGGAAATTCGGGGCGTAGGTAATCTTTTGGGTGCAGAACAATCGGGGCAAATGGAGGCGATCGGTTATGAGTTTTATATGGAGATGTTGCAAGATGCCATTAAAGAAATCCAGGGTCAGGAAATTCCCAAAGTGGAAGATACCCAAATAGATTTACCTCTCACTGCCTTTATTCCCAGCGACTACATTCCCGATTTAGAAGAAAAAATGGCCGCCTATCGTCGCATTACTAGCATTGAATCCACTGATGAGTTGCCGAAAATTGCCTTGGATTGGGGCGATCGGTATGGTATGTTACCAAGTCCGGTGGAGGAATTATTTAAAGTGGTTAAGCTCAAGCATTTAGCCAAATCCTTAGGCTTTTCTCGCATTAAAGTGGAGGGTAAACAAAATCTTGTCTTGGAAACGCCCATGGAGGAACCCGCTTGGAAATTATTAGCGGAAAATTTACCCAATCATCTCCAGTCCCGCTTTGTTTACAGTGCCAAAAAAGTGGTGGTGCGGGGTTTAGGAGTGTTGGCCCCAGCTAAGCAAATGGATAATTTAATTGACTGGTTTGGCAAGATGCAAGGGGCTTTACCAGAAACAAAAATGGAAACTTTAGTGGGTAAATAG

Protein

MAEPRAVLKQGNRNRDKDSVGLGNRLRFVSISSALNPMTFSSILRHLQTLPLSKDLREKLQKRGHVQLSGLPRLPKGLIVSSLAQSLEKNLLVITATLEEAGRWTAQLELMGWQTVNFYPTSEASPYDPGRLESEMVWGQMQVLAELIQGHQVKGKAIVATEKALQPHLPPVATLREYCLALRRGQEMDSKSLELTLARLGYERGSTVETEGQWSRRGDIVDIFPVSAELPVRLEWFGDELEKIREFDPASQRSLDDLTGLVLTPTSFDQVIEPALNAQAIDLSAWGEDAETEQLFGKEGLQRFLGLAFTEPACLLDYLPTETVCVLDEPEQCAAHSERWFEAVAQDWSALQLPNLPQLHRNFSALGDRLKTDFQYITLSEIHEANGDSLDISARPIPTMPHQFAKLAEILRGKREIYSGLTLGQYSTWLISAQPSRTVSLLQEHDCAVQFIANPRDYPAIEKSQIQRTAVTLKYSGLAELEGFILPTFRLVLVTDRELFGQHALATPEYVRKRRRATSKQVDINKLSPGDYVVHKSHGIGKFLKLDALANREYLMIQYADGILRVPADSLDSLSRFRHTGTRPPELHKMGGKVWEATKNKVRKAVKKLAVDLLNLYAKRAKQVGYAYPPDSPWQQELEDSFPYQPTPDQLKAVQDVKRDLEGDRPMDRLVCGDVGFGKTEVAVRAIFKAVTSGNKQVALLAPTTVLTQQHYHTLKERFAPYPITIGLLNRFRTASEKKEILAKLKSGELDIVVGTQQVLGTSVKFKDLGLLVIDEEQRFGVNQKEKIKTLKTEVDVLTLTATPIPRTLYMSLSGIREMSLITTPPPSRRPIKTHLSPYNPEVIRTAIRNELDRGGQVFYVVPRIEGIEELGGQLRQMVPSARIAIGHGQMEESELESTMLAFNDGEADILVCTTIIEAGLDIPRVNTIIVEDAQKFGLAQLYQLRGRVGRSGIQAHAWLLYPNQKQLTEKARLRLRALQEFSQLGSGYQLATRDMEIRGVGNLLGAEQSGQMEAIGYEFYMEMLQDAIKEIQGQEIPKVEDTQIDLPLTAFIPSDYIPDLEEKMAAYRRITSIESTDELPKIALDWGDRYGMLPSPVEELFKVVKLKHLAKSLGFSRIKVEGKQNLVLETPMEEPAWKLLAENLPNHLQSRFVYSAKKVVVRGLGVLAPAKQMDNLIDWFGKMQGALPETKMETLVGK