Your browser is old and dusty. Try Google Chrome!

Details for sll0271

ORF sll0271
Accession NP_441814.1
Symbol
Category RNA synthesis, modification, and DNA transcription
Definition N utilization substance protein B homolog
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -375 -361 3.93283 0.158
NP_440795.1_7 Forward -375 -368 14.6904 0.0123
NP_440795.1_7 Reverse -368 -375 14.6904 0.0123
NP_440694.1_1 Reverse -41 -60 18.584 0.138
NP_442291.1_5 Reverse -366 -382 7.43336 0.0643
NP_440897.1_6 Reverse -367 -386 -1.67294 0.194
NP_440897.1_6 Reverse -39 -58 -1.8696 0.198
NP_441453.1_4 Reverse -367 -375 16.539 0.00633
NP_441453.1_4 Forward -376 -368 16.539 0.00633
NP_441623.1_1 Forward -47 -29 -2.14413 0.241
NP_442151.1_6 Forward -376 -362 20.1574 0.0045
NP_440561.1_4 Reverse -37 -56 13.4051 0.229
NP_441818.1_1 Forward -375 -364 16.0861 0.0221
NP_441818.1_9 Forward -288 -269 -3.63879 0.228
NP_441818.1_9 Reverse -4 -23 -10.6203 0.296
NP_440226.1_1 Forward -376 -357 5.30933 0.161
NP_441465.1_8 Forward -357 -339 16.1454 0.0966
NP_442173.1_1 Forward -375 -367 15.4574 0.00633
NP_442173.1_1 Reverse -368 -376 15.4574 0.00633
NP_442752.1_4 Forward -376 -369 13.8055 0.0199
NP_442752.1_4 Reverse -367 -374 13.8055 0.0199
NP_443027.1_4 Reverse -365 -375 13.1564 0.0521
NP_442975.1_10 Reverse -363 -377 12.487 0.0477
NP_442975.1_10 Forward -380 -366 1.47397 0.297
NP_440784.1_7 Forward -375 -368 15.9687 0.0123
NP_440784.1_7 Reverse -368 -375 15.9687 0.0123
NP_442909.1_7 Reverse -368 -382 9.24208 0.156
NP_440061.1_9 Forward -378 -364 12.2903 0.0985
NP_440110.1_4 Forward -387 -368 13.6675 0.0777
NP_440110.1_8 Reverse -147 -166 -1.37718 0.238
NP_441054.1_2 Forward -282 -263 9.24257 0.299
NP_442062.1_8 Forward -376 -366 17.3846 0.00193
NP_442062.1_8 Reverse -367 -377 17.3846 0.00193
NP_440304.1_4 Reverse -365 -375 9.91146 0.051
NP_440304.1_4 Reverse -243 -253 4.20827 0.272
NP_440304.1_4 Forward -378 -368 1.84832 0.299
NP_442242.1_4 Forward -375 -368 14.3954 0.0124
NP_442242.1_4 Reverse -368 -375 14.3954 0.0124
NP_440044.1_8 Reverse -368 -387 5.01433 0.106
NP_439918.1_2 Reverse -77 -96 -2.75381 0.249
NP_441935.1_2 Forward -60 -41 -2.75381 0.253
NP_441619.1_8 Forward -382 -368 17.2068 0.0675
NP_441208.1_9 Reverse -49 -63 4.52282 0.299
NP_441594.1_6 Reverse -358 -377 3.53937 0.227
NP_442110.1_7 Forward -376 -362 8.65272 0.0851
NP_440856.1_7 Forward -135 -116 -4.91709 0.224
NP_441083.1_5 Forward -376 -366 20.3345 0.00053
NP_441083.1_5 Reverse -367 -377 20.3345 0.00053
NP_441083.1_5 Reverse -337 -347 2.92996 0.187
NP_441083.1_5 Reverse -264 -274 0.57002 0.223
NP_439957.1_9 Forward -124 -105 3.867 0.3
NP_441738.1_2 Forward -374 -367 15.28 0.0102
NP_441738.1_2 Reverse -369 -376 15.28 0.0102
NP_441738.1_2 Forward -59 -52 8.29857 0.176
NP_441558.1_5 Reverse -365 -384 4.03102 0.293
NP_440209.1_1 Reverse -367 -375 18.1123 0.00295
NP_440209.1_1 Forward -376 -368 18.1123 0.00295
NP_442889.1_8 Reverse -364 -378 12.8803 0.0599
NP_441713.1_1 Reverse -361 -380 3.04771 0.0568
NP_440178.1_7 Forward -377 -358 -22.8133 0.279
NP_442570.1_3 Forward -294 -275 -4.42544 0.23
NP_441716.1_1 Forward -376 -362 13.0776 0.0689
NP_441716.1_1 Reverse -367 -381 4.03116 0.259
NP_442111.1_4 Reverse -366 -380 9.34103 0.0609
NP_442111.1_4 Forward -377 -363 5.01447 0.181
NP_440343.1_3 Reverse -264 -282 2.87 0.288
NP_440906.1_5 Forward -375 -368 15.8704 0.0124
NP_440906.1_5 Reverse -368 -375 15.8704 0.0124
NP_440747.1_10 Forward -379 -367 14.887 0.00223
NP_440747.1_10 Reverse -364 -376 7.51213 0.00286
NP_441130.1_10 Forward -378 -364 7.66941 0.153
NP_441854.1_10 Forward -169 -150 3.14605 0.282
NP_441486.1_1 Reverse -364 -378 15.2409 0.0061
NP_441486.1_1 Forward -379 -365 5.80112 0.0344
NP_441265.1_3 Reverse -361 -375 3.14618 0.181
NP_440842.1_10 Forward -248 -234 3.93283 0.254
NP_441695.1_4 Reverse -263 -281 18.2104 0.112
NP_441695.1_8 Forward -286 -272 10.521 0.295
NP_442848.1_1 Forward -382 -368 6.78443 0.0791
NP_442848.1_1 Reverse -361 -375 6.29277 0.0791
NP_442848.1_5 Reverse -167 -185 2.67408 0.276
NP_443018.1_3 Forward -375 -368 14.8871 0.0123
NP_443018.1_3 Reverse -368 -375 14.8871 0.0123
NP_443018.1_3 Forward -47 -40 10.2655 0.107
NP_443018.1_3 Forward -253 -246 8.49558 0.141
NP_441634.1_8 Forward -378 -364 5.21113 0.114
NP_440376.1_1 Forward -376 -367 19.4693 0.000692
NP_440376.1_1 Reverse -367 -376 19.4693 0.000692
NP_440376.1_1 Reverse -52 -61 -0.0986038 0.285
NP_441588.1_4 Reverse -369 -379 15.9097 0.0369
NP_441588.1_4 Forward -374 -364 8.63316 0.14
NP_442687.1_7 Forward -377 -367 8.92815 0.0994
NP_442687.1_7 Reverse -366 -376 8.92815 0.0994
NP_442687.1_7 Forward -172 -162 4.0116 0.271
NP_442191.1_4 Reverse -232 -246 11.6718 0.247
NP_442191.1_4 Forward -285 -271 10.7992 0.288
NP_442485.1_3 Forward -173 -154 2.55606 0.209
NP_442485.1_3 Reverse -260 -279 -2.26216 0.262
NP_441846.1_10 Reverse -243 -262 -20.945 0.256
NP_440533.1_9 Forward -376 -357 5.30933 0.207
NP_442658.1_1 Reverse -365 -375 9.616 0.147
NP_442658.1_1 Forward -378 -368 6.76441 0.214
NP_442658.1_1 Reverse -243 -253 5.58445 0.262
NP_442782.1_2 Reverse -283 -297 4.03116 0.257
NP_441414.1_9 Reverse -367 -386 17.2074 0.00979
NP_442937.1_5 Reverse -362 -381 12.5858 0.105
NP_442937.1_5 Reverse -118 -137 10.2259 0.168
NP_442937.1_5 Forward -381 -362 9.0459 0.204
NP_441958.1_5 Forward -377 -367 12.2714 0.00183
NP_441958.1_5 Reverse -366 -376 12.2714 0.00183
NP_442836.1_5 Reverse -361 -380 8.45592 0.143
NP_442836.1_10 Forward -178 -168 9.22315 0.282
NP_440203.1_5 Forward -58 -48 10.4026 0.225
NP_439905.1_1 Forward -253 -240 9.75405 0.216
NP_439990.1_5 Reverse -362 -375 21.2588 0.00296
NP_442911.1_2 Forward -386 -367 -2.55715 0.0995
NP_442911.1_2 Reverse -357 -376 -3.04881 0.107
NP_443055.1_6 Forward -62 -44 -0.0799167 0.252
NP_440993.1_2 Forward -381 -365 1.14018 0.29
NP_440138.1_6 Reverse -246 -265 1.96529 0.273
NP_441099.1_5 Reverse -357 -376 7.07928 0.0429
NP_442002.1_9 Reverse -198 -205 12.4288 0.185
NP_441294.1_7 Reverse -363 -377 15.4899 0.0239
NP_441294.1_7 Forward -380 -366 11.9383 0.12
NP_441646.1_1 Forward -383 -364 17.699 0.0597
NP_442438.1_10 Reverse -362 -376 7.47274 0.0933
NP_442431.1_10 Reverse -123 -141 3.75572 0.213
NP_441752.1_6 Reverse -260 -279 2.26107 0.239
NP_440484.1_3 Reverse -365 -379 9.43936 0.263
NP_440147.1_4 Forward -378 -365 20.7671 0.00185
NP_440147.1_4 Forward -173 -160 2.67422 0.203
NP_440147.1_4 Reverse -365 -378 2.18257 0.209
NP_440147.1_4 Reverse -342 -355 -0.275709 0.279
NP_441175.1_7 Reverse -367 -386 5.80098 0.271
NP_441295.1_4 Reverse -40 -59 -5.31042 0.297
NP_441550.1_8 Reverse -365 -375 16.7941 0.00906
NP_441550.1_8 Forward -378 -368 14.6309 0.0132
NP_441916.1_7 Forward -376 -366 10.3048 0.0261
NP_441916.1_7 Reverse -367 -377 10.3048 0.0261
NP_441916.1_10 Reverse -359 -378 2.85105 0.24
NP_440206.1_4 Forward -284 -265 0.785326 0.289
NP_441041.1_4 Reverse -199 -218 -10.4236 0.232
NP_441041.1_7 Reverse -364 -376 12.4708 0.0611
NP_442396.1_5 Forward -380 -367 20.1771 0.00762
NP_441725.1_5 Forward -375 -365 9.02648 0.0553
NP_441725.1_5 Forward -253 -243 4.89658 0.115
NP_441725.1_5 Reverse -368 -378 2.04498 0.115
NP_441725.1_5 Forward -207 -197 -0.216628 0.241
NP_441725.1_5 Reverse -40 -50 -0.609952 0.265
NP_439966.1_7 Reverse -365 -375 14.8275 0.0177
NP_439966.1_7 Forward -378 -368 7.25606 0.15
NP_439966.1_9 Reverse -365 -374 0.884706 0.253
NP_440736.1_3 Reverse -43 -62 3.73603 0.282
NP_442941.1_3 Reverse -368 -378 11.0914 0.0116
NP_442941.1_3 Forward -375 -365 10.9931 0.0116
NP_440289.1_2 Reverse -364 -377 11.6223 0.0184
NP_440289.1_2 Forward -323 -310 -4.20895 0.283
NP_440289.1_2 Forward -379 -366 -4.9956 0.294
NP_440260.1_8 Forward -280 -262 0.904127 0.193
NP_441678.1_9 Reverse -244 -263 -3.83545 0.288
NP_442281.1_1 Reverse -362 -376 6.78381 0.115
NP_442281.1_1 Reverse -194 -208 3.24392 0.238
NP_442281.1_1 Forward -381 -367 1.5723 0.296
NP_442256.1_2 Reverse -365 -383 -9.22396 0.254
NP_001035871.2_7 Reverse -1 -11 13.2547 0.219
NP_001035871.2_7 Reverse -307 -317 11.6814 0.287
NP_442500.1_8 Forward -122 -108 8.73228 0.288
NP_440375.1_8 Reverse -338 -357 -1.47551 0.288
NP_441644.1_6 Forward -376 -366 17.3841 0.00127
NP_441644.1_6 Reverse -367 -377 17.3841 0.00127
NP_440867.1_10 Reverse -236 -255 2.65439 0.283
NP_442215.1_2 Forward -378 -362 7.53169 0.0679
NP_442215.1_2 Reverse -365 -381 1.73016 0.128
NP_440253.1_2 Forward -376 -358 21.652 0.00365
NP_440929.1_8 Forward -376 -367 19.2726 0.000701
NP_440929.1_8 Reverse -367 -376 19.2726 0.000701
NP_442933.1_10 Forward -376 -367 17.601 0.00325
NP_442933.1_10 Reverse -367 -376 17.601 0.00325
NP_441751.2_8 Forward -375 -361 2.75286 0.0759
NP_441751.2_8 Reverse -368 -382 -0.885388 0.129
NP_442554.1_4 Forward -163 -144 7.27595 0.291
NP_442554.1_8 Forward -375 -365 18.0729 0.00543
NP_442554.1_8 Reverse -368 -378 15.3197 0.00882
NP_442554.1_8 Reverse -40 -50 2.83163 0.253
NP_442075.1_3 Reverse -135 -154 13.2741 0.295
NP_442970.1_1 Reverse -56 -70 9.27434 0.277
NP_441762.1_7 Forward -377 -365 2.69391 0.0676
NP_441762.1_7 Reverse -366 -378 0.432302 0.0747
NP_442142.1_4 Reverse -364 -377 12.2117 0.0464
NP_442142.1_4 Forward -138 -125 3.16532 0.265
NP_442142.1_4 Forward -379 -366 2.96866 0.269
NP_442292.1_1 Forward -375 -366 18.486 0.00229
NP_442292.1_1 Reverse -368 -377 18.486 0.00229
NP_442476.1_6 Reverse -368 -382 5.70279 0.131
NP_443009.1_5 Reverse -366 -377 8.90795 0.0965
NP_443009.1_5 Forward -377 -366 8.90795 0.0965
NP_443009.1_5 Forward -363 -352 3.99143 0.268
NP_441715.1_4 Reverse -368 -378 7.94484 0.107
NP_441715.1_4 Forward -375 -365 7.84651 0.107
NP_441198.1_5 Reverse -369 -382 14.67 0.206
NP_440379.1_5 Forward -280 -261 6.88262 0.133
NP_440379.1_5 Forward -171 -152 -3.3438 0.204
NP_440464.1_10 Reverse -368 -378 13.0082 0.169
NP_441468.1_1 Forward -375 -368 15.8704 0.0124
NP_441468.1_1 Reverse -368 -375 15.8704 0.0124
NP_441020.2_6 Reverse -365 -382 8.00365 0.212
NP_441015.1_8 Forward -168 -149 5.30933 0.258
NP_441015.1_9 Forward -63 -50 15.0633 0.292
NP_441015.1_10 Reverse -362 -381 -6.39206 0.248
NP_441673.1_1 Forward -376 -367 20.8459 0.000698
NP_441673.1_1 Reverse -367 -376 20.8459 0.000698
NP_441876.1_9 Forward -142 -132 14.9258 0.267
NP_441876.1_9 Forward -249 -239 10.8943 0.284
NP_441826.1_2 Reverse -361 -375 6.29277 0.0944
NP_441826.1_2 Forward -382 -368 1.47456 0.151
NP_442868.1_6 Reverse -365 -375 17.4829 0.012
NP_442868.1_6 Forward -378 -368 9.81313 0.038
NP_442719.1_2 Forward -71 -53 -5.48809 0.219
NP_442677.1_7 Reverse -269 -279 17.2863 0.27
NP_441612.1_2 Forward -156 -146 15.2294 0.209
NP_441612.1_2 Reverse -367 -377 8.54929 0.21
NP_441612.1_2 Forward -376 -366 8.54929 0.21
NP_442808.1_1 Reverse -366 -376 8.63269 0.0481
NP_442808.1_1 Forward -377 -367 8.63269 0.0481
NP_442808.1_1 Forward -293 -283 2.83119 0.254
NP_442775.1_6 Reverse -118 -137 10.3242 0.277
NP_440145.1_3 Reverse -357 -376 23.0089 0.00632
NP_440145.1_3 Forward -386 -367 6.88262 0.0503
NP_442820.1_3 Forward -147 -137 12.3692 0.293
NP_442542.1_9 Reverse -238 -252 5.70218 0.259
NP_442050.1_5 Reverse -365 -375 15.6142 0.01
NP_442050.1_5 Forward -378 -368 7.64939 0.243
NP_442342.1_9 Reverse -37 -53 9.98996 0.145
NP_442342.1_9 Forward -247 -231 4.3851 0.25
NP_442342.1_9 Reverse -45 -61 1.92682 0.296
NP_441114.1_3 Forward -360 -351 7.96454 0.231
NP_440558.1_2 Reverse -258 -277 -3.73712 0.238
NP_440558.1_2 Reverse -358 -377 -6.88371 0.283
NP_441518.1_3 Reverse -357 -376 -11.4069 0.26
NP_441878.1_6 Forward -377 -367 10.4031 0.0176
NP_441878.1_6 Reverse -366 -376 10.4031 0.0176
NP_441878.1_6 Forward -49 -39 0.766681 0.134
NP_441878.1_6 Reverse -38 -48 0.57002 0.14
NP_441878.1_6 Reverse -244 -254 -7.49312 0.231
NP_441036.1_8 Forward -377 -367 8.33817 0.174
NP_441036.1_8 Reverse -366 -376 8.33817 0.174
NP_441557.1_5 Forward -376 -367 19.9609 0.000699
NP_441557.1_5 Reverse -367 -376 19.9609 0.000699
NP_441445.1_1 Forward -355 -336 3.44104 0.213
NP_442066.2_9 Forward -65 -52 8.47575 0.185
NP_442066.2_9 Reverse -363 -376 8.08242 0.193
NP_441433.1_8 Reverse -231 -250 0.982764 0.238
NP_441433.1_8 Reverse -40 -59 -4.72043 0.294
NP_442962.1_10 Reverse -77 -96 24.1889 0.0231
NP_442830.1_5 Reverse -168 -182 0.490664 0.294
NP_442183.1_1 Forward -376 -362 8.55439 0.113
NP_440276.1_8 Reverse -227 -246 10.7175 0.232
NP_442347.1_2 Forward -375 -366 12.4878 0.056
NP_442347.1_2 Reverse -368 -377 12.4878 0.056
NP_442347.1_2 Forward -249 -240 4.62128 0.274
NP_442645.1_2 Forward -384 -365 -3.14714 0.0487
NP_442645.1_2 Forward -179 -160 -17.3068 0.253
NP_442645.1_2 Reverse -359 -378 -20.7484 0.288
NP_441037.1_4 Reverse -365 -375 9.55921 0.21
NP_441037.1_4 Forward -378 -368 7.9999 0.237
NP_441633.1_3 Forward -378 -365 10.934 0.0286
NP_441633.1_3 Forward -256 -243 -2.04567 0.171
NP_441633.1_3 Reverse -365 -378 -5.97891 0.236
NP_440136.1_2 Forward -375 -368 15.9687 0.0123
NP_440136.1_2 Reverse -368 -375 15.9687 0.0123
NP_442590.1_9 Reverse -276 -295 6.98095 0.252
NP_442998.1_5 Reverse -310 -320 8.73149 0.261
NP_442998.1_5 Reverse -136 -146 8.53483 0.261
NP_442998.1_10 Forward -374 -367 15.5754 0.0102
NP_442998.1_10 Reverse -369 -376 15.5754 0.0102
NP_440899.1_1 Reverse -77 -96 6.45561 0.278
NP_440299.1_1 Forward -380 -367 18.9965 0.00298
NP_440299.1_1 Reverse -363 -376 13.5883 0.0298
NP_440299.1_1 Forward -258 -245 2.28034 0.292
NP_441799.1_1 Forward -380 -366 14.8469 0.0221
NP_441799.1_1 Reverse -363 -377 3.73557 0.284
NP_441007.1_10 Reverse -362 -375 3.16588 0.182
NP_442334.1_2 Reverse -284 -301 -6.15601 0.24
NP_440256.1_1 Reverse -155 -174 -2.16383 0.113
NP_440256.1_1 Forward -283 -264 -7.37537 0.234
NP_440256.1_1 Reverse -364 -383 -9.44032 0.28
NP_441559.1_8 Reverse -362 -376 -5.9986 0.271
NP_440915.1_6 Reverse -363 -377 14.0609 0.0187
NP_440915.1_6 Forward -380 -366 0.687908 0.155
NP_440915.1_6 Reverse -290 -304 0.392915 0.165
NP_440915.1_6 Forward -275 -261 -1.5737 0.239
NP_442866.1_1 Forward -173 -154 -6.49039 0.255
NP_440748.1_5 Forward -217 -198 3.83436 0.207
NP_441464.1_10 Forward -348 -334 9.5377 0.262
NP_441464.1_10 Forward -341 -327 8.45605 0.281
NP_442993.1_1 Forward -376 -360 -7.31629 0.146
NP_442386.1_9 Reverse -366 -375 13.8639 0.0289
NP_442386.1_9 Forward -377 -368 13.8639 0.0289
NP_442386.1_9 Forward -287 -278 6.39082 0.219
NP_441340.1_5 Forward -375 -368 15.6737 0.0124
NP_441340.1_5 Reverse -368 -375 15.6737 0.0124
NP_442791.1_5 Forward -293 -274 -10.522 0.279
NP_440168.1_4 Reverse -35 -54 2.55606 0.202
NP_440194.1_3 Forward -386 -367 1.27776 0.277
NP_442474.1_9 Forward -342 -323 9.3409 0.264
NP_440586.1_8 Forward -375 -368 13.2151 0.026
NP_440586.1_8 Reverse -368 -375 13.2151 0.026
NP_440586.1_8 Forward -47 -40 9.08521 0.178
NP_442251.1_6 Forward -375 -368 15.2804 0.0124
NP_442251.1_6 Reverse -368 -375 15.2804 0.0124
NP_440684.1_9 Forward -177 -163 10.1277 0.209
NP_440684.1_9 Forward -382 -368 9.63603 0.217
NP_441262.1_3 Reverse -367 -374 14.7888 0.0223
NP_441262.1_3 Forward -376 -369 14.7888 0.0223
NP_440027.1_3 Reverse -257 -275 2.47668 0.289
NP_440027.1_3 Forward -286 -268 2.37835 0.29
NP_443051.1_1 Reverse -366 -375 10.4228 0.00754
NP_443051.1_1 Forward -377 -368 10.4228 0.00754
NP_441232.1_10 Reverse -120 -139 1.27776 0.284
NP_439984.1_3 Forward -383 -369 12.782 0.255
NP_439937.1_9 Forward -377 -360 -6.74666 0.157
NP_439937.1_9 Forward -136 -119 -15.5964 0.287
NP_440408.1_7 Reverse -244 -263 8.06259 0.282
NP_442239.1_8 Forward -286 -267 7.47261 0.257
NP_439943.1_7 Forward -313 -294 9.0459 0.18
NP_440372.1_2 Forward -375 -368 16.3621 0.0124
NP_440372.1_2 Reverse -368 -375 16.3621 0.0124
NP_441138.1_5 Reverse -98 -111 10.8524 0.227
NP_440316.1_10 Forward -49 -39 9.02648 0.236
NP_440316.1_10 Reverse -276 -286 7.05986 0.251
NP_441803.1_2 Forward -381 -362 1.86774 0.223
NP_439977.1_5 Reverse -361 -380 1.96607 0.183
NP_439977.1_5 Forward -382 -363 -0.000545616 0.217
NP_441572.1_7 Reverse -361 -380 -2.0655 0.19
NP_442384.1_10 Reverse -367 -380 16.7355 0.00732
NP_442384.1_10 Forward -376 -363 3.95252 0.172
NP_440364.1_10 Reverse -237 -256 17.109 0.211
NP_442262.1_10 Forward -375 -368 14.1988 0.0123
NP_442262.1_10 Reverse -368 -375 14.1988 0.0123
NP_442262.1_10 Forward -47 -40 9.18389 0.211
NP_442262.1_10 Forward -253 -246 8.59391 0.22
NP_441689.1_5 Reverse -365 -375 5.87944 0.197
NP_441689.1_5 Forward -378 -368 5.78111 0.197
NP_440344.1_10 Reverse -360 -377 11.1502 0.00644
NP_440282.1_10 Reverse -252 -271 -8.752 0.263
NP_440189.1_10 Forward -257 -238 5.60432 0.279
NP_441335.1_8 Reverse -282 -301 10.5209 0.204
NP_440562.1_3 Forward -375 -358 24.6216 0.00788
NP_441965.1_10 Reverse -364 -380 2.32015 0.288
NP_442750.1_3 Reverse -134 -153 -12.5869 0.288
NP_440297.1_9 Reverse -40 -50 9.22315 0.0917
NP_440297.1_9 Reverse -368 -378 -0.118297 0.282
NP_440297.1_9 Forward -375 -365 -0.216628 0.282
NP_442280.1_10 Reverse -227 -245 12.4673 0.178
NP_442280.1_10 Forward -171 -153 5.55182 0.283
NP_441592.1_4 Reverse -367 -386 6.68596 0.124
NP_441896.1_3 Reverse -358 -377 8.25926 0.0915
NP_441896.1_3 Reverse -236 -255 1.0811 0.222
NP_441896.1_5 Reverse -88 -95 15.3787 0.268
NP_440650.1_9 Forward -187 -168 15.4374 0.265
NP_440999.1_9 Reverse -363 -377 13.8643 0.0287
NP_440888.1_2 Forward -376 -362 20.1568 0.000881
NP_440888.1_2 Reverse -367 -381 9.93039 0.11
NP_440600.1_4 Forward -384 -366 -7.45401 0.291
NP_439969.1_1 Reverse -151 -170 -6.39206 0.288
NP_442033.1_10 Forward -378 -359 1.37609 0.0882
NP_441543.1_2 Forward -375 -366 16.9127 0.00359
NP_441543.1_2 Reverse -368 -377 16.9127 0.00359
NP_442845.1_2 Reverse -361 -375 10.7177 0.143
NP_442845.1_2 Forward -382 -368 5.50613 0.231
NP_441834.1_7 Reverse -355 -374 17.6007 0.209
NP_441319.1_8 Forward -303 -285 11.6222 0.147
NP_441918.1_7 Reverse -366 -385 -1.37718 0.297
NP_441469.1_8 Forward -377 -368 6.48957 0.227
NP_441469.1_8 Reverse -366 -375 6.48957 0.227
NP_443064.1_6 Forward -376 -366 12.5669 0.0796
NP_443064.1_6 Reverse -367 -377 12.5669 0.0796
NP_441306.1_10 Reverse -160 -174 21.9267 0.0345
NP_442578.1_7 Forward -375 -368 14.5921 0.026
NP_442578.1_7 Reverse -368 -375 14.5921 0.026
NP_440710.1_1 Forward -384 -366 -3.6191 0.208
NP_440148.1_6 Reverse -180 -194 15.2817 0.3
NP_441462.1_2 Forward -376 -366 11.5831 0.00406
NP_441462.1_2 Reverse -367 -377 11.5831 0.00406
NP_443062.1_6 Forward -384 -365 0.982764 0.283
NP_441601.1_10 Reverse -275 -294 6.19431 0.256
NP_441410.1_3 Reverse -190 -209 15.1424 0.121
NP_440516.1_6 Reverse -39 -53 10.1271 0.233
NP_440516.1_6 Forward -303 -289 8.84875 0.246
NP_440516.1_8 Forward -376 -367 16.9127 0.00442
NP_440516.1_8 Reverse -367 -376 16.9127 0.00442
NP_441785.1_1 Forward -376 -362 13.611 0.205
NP_442428.1_5 Forward -375 -368 15.8704 0.0124
NP_442428.1_5 Reverse -368 -375 15.8704 0.0124
NP_441867.1_2 Reverse -276 -295 -13.4719 0.277
NP_440673.1_2 Forward -386 -367 11.3651 0.178
NP_440673.1_3 Forward -374 -367 12.4288 0.0426
NP_440673.1_3 Reverse -369 -376 12.4288 0.0426
NP_440673.1_3 Forward -206 -199 7.51227 0.252
NP_441052.1_2 Forward -376 -366 19.9412 0.00106
NP_441052.1_2 Reverse -367 -377 19.9412 0.00106
NP_442219.1_8 Reverse -357 -376 6.52434 0.294
NP_442219.1_9 Forward -375 -366 17.7976 0.00718
NP_442219.1_9 Reverse -368 -377 17.7976 0.00718
NP_440436.1_4 Forward -375 -366 17.2072 0.00233
NP_440436.1_4 Reverse -368 -377 17.2072 0.00233
NP_441884.1_9 Reverse -364 -383 -23.6983 0.284
NP_442864.1_10 Forward -313 -294 14.5524 0.28
NP_440314.1_9 Forward -375 -356 0.392778 0.0952
NP_440314.1_9 Forward -302 -283 -9.24366 0.262
NP_440314.1_9 Reverse -368 -387 -9.53865 0.269
NP_442907.1_9 Reverse -251 -270 8.16093 0.127
NP_441719.1_4 Forward -375 -368 16.3621 0.0124
NP_441719.1_4 Reverse -368 -375 16.3621 0.0124
NP_441733.1_10 Reverse -364 -377 10.344 0.106
NP_441363.1_4 Forward -179 -160 7.37428 0.277
NP_441004.1_1 Reverse -239 -258 -16.1268 0.283
NP_441004.1_5 Reverse -19 -33 9.43936 0.252
NP_442366.1_5 Forward -379 -369 15.4175 0.0374
NP_442366.1_5 Forward -174 -164 10.796 0.233
NP_440129.1_10 Reverse -192 -206 5.80112 0.185
NP_442694.1_3 Reverse -295 -313 -5.19239 0.295
NP_442854.1_6 Forward -48 -29 1.37609 0.279
NP_440094.1_9 Reverse -244 -263 -4.32711 0.257
NP_443054.1_2 Forward -378 -364 3.04785 0.24
NP_441851.1_10 Forward -377 -367 15.8113 0.00552
NP_441851.1_10 Reverse -366 -376 15.8113 0.00552
NP_442001.1_4 Reverse -328 -347 14.8466 0.189
NP_442001.1_4 Forward -87 -68 6.29183 0.29
NP_441542.1_4 Reverse -17 -31 5.40779 0.264
NP_441668.1_4 Forward -386 -367 -1.37718 0.273
NP_442515.1_1 Forward -377 -363 4.32615 0.107
NP_442515.1_1 Reverse -366 -380 4.32615 0.107
NP_440593.1_3 Reverse -362 -381 -1.67217 0.212
NP_441982.1_6 Forward -157 -148 13.5358 0.274
NP_441349.1_10 Forward -386 -367 0.687771 0.0867
NP_441349.1_10 Reverse -357 -376 -9.73531 0.297
NP_440432.1_9 Reverse -368 -383 -3.36336 0.179
NP_442843.1_1 Forward -361 -342 -5.80207 0.244
NP_442843.1_1 Reverse -277 -296 -11.9969 0.296
NP_439960.1_4 Reverse -276 -295 18.1898 0.125
NP_442944.1_10 Reverse -370 -389 8.06259 0.269
NP_442450.1_5 Forward -378 -368 7.55152 0.13
NP_440195.1_5 Reverse -361 -380 3.6377 0.273
NP_442006.1_2 Reverse -236 -253 -17.2674 0.271
NP_440483.1_1 Reverse -231 -250 -8.06369 0.282
NP_442243.1_1 Reverse -361 -379 5.91824 0.178
NP_441570.1_1 Reverse -367 -385 -15.2222 0.228
NP_441570.1_1 Reverse -277 -295 -16.0088 0.237
NP_441570.1_1 Reverse -294 -312 -16.5988 0.249
NP_440078.1_4 Reverse -84 -103 11.0125 0.237
NP_441078.1_4 Forward -376 -367 19.6659 0.0007
NP_441078.1_4 Reverse -367 -376 19.6659 0.0007
NP_442729.1_5 Forward -49 -39 9.02648 0.235
NP_442729.1_8 Reverse -363 -376 8.77074 0.125
NP_441528.1_2 Reverse -143 -162 7.76679 0.297
NP_442348.1_2 Reverse -52 -61 14.1594 0.167
NP_442443.1_1 Forward -278 -259 -3.44213 0.267
NP_442443.1_1 Reverse -121 -140 -6.39206 0.294
NP_442443.1_1 Reverse -278 -297 -6.49039 0.294
NP_440526.1_3 Forward -375 -364 20.0193 0.0113
NP_440526.1_3 Reverse -368 -379 1.04151 0.267
NP_441432.1_8 Reverse -366 -375 16.8143 0.00595
NP_441432.1_8 Forward -377 -368 16.8143 0.00595
NP_442320.1_8 Reverse -361 -375 15.7325 0.0102
NP_442320.1_8 Forward -382 -368 -4.7203 0.185
NP_442320.1_9 Forward -343 -329 11.111 0.271
NP_441732.1_2 Forward -380 -364 -6.92296 0.0558
NP_441732.1_2 Reverse -363 -379 -15.1828 0.145
NP_440313.1_7 Forward -33 -14 17.3057 0.235
NP_440760.1_1 Reverse -367 -386 -5.70374 0.0511
NP_440760.1_1 Forward -376 -357 -13.6686 0.11
NP_440760.1_1 Reverse -162 -181 -20.7484 0.225
NP_440199.1_10 Reverse -364 -374 7.35486 0.231
NP_441057.1_4 Reverse -152 -170 -3.02911 0.278
NP_442353.1_4 Reverse -361 -380 2.6536 0.229
NP_443011.1_4 Reverse -276 -295 9.24257 0.225
NP_441023.1_1 Forward -61 -43 11.0322 0.254
NP_442489.1_7 Forward -376 -367 20.1576 0.000695
NP_442489.1_7 Reverse -367 -376 20.1576 0.000695
NP_441706.1_1 Forward -225 -206 2.65439 0.118
NP_440559.1_1 Forward -375 -366 17.4043 0.00658
NP_440559.1_1 Reverse -368 -377 17.4043 0.00658
NP_441659.2_8 Forward -376 -366 18.1713 0.00133
NP_441659.2_8 Reverse -367 -377 18.1713 0.00133
NP_442913.1_10 Reverse -358 -377 2.94938 0.118
NP_442913.1_10 Forward -385 -366 -2.26216 0.183
NP_441040.1_2 Reverse -229 -248 -9.44032 0.236
NP_441040.1_2 Forward -262 -243 -14.0619 0.284
NP_440335.1_9 Reverse -324 -342 15.3588 0.186
NP_442346.1_5 Forward -377 -367 16.6963 0.00248
NP_442346.1_5 Reverse -366 -376 16.6963 0.00248
NP_442346.1_5 Forward -172 -162 9.12481 0.118
NP_440545.1_3 Forward -380 -363 -1.43612 0.168
NP_440545.1_3 Reverse -258 -275 -7.04099 0.295
NP_440545.1_5 Forward -350 -333 12.5269 0.21
NP_440545.1_5 Forward -380 -363 9.47861 0.21
NP_440025.1_3 Forward -66 -52 12.9343 0.26
NP_441943.1_8 Forward -58 -39 -12.5869 0.261
NP_442603.1_7 Forward -376 -362 12.192 0.102
NP_440449.1_6 Reverse -236 -254 4.36531 0.297
NP_441948.1_9 Reverse -247 -265 25.6835 0.00419
NP_441833.1_4 Forward -375 -368 15.9687 0.0124
NP_441833.1_4 Reverse -368 -375 15.9687 0.0124
NP_440912.1_3 Forward -89 -70 10.6184 0.254
NP_441895.1_10 Reverse -56 -75 -19.2734 0.282
NP_442699.1_8 Reverse -129 -148 -12.7836 0.257
NP_442162.1_9 Forward -375 -368 16.2637 0.0124
NP_442162.1_9 Reverse -368 -375 16.2637 0.0124
NP_440671.1_4 Reverse -361 -375 6.6861 0.239
NP_442140.1_3 Forward -375 -365 13.5497 0.0542
NP_442140.1_3 Reverse -368 -378 12.2714 0.0632
NP_440875.1_9 Forward -374 -364 8.66404 0.233
NP_442547.1_7 Forward -306 -287 11.7797 0.243
NP_441813.1_5 Reverse -365 -375 8.73149 0.0367
NP_441813.1_5 Forward -378 -368 8.63316 0.0367
NP_442254.1_1 Reverse -341 -360 -4.52377 0.282
NP_440590.1_4 Forward -375 -362 23.0287 0.00377
NP_440590.1_4 Reverse -368 -381 0.707601 0.144
NP_440567.1_1 Forward -375 -361 9.63603 0.0422
NP_440567.1_1 Reverse -368 -382 5.60446 0.1
NP_442497.1_10 Forward -375 -366 10.4228 0.0087
NP_442497.1_10 Reverse -368 -377 10.4228 0.0087
NP_440821.1_4 Reverse -365 -375 17.9746 0.00497
NP_440821.1_4 Forward -378 -368 9.41981 0.0286
NP_441239.1_9 Reverse -37 -49 8.49544 0.131
NP_441239.1_9 Reverse -365 -377 7.11881 0.169
NP_441239.1_9 Forward -378 -366 3.38223 0.285
NP_441951.1_6 Forward -295 -276 11.7008 0.248
NP_440400.1_1 Forward -263 -244 1.47364 0.263
NP_441892.1_1 Forward -57 -40 1.71047 0.148
NP_442193.1_8 Reverse -364 -383 11.11 0.269
NP_441017.1_6 Forward -52 -38 12.9786 0.209
NP_441874.1_1 Reverse -42 -56 9.14437 0.277
NP_443035.1_10 Reverse -238 -255 12.1336 0.208
NP_441617.1_6 Forward -383 -364 -4.52377 0.265
NP_442052.1_8 Forward -364 -354 12.2714 0.282
NP_440546.1_4 Forward -376 -366 10.046 0.109
NP_440546.1_4 Reverse -367 -377 10.046 0.109
NP_440675.1_1 Reverse -241 -260 1.67108 0.287
NP_441656.1_6 Reverse -224 -243 6.68596 0.253
NP_440462.1_6 Reverse -365 -375 10.3048 0.0396
NP_440462.1_6 Forward -378 -368 1.35667 0.294
NP_440868.1_4 Forward -380 -368 6.1355 0.0878
NP_440868.1_4 Reverse -363 -375 0.432302 0.212
NP_442499.1_3 Forward -377 -359 6.214 0.282
NP_442479.1_9 Forward -179 -160 -9.047 0.266
NP_441582.1_5 Reverse -365 -384 3.44025 0.266
NP_442402.1_4 Forward -36 -17 -8.85106 0.284
NP_440696.1_3 Reverse -267 -285 1.88744 0.217
NP_440696.1_3 Forward -171 -153 -2.73412 0.279
NP_442039.1_4 Forward -375 -368 15.1821 0.0124
NP_442039.1_4 Reverse -368 -375 15.1821 0.0124
NP_442679.1_1 Forward -116 -97 2.26107 0.167
NP_440825.1_7 Reverse -368 -378 12.9096 0.152
NP_442837.1_3 Forward -375 -368 15.7721 0.0124
NP_442837.1_3 Reverse -368 -375 15.7721 0.0124
NP_440160.1_2 Reverse -244 -263 -8.65367 0.286
NP_442053.1_1 Forward -376 -367 18.3876 0.0007
NP_442053.1_1 Reverse -367 -376 18.3876 0.0007
NP_440505.1_3 Reverse -365 -375 16.598 0.00683
NP_440505.1_3 Forward -378 -368 9.22315 0.122
NP_442360.1_5 Reverse -46 -56 13.1564 0.289
NP_441536.1_7 Reverse -330 -349 22.8114 0.0342
NP_441203.1_1 Reverse -40 -59 -15.9302 0.244
NP_440914.1_1 Forward -376 -366 17.5935 0.000537
NP_440914.1_1 Reverse -367 -377 17.5935 0.000537
NP_441011.1_8 Forward -375 -366 8.25953 0.144
NP_441011.1_8 Reverse -368 -377 8.25953 0.144
NP_442533.1_6 Forward -376 -367 17.2076 0.00137
NP_442533.1_6 Reverse -367 -376 17.2076 0.00137
NP_442533.1_6 Reverse -262 -271 5.01461 0.16
NP_442533.1_6 Forward -171 -162 3.53964 0.21
NP_442541.1_10 Reverse -152 -166 2.06395 0.269
NP_440263.1_5 Forward -68 -54 10.0294 0.294
NP_441482.1_7 Forward -382 -368 -3.04867 0.106
NP_439944.1_9 Forward -375 -365 19.1546 0.00329
NP_439944.1_9 Reverse -368 -378 10.5014 0.0887
NP_441028.1_6 Forward -143 -133 5.78111 0.243
NP_441028.1_6 Reverse -148 -158 4.89613 0.275
NP_440116.1_8 Forward -375 -356 -1.86883 0.122
NP_441527.1_4 Forward -112 -93 -12.1756 0.285
NP_440115.1_6 Reverse -364 -374 9.81313 0.115
NP_440115.1_6 Reverse -196 -206 4.79825 0.282
NP_440007.1_9 Forward -283 -269 1.37622 0.285
NP_440007.1_9 Reverse -363 -377 1.17956 0.29
NP_442492.1_2 Reverse -367 -386 -1.08219 0.292
NP_441106.1_1 Forward -377 -368 9.63616 0.0311
NP_441106.1_1 Reverse -366 -375 9.63616 0.0311
NP_441869.1_9 Reverse -298 -317 13.5691 0.263
NP_439903.1_7 Reverse -232 -251 14.1591 0.199
NP_441286.1_1 Forward -377 -365 21.6718 0.00196
NP_441286.1_1 Reverse -366 -378 12.9203 0.00815
NP_440092.1_4 Reverse -196 -215 12.9791 0.283
NP_440670.1_8 Forward -376 -367 18.3876 0.000699
NP_440670.1_8 Reverse -367 -376 18.3876 0.000699
NP_440886.1_7 Forward -377 -367 7.94438 0.0805
NP_440886.1_7 Reverse -366 -376 7.94438 0.0805
NP_440886.1_7 Reverse -336 -346 3.71617 0.267
NP_440828.1_4 Reverse -261 -280 -4.91784 0.246
NP_441001.1_10 Forward -281 -262 7.37428 0.249
NP_439995.1_5 Forward -386 -367 5.211 0.276
NP_442072.1_9 Forward -377 -359 -21.6137 0.211
NP_442072.1_9 Reverse -366 -384 -22.4003 0.234
NP_442213.1_5 Forward -344 -325 -1.57384 0.293
NP_442022.1_4 Reverse -123 -142 7.27595 0.268
NP_440907.2_8 Forward -375 -365 10.8943 0.0969
NP_440907.2_8 Reverse -368 -378 7.64939 0.117
NP_442264.1_2 Reverse -357 -374 7.61033 0.236
NP_439967.1_4 Reverse -340 -354 17.3058 0.289
NP_441021.1_1 Reverse -368 -387 -11.4069 0.262
NP_441463.1_3 Forward -218 -199 -5.31042 0.225
NP_441463.1_3 Reverse -320 -339 -6.1954 0.241
NP_441463.1_6 Forward -305 -291 6.99573 0.265
NP_441626.1_2 Forward -375 -368 15.7721 0.0124
NP_441626.1_2 Reverse -368 -375 15.7721 0.0124
NP_442365.1_7 Reverse -363 -382 1.0811 0.175
NP_442238.1_1 Reverse -199 -218 -0.000545616 0.295
NP_442794.1_1 Forward -380 -368 9.38042 0.0795
NP_442794.1_1 Reverse -363 -375 3.48056 0.286
NP_442615.1_1 Forward -385 -367 6.60732 0.0344
NP_442615.1_1 Reverse -358 -376 0.0191479 0.109
NP_442615.1_8 Reverse -281 -300 14.1591 0.0963
NP_441962.1_4 Reverse -362 -381 0.687771 0.111
NP_441962.1_4 Forward -381 -362 -6.88371 0.183
NP_441962.1_4 Forward -375 -356 -9.047 0.211
NP_440387.1_1 Reverse -367 -383 21.9863 0.00209
NP_440387.1_1 Forward -376 -360 -0.826444 0.142
NP_441431.1_2 Reverse -364 -378 8.75042 0.207
NP_442647.1_7 Reverse -332 -345 6.01747 0.257
NP_441993.1_1 Forward -177 -158 7.01447 0.176
NP_441993.1_1 Reverse -231 -250 5.06532 0.208
NP_442323.1_7 Reverse -47 -66 1.08032 0.292
NP_440766.1_4 Reverse -363 -377 8.16106 0.0871
NP_439988.1_3 Forward -52 -38 5.70279 0.278
NP_441237.1_9 Forward -375 -365 14.9263 0.0242
NP_441237.1_9 Reverse -368 -378 14.828 0.0242
NP_441237.1_9 Forward -253 -243 12.0747 0.139
NP_442635.1_8 Forward -364 -346 17.8171 0.242
NP_439910.1_2 Reverse -359 -376 -22.0856 0.207
NP_442867.1_8 Reverse -269 -288 14.7491 0.164
NP_440457.1_1 Reverse -363 -375 5.34885 0.141
NP_440457.1_1 Forward -52 -40 4.16888 0.171
NP_440457.1_1 Forward -380 -368 0.825626 0.25
NP_442297.1_4 Forward -380 -361 14.7667 0.183
NP_441984.1_3 Forward -250 -232 9.45892 0.21
NP_441984.1_3 Reverse -35 -53 7.59063 0.245
NP_440473.1_9 Reverse -28 -47 -6.29373 0.228
NP_442509.1_9 Forward -376 -366 8.14104 0.192
NP_442509.1_9 Reverse -367 -377 8.14104 0.192
NP_442514.1_5 Reverse -230 -249 -8.75273 0.29
NP_441440.1_8 Reverse -274 -287 15.3589 0.299
NP_441159.1_8 Reverse -103 -122 -0.00131823 0.236
NP_440554.1_4 Forward -375 -365 6.37155 0.123
NP_441885.1_5 Forward -376 -366 20.9245 0.000538
NP_441885.1_5 Reverse -367 -377 20.9245 0.000538
NP_442341.1_7 Forward -377 -363 20.3541 0.00702
NP_442341.1_7 Reverse -366 -380 7.66941 0.0994
NP_441173.1_9 Reverse -149 -157 12.1137 0.21
NP_443000.1_7 Reverse -365 -375 10.4031 0.0345
NP_443000.1_7 Forward -378 -368 10.3048 0.0345
NP_440076.1_5 Forward -286 -267 13.6666 0.252
NP_440507.2_3 Reverse -358 -377 16.9115 0.066
NP_440507.2_3 Reverse -36 -55 8.84842 0.241
NP_440275.1_3 Reverse -365 -375 17.6796 0.0102
NP_440275.1_3 Forward -378 -368 8.04317 0.0602
NP_440091.1_1 Reverse -363 -375 10.7571 0.0429
NP_440091.1_1 Forward -380 -368 1.41561 0.197
NP_440679.1_10 Reverse -119 -138 -21.0434 0.29
NP_440175.1_7 Reverse -119 -137 13.9499 0.174
NP_442495.1_4 Forward -57 -47 12.6647 0.218
NP_441105.1_3 Reverse -356 -375 -7.86702 0.261
NP_440216.1_1 Reverse -367 -381 -1.47537 0.0328
NP_440216.1_1 Forward -376 -362 -9.63684 0.145
NP_440216.1_9 Forward -360 -351 5.50626 0.292
NP_440172.1_1 Forward -376 -366 15.0247 0.00945
NP_440172.1_1 Reverse -367 -377 15.0247 0.00945
NP_442015.1_10 Reverse -363 -376 3.65753 0.178
NP_442015.1_10 Forward -380 -367 1.49425 0.204
NP_441226.1_7 Forward -375 -368 14.4934 0.0123
NP_441226.1_7 Reverse -368 -375 14.4934 0.0123
NP_441111.1_7 Forward -375 -367 18.7023 0.00294
NP_441111.1_7 Reverse -368 -376 18.7023 0.00294
NP_441766.1_2 Forward -376 -367 17.5026 0.00297
NP_441766.1_2 Reverse -367 -376 17.5026 0.00297
NP_441766.1_9 Reverse -269 -288 -0.885524 0.261
NP_440416.1_1 Forward -376 -357 -13.6686 0.281
NP_440416.1_9 Forward -261 -242 -6.1954 0.0866
NP_440416.1_9 Reverse -151 -170 -20.3551 0.284
NP_443052.1_9 Forward -139 -120 -2.26216 0.235
NP_440072.1_5 Reverse -45 -63 -3.22577 0.277
NP_442154.1_1 Forward -279 -261 -17.7788 0.267
NP_440261.1_5 Forward -375 -362 -2.93064 0.0983
NP_440261.1_5 Forward -253 -240 -3.02898 0.108
NP_440988.1_10 Reverse -365 -379 8.57771 0.205
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CGACAAAACGGGCGTTTAAAGTTTGGCGATCGCCACTGAACCATTGCACAGGTTGCTGATTGGGGCTGGTGTTATCAAGCAGATCTAGCCCTAGAAACTGCATGGCCCCAGTATCCCCAAGGCCGGTGCGGGTCTGGCCTCCCTCCTGCCATTGACCCCAGGCCACAGGATAGGATTTACCGTCAATGCTAATTTGATTGCCCTGTTGAATAAAATCTGAAGAGGATTGGGCCACCACTGGACTGGGCAAAAACAGTTTTAGCCCCAGCATTACCGCCAGAGTAAGAACAAATAAGCACGAAAAACCAAACCAATTTCTAGTCCAATTAACCATTTTCAGCAAATCCCCTAGGGCCATGGAGCCATTCTGCCATTAATCCACAATGGAACCAATCCTTTG

CDS

GTGCCGGCTCTGGCACAGGGTAAACCCATCGGCATTGGTGAGTTGCATGGTAATCGAAATCCAGTCGGCGATCGCCTAGGCTTGGGCCAGATTATCCAAGTAACCAACAATGGCCATAGGATCAGAGAAAGTATTACTCCTGATTTGCTGAGATTTGAACCTATGCTTGCCCGTCAACAACCCCGCCGTGTGGCCCGTGAACTGTCCCTGTTGAGCCTGAGCCAATTGAGCCGCAAGGACACTAAGCCCGAAACCTTGGAGCAAGGCGACCTGGAAGCATTGTTGTTGGCCGCCACCCGCACCCTGAGTGGGGAAGTCCATGAAATTTTAGAAACGGCCTCGGCGGAATTGAGTCGTAGCCATGAACGCCTGTTAAACAGTGAAATCCGGGCTAGCAACCTCAACAGTGCTAAGGCCATGTTGGAAGAGGCTATGACCCTAACGGAAACGGTGATTAATCGCCTAGCCCTAGCGGTGGATTTACCGGAAACGTTGCAGTTGGCGGGGCAAATGGAAGTACGAAAATTTGCGTTGGAATTGATTGGCACCGTCTGTCGCCGCCGTCAGCAGATTGATGAGCAGTTGCAAGAAGCCATGGTGGACTGGCAACTGTCCCGCCTGGCCAAAATAGATCAAGACATACTCCGTCTGGCGATCGCCGAACTGGATTACCTCGGTGTGCCCCAAAAAGTCGCCATCAATGAAGCAGTGGAGTTGGCCAAACGTTATTCGGGTCAGGATGGTCACCGTTTTATCAATGGGGTCTTGCGCCGAGTTACCGAAAAAAAGACTGACGGAGCCCCCGTCACCCCTGGTGAACCCCGTTAA

Protein

MPALAQGKPIGIGELHGNRNPVGDRLGLGQIIQVTNNGHRIRESITPDLLRFEPMLARQQPRRVARELSLLSLSQLSRKDTKPETLEQGDLEALLLAATRTLSGEVHEILETASAELSRSHERLLNSEIRASNLNSAKAMLEEAMTLTETVINRLALAVDLPETLQLAGQMEVRKFALELIGTVCRRRQQIDEQLQEAMVDWQLSRLAKIDQDILRLAIAELDYLGVPQKVAINEAVELAKRYSGQDGHRFINGVLRRVTEKKTDGAPVTPGEPR