Your browser is old and dusty. Try Google Chrome!

Details for sll0270

ORF sll0270
Accession NP_441816.1
Symbol
Category primosomal protein N'
Definition DNA replication, restriction, modification, recombination, and repair
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Forward -367 -348 -28.8115 0.211
NP_440259.1_4 Reverse -13 -27 12.3957 0.254
NP_442752.1_4 Reverse -142 -149 10.5605 0.1
NP_442752.1_4 Reverse -382 -389 7.90559 0.144
NP_440110.1_8 Reverse -248 -267 -0.983855 0.232
NP_440110.1_8 Reverse -148 -167 -2.85214 0.282
NP_441476.1_5 Forward -99 -80 1.17943 0.19
NP_441781.1_7 Forward -397 -378 -2.26216 0.289
NP_439902.1_3 Forward -83 -64 17.8227 0.256
NP_442602.1_3 Reverse -378 -397 -3.04881 0.274
NP_439918.1_3 Reverse -127 -146 3.6377 0.266
NP_442110.1_7 Reverse -102 -116 2.45787 0.222
NP_442726.1_7 Reverse -336 -354 17.6204 0.0738
NP_441925.1_4 Reverse -339 -358 -6.19614 0.185
NP_441925.1_4 Forward -161 -142 -14.3576 0.262
NP_441925.1_4 Reverse -336 -355 -15.4392 0.264
NP_440856.1_7 Forward -370 -351 -6.09707 0.235
NP_442827.1_8 Forward -384 -365 -0.197979 0.222
NP_441955.1_8 Forward -268 -251 7.41366 0.279
NP_442889.1_8 Reverse -340 -354 5.80051 0.213
NP_441770.1_10 Reverse -365 -384 9.3409 0.251
NP_442570.1_3 Forward -240 -221 -8.752 0.292
NP_442111.1_4 Reverse -53 -67 2.75286 0.266
NP_441624.1_6 Reverse -341 -360 12.6833 0.268
NP_440343.1_9 Forward -362 -343 10.4225 0.243
NP_441634.1_8 Forward -324 -310 -3.04867 0.295
NP_442687.1_7 Reverse -342 -352 4.99491 0.225
NP_441077.1_6 Forward -25 -9 6.46533 0.239
NP_440066.1_5 Reverse -78 -97 6.09517 0.287
NP_441846.1_10 Reverse -372 -391 -6.09707 0.19
NP_440892.1_1 Reverse -97 -116 0.196116 0.216
NP_440642.1_10 Reverse -23 -37 16.2235 0.119
NP_441763.1_5 Forward -389 -370 -4.13045 0.234
NP_442198.1_1 Forward -367 -348 13.8641 0.29
NP_442782.1_2 Forward -111 -97 5.21113 0.246
NP_442544.1_2 Reverse -134 -148 8.65272 0.106
NP_439968.1_2 Reverse -336 -355 13.5683 0.257
NP_442937.1_5 Forward -360 -341 11.9958 0.123
NP_442937.1_5 Reverse -137 -156 11.9958 0.123
NP_442937.1_5 Forward -102 -83 6.58763 0.275
NP_442937.1_5 Forward -357 -338 6.09597 0.288
NP_439990.1_5 Reverse -137 -150 7.29578 0.203
NP_442536.1_4 Forward -278 -260 8.37728 0.299
NP_442536.1_8 Forward -349 -330 13.0775 0.241
NP_442536.1_8 Forward -364 -345 12.3892 0.253
NP_442210.1_5 Forward -360 -341 14.2574 0.19
NP_442210.1_9 Forward -380 -362 11.0322 0.23
NP_442438.1_10 Forward -156 -142 -0.0987402 0.248
NP_440605.1_5 Forward -254 -236 10.8356 0.205
NP_443063.1_7 Forward -329 -313 4.97508 0.288
NP_440736.1_8 Reverse -278 -297 18.0349 0.256
NP_440983.1_5 Reverse -343 -362 0.196116 0.216
NP_440260.1_7 Reverse -259 -278 0.58944 0.241
NP_440260.1_8 Reverse -79 -97 0.904127 0.193
NP_441514.1_1 Forward -301 -291 14.4405 0.274
NP_440177.1_1 Reverse -336 -354 12.0155 0.252
NP_441556.1_4 Reverse -346 -365 18.5853 0.109
NP_441556.1_4 Reverse -334 -353 15.1147 0.161
NP_441556.1_4 Reverse -349 -368 14.1506 0.171
NP_440929.1_8 Forward -315 -306 0.884706 0.293
NP_440566.1_2 Reverse -348 -367 5.99764 0.265
NP_442933.1_10 Reverse -142 -151 6.98123 0.116
NP_442313.1_5 Forward -252 -233 23.0089 0.0328
NP_442142.1_4 Forward -154 -141 2.67367 0.281
NP_442143.1_10 Forward -274 -255 13.8641 0.213
NP_442476.1_5 Reverse -337 -356 11.4058 0.256
NP_443009.1_5 Reverse -265 -276 4.97473 0.222
NP_442301.1_2 Reverse -333 -352 9.83173 0.2
NP_440357.1_3 Forward -277 -258 -1.18052 0.297
NP_439939.1_6 Reverse -337 -356 12.1925 0.28
NP_441020.2_6 Reverse -356 -373 6.43035 0.262
NP_441015.1_8 Forward -40 -21 0.196116 0.28
NP_441015.1_10 Forward -327 -308 -1.37718 0.172
NP_441015.1_10 Forward -357 -338 -5.80207 0.232
NP_441826.1_5 Reverse -326 -345 0.786102 0.3
NP_442490.1_9 Forward -379 -360 -6.58872 0.273
NP_441764.1_8 Forward -303 -293 13.2248 0.284
NP_442719.1_2 Reverse -9 -27 8.6715 0.0946
NP_441251.1_8 Forward -26 -13 12.6667 0.262
NP_442808.1_1 Reverse -67 -77 4.40448 0.199
NP_442808.1_1 Reverse -327 -337 4.10949 0.207
NP_442050.1_5 Forward -65 -55 7.0594 0.27
NP_440558.1_2 Reverse -334 -353 3.24438 0.159
NP_440558.1_2 Reverse -79 -98 -2.36049 0.226
NP_440558.1_2 Reverse -310 -329 -2.85214 0.231
NP_442789.1_4 Reverse -248 -267 -0.197208 0.198
NP_441878.1_6 Reverse -342 -352 -0.0199663 0.163
NP_441878.1_6 Forward -353 -343 -7.29646 0.217
NP_441036.1_3 Forward -29 -10 -2.75381 0.235
NP_441036.1_3 Forward -198 -179 -5.50708 0.288
NP_442650.1_2 Forward -117 -103 10.1277 0.13
NP_441445.1_1 Reverse -302 -321 2.94938 0.224
NP_441445.1_1 Forward -361 -342 0.687771 0.27
NP_442066.2_4 Forward -329 -310 -0.000545616 0.172
NP_442397.1_9 Reverse -381 -400 5.30933 0.246
NP_440440.1_2 Reverse -332 -351 14.4533 0.264
NP_441574.1_1 Reverse -130 -149 0.786102 0.186
NP_440276.1_8 Reverse -132 -151 9.73422 0.244
NP_441549.1_9 Forward -356 -338 -5.38906 0.198
NP_441549.1_9 Reverse -50 -68 -10.4039 0.278
NP_441633.1_3 Forward -277 -264 -7.06055 0.288
NP_442998.1_5 Forward -28 -18 10.8948 0.201
NP_442998.1_5 Reverse -263 -273 7.35486 0.295
NP_440899.1_5 Reverse -333 -352 8.65258 0.232
NP_441799.1_4 Reverse -335 -354 -1.86883 0.203
NP_440640.1_9 Reverse -367 -386 10.9142 0.298
NP_441007.1_10 Forward -357 -344 -0.669033 0.287
NP_441449.1_8 Reverse -344 -363 13.9854 0.281
NP_442333.2_5 Reverse -309 -328 -13.0786 0.251
NP_440256.1_1 Forward -110 -91 -9.44032 0.28
NP_441090.1_2 Forward -368 -349 0.491109 0.267
NP_441559.1_8 Reverse -261 -275 -6.09693 0.274
NP_441559.1_8 Reverse -64 -78 -6.49025 0.279
NP_442785.1_7 Reverse -364 -378 10.3243 0.229
NP_442452.1_3 Reverse -371 -390 1.0811 0.282
NP_441464.1_8 Reverse -343 -357 5.30946 0.259
NP_441494.1_6 Reverse -260 -273 7.88576 0.246
NP_442386.1_9 Reverse -68 -77 6.58748 0.219
NP_442791.1_9 Reverse -311 -330 23.2047 0.0402
NP_440168.1_9 Forward -330 -311 -3.14714 0.288
NP_440327.1_6 Forward -364 -345 2.94938 0.285
NP_441776.1_5 Reverse -138 -157 17.0107 0.182
NP_440586.1_9 Reverse -312 -331 8.94757 0.263
NP_442959.1_4 Reverse -19 -38 5.211 0.253
NP_439937.1_8 Forward -96 -77 -0.983855 0.247
NP_439937.1_8 Reverse -347 -366 -3.14714 0.265
NP_439937.1_9 Forward -276 -259 -2.22346 0.145
NP_441595.1_2 Reverse -284 -297 12.0938 0.277
NP_440408.1_7 Reverse -337 -356 11.2092 0.229
NP_440819.1_5 Forward -29 -21 7.68924 0.266
NP_441293.1_6 Reverse -287 -306 16.281 0.1
NP_442384.1_10 Forward -352 -339 6.01747 0.113
NP_442384.1_10 Forward -151 -138 0.707601 0.282
NP_440948.1_4 Reverse -89 -108 9.93088 0.278
NP_442035.1_8 Forward -154 -140 13.6676 0.237
NP_441018.1_7 Forward -356 -337 7.07928 0.277
NP_442244.1_6 Reverse -301 -320 3.14605 0.291
NP_440163.1_10 Reverse -355 -365 8.73149 0.262
NP_440344.1_10 Forward -123 -106 -12.8425 0.267
NP_440282.1_10 Reverse -378 -397 -7.76869 0.253
NP_440297.1_9 Forward -351 -341 -0.511621 0.289
NP_440894.1_10 Reverse -23 -42 14.1591 0.102
NP_440888.1_2 Forward -396 -382 9.83206 0.113
NP_441771.1_4 Forward -156 -137 -2.85214 0.292
NP_440052.1_8 Forward -360 -341 11.7992 0.19
NP_441829.1_4 Reverse -262 -276 20.2558 0.0746
NP_442337.1_8 Forward -386 -367 2.55606 0.217
NP_440710.1_1 Reverse -335 -353 -1.84914 0.186
NP_441621.1_7 Forward -348 -334 -5.01529 0.248
NP_442204.1_1 Reverse -378 -389 6.25352 0.17
NP_440454.1_2 Forward -152 -138 14.8129 0.198
NP_441033.1_2 Reverse -318 -337 -2.95047 0.179
NP_442859.1_2 Reverse -143 -162 3.83436 0.235
NP_441052.1_2 Reverse -343 -353 4.3066 0.161
NP_442907.1_9 Reverse -338 -357 -3.54046 0.267
NP_441004.1_1 Forward -364 -345 -17.7985 0.294
NP_441004.1_5 Forward -359 -345 6.6861 0.298
NP_442813.1_4 Forward -112 -93 -5.40875 0.299
NP_442176.1_1 Forward -238 -219 0.392778 0.294
NP_442873.1_5 Reverse -312 -331 15.1416 0.178
NP_443054.1_2 Reverse -264 -278 0.88457 0.252
NP_442622.1_1 Forward -368 -349 -6.1954 0.257
NP_442011.1_1 Forward -323 -304 -2.55715 0.276
NP_442515.1_1 Reverse -342 -356 0.589577 0.187
NP_441396.1_5 Forward -354 -345 8.25953 0.224
NP_440593.1_3 Reverse -77 -96 0.982764 0.19
NP_441394.1_10 Reverse -351 -369 8.96649 0.263
NP_442843.1_4 Reverse -78 -96 13.8838 0.274
NP_441031.1_8 Reverse -113 -132 3.24438 0.18
NP_441031.1_8 Forward -363 -344 -3.44213 0.248
NP_441078.1_4 Forward -352 -343 -1.86856 0.272
NP_442443.1_1 Forward -336 -317 -1.86883 0.245
NP_442443.1_1 Forward -99 -80 -6.88371 0.299
NP_440793.1_1 Reverse -4 -18 9.04542 0.295
NP_441432.1_9 Reverse -12 -25 12.7675 0.197
NP_441432.1_9 Reverse -1 -14 11.701 0.221
NP_441432.1_9 Reverse -11 -24 8.88924 0.284
NP_441732.1_2 Forward -143 -127 -17.641 0.281
NP_441030.1_3 Forward -41 -22 18.0915 0.243
NP_440629.1_4 Forward -312 -293 15.3391 0.161
NP_440629.1_5 Forward -276 -257 21.0423 0.0439
NP_440629.1_9 Forward -232 -213 13.8641 0.078
NP_440760.1_1 Forward -352 -333 -19.9617 0.22
NP_441131.1_9 Forward -364 -345 14.3558 0.164
NP_440578.1_10 Reverse -16 -35 16.0274 0.246
NP_441945.1_10 Reverse -129 -148 8.84924 0.273
NP_442727.1_1 Forward -359 -345 15.3392 0.208
NP_442400.1_10 Reverse -60 -73 13.4306 0.187
NP_442489.1_7 Forward -352 -343 -1.37691 0.195
NP_441659.2_8 Reverse -343 -353 3.42162 0.161
NP_441022.1_1 Reverse -99 -108 10.7788 0.285
NP_439912.1_7 Forward -268 -249 13.9625 0.26
NP_442776.1_1 Reverse -271 -290 6.29264 0.231
NP_442346.1_5 Reverse -342 -352 9.61647 0.118
NP_442346.1_5 Reverse -141 -151 9.61647 0.118
NP_440025.1_3 Reverse -199 -213 13.8056 0.235
NP_441629.1_3 Reverse -336 -355 -1.27961 0.262
NP_441126.1_6 Forward -306 -292 17.5509 0.228
NP_440459.1_2 Forward -331 -314 9.77361 0.219
NP_440010.1_4 Forward -161 -142 -1.96793 0.273
NP_440010.1_10 Reverse -299 -318 4.32602 0.246
NP_440847.1_3 Reverse -17 -31 13.6669 0.209
NP_441329.1_6 Forward -27 -8 -1.76702 0.293
NP_441895.1_10 Forward -31 -12 -18.5851 0.282
NP_442162.1_10 Reverse -38 -57 16.8047 0.216
NP_442073.1_6 Reverse -328 -347 -1.27885 0.271
NP_442546.1_2 Reverse -7 -26 3.34192 0.229
NP_442021.1_3 Reverse -124 -143 -5.80207 0.257
NP_442547.1_7 Forward -332 -313 15.0891 0.168
NP_441813.1_7 Forward -154 -140 11.5037 0.216
NP_441813.1_7 Reverse -343 -357 10.2254 0.235
NP_440594.1_6 Reverse -79 -98 16.4199 0.169
NP_442089.1_6 Reverse -109 -128 4.32602 0.262
NP_440590.1_4 Forward -150 -137 -2.83231 0.251
NP_441239.1_9 Forward -330 -318 9.08543 0.115
NP_441239.1_9 Reverse -311 -323 5.44718 0.221
NP_442568.1_8 Forward -24 -10 9.83269 0.257
NP_440665.1_1 Forward -364 -345 -14.1602 0.261
NP_440665.1_1 Reverse -346 -365 -17.2085 0.298
NP_440665.1_2 Reverse -194 -213 -4.32711 0.246
NP_442044.1_1 Reverse -335 -354 -3.63879 0.176
NP_441230.1_5 Reverse -349 -368 0.884433 0.258
NP_440675.1_3 Forward -367 -348 7.17762 0.25
NP_440462.1_4 Forward -359 -345 6.6861 0.278
NP_442340.1_3 Forward -149 -130 -8.94866 0.265
NP_442479.1_5 Reverse -9 -28 7.5772 0.222
NP_441582.1_5 Forward -277 -258 3.73524 0.259
NP_441269.1_1 Forward -363 -344 16.1257 0.0855
NP_441474.1_1 Reverse -345 -364 0.588665 0.255
NP_442402.1_1 Reverse -22 -41 16.6174 0.112
NP_442402.1_2 Reverse -27 -41 10.3237 0.292
NP_442402.1_4 Reverse -140 -159 -10.2277 0.298
NP_442402.1_10 Forward -271 -261 13.1559 0.204
NP_441848.1_4 Forward -308 -292 8.02812 0.288
NP_441848.1_7 Reverse -14 -33 3.34192 0.217
NP_442039.1_7 Forward -260 -250 7.05986 0.283
NP_441811.1_4 Reverse -333 -352 5.99764 0.196
NP_442679.1_1 Forward -31 -12 -0.787193 0.225
NP_440160.1_1 Forward -32 -13 8.61937 0.289
NP_440160.1_2 Forward -174 -155 -2.75381 0.249
NP_440160.1_3 Reverse -346 -365 18.6815 0.109
NP_440505.1_3 Forward -119 -109 4.89658 0.257
NP_440505.1_7 Reverse -183 -202 1.57275 0.249
NP_440914.1_7 Reverse -200 -219 7.59119 0.274
NP_442533.1_1 Reverse -370 -389 -15.7335 0.257
NP_442533.1_1 Reverse -247 -266 -16.1268 0.263
NP_442533.1_1 Forward -355 -336 -16.9135 0.277
NP_442533.1_6 Reverse -343 -352 5.60459 0.137
NP_442533.1_6 Forward -352 -343 3.7363 0.204
NP_442541.1_10 Reverse -313 -327 4.12889 0.252
NP_442232.1_3 Forward -99 -80 -10.4236 0.27
NP_442203.1_3 Forward -300 -281 7.75703 0.257
NP_441028.1_6 Forward -270 -260 8.23937 0.216
NP_441527.1_4 Forward -23 -4 -3.86785 0.175
NP_441527.1_4 Forward -27 -8 -5.30023 0.198
NP_441527.1_4 Forward -24 -5 -7.49654 0.235
NP_441527.1_4 Forward -34 -15 -9.1199 0.255
NP_440007.1_9 Reverse -378 -392 2.65453 0.277
NP_440007.1_9 Forward -120 -106 0.88457 0.29
NP_441680.1_4 Reverse -347 -366 -2.85214 0.275
NP_441972.1_5 Forward -150 -131 -10.1286 0.299
NP_441286.1_1 Forward -353 -341 -5.07423 0.188
NP_442674.1_2 Reverse -3 -22 8.35759 0.255
NP_439955.1_10 Forward -67 -48 14.9449 0.258
NP_440886.1_7 Reverse -342 -352 6.17443 0.141
NP_440828.1_1 Reverse -327 -346 0.392004 0.269
NP_442614.1_2 Reverse -343 -357 6.29277 0.291
NP_442401.1_2 Reverse -334 -353 6.98015 0.282
NP_442022.1_4 Forward -364 -345 8.35759 0.268
NP_442842.1_5 Forward -342 -323 18.3865 0.113
NP_441988.1_2 Reverse -334 -353 13.2741 0.239
NP_442794.1_1 Reverse -138 -150 4.46387 0.261
NP_441431.1_3 Forward -364 -345 3.04771 0.275
NP_441836.1_2 Forward -175 -156 -2.16383 0.226
NP_441993.1_1 Forward -328 -309 6.81956 0.177
NP_442698.1_10 Forward -143 -124 -0.983855 0.297
NP_442698.1_10 Forward -37 -18 -0.983855 0.297
NP_441237.1_6 Forward -328 -311 3.48043 0.262
NP_442940.1_2 Reverse -337 -356 3.44104 0.258
NP_442940.1_2 Forward -397 -378 -0.295539 0.296
NP_442680.1_5 Forward -31 -12 2.12373 0.237
NP_441984.1_3 Forward -332 -314 6.41066 0.269
NP_442341.1_9 Forward -319 -305 12.0937 0.113
NP_441756.1_5 Reverse -309 -328 -0.885524 0.25
NP_441756.1_5 Reverse -315 -334 -1.37718 0.255
NP_441173.1_9 Forward -269 -261 10.1471 0.261
NP_442395.2_4 Reverse -348 -367 1.37531 0.244
NP_440076.1_5 Forward -324 -305 11.405 0.3
NP_440507.2_3 Forward -379 -360 7.07848 0.29
NP_440679.1_7 Forward -362 -343 17.6007 0.274
NP_440679.1_10 Forward -359 -340 -20.7484 0.286
NP_441122.1_1 Forward -236 -221 3.12649 0.285
NP_441207.1_7 Forward -300 -286 8.67452 0.282
NP_439962.1_4 Forward -346 -327 -8.26035 0.292
NP_440149.1_8 Forward -328 -309 -6.29373 0.246
NP_440216.1_9 Forward -32 -23 11.3078 0.269
NP_441008.1_4 Reverse -346 -365 15.933 0.295
NP_440416.1_9 Reverse -299 -318 -8.06369 0.109
NP_443052.1_9 Reverse -333 -352 -6.58872 0.285
NP_440072.1_5 Forward -361 -343 -4.11075 0.292
NP_442154.1_1 Forward -360 -342 -4.70074 0.125
NP_442154.1_1 Forward -354 -336 -12.5672 0.217
NP_442154.1_1 Forward -363 -345 -16.1071 0.232
NP_442154.1_6 Forward -359 -340 4.12936 0.234
NP_442564.1_9 Reverse -142 -156 13.3488 0.3
NP_442046.1_8 Forward -150 -131 10.4225 0.293
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GCTGGGTCTTTCCCTCACCCTGGTGTCCATTAGCCTGACCGCTGTGTTGGTGGTGGCCCTACCGGCGTTACAGGAACTGGCCCGGGCGGCACGCAGTGCAGAAAAATTATTTGACAGCCTTAATCGGGAATTTCCCCCCACGTTGGAAGCCATTCGTTTAACGGGTTTGGAAATTAGCGAATTGACAGATGATTTAAACCAAGGGGTCAGAACAGTGGAAGACGTAGTTCAAACCGTGGACCGGGGCGTAACCATCACCAAAGAGGGAGCCAAAAAGGTGCAAGGGGGTTCCAAACGCTTTGTGGCGGGAGTCAAGGCAGCCTGGCATTCCTGGCAAGTCTATCCCACAGAGCATTTAACCGTGGAGAGCAAGGGAAAAAATGGTAAAAAGTAAGCAAAT

CDS

ATGACTGTTTCTCCCTCAGCCCTGGCGGAATTGGGGTTTAACTACCAGGAAGAAGATTCAGTGCGCCCTTGGGCGGCGGTGCTGGTGGATTTACCCCAAAATGAAGGGGTTTATACCTATGCCATTCCCCCAGGTTTAACCGTGCAGGATGGGGACATTGTGGCGGTGCCCTTTGGTAACCAGCAGTTGGGGGGCATTGTGGTGGGTTGTTTGACAAAACTGCCACCGGATTTGCCGCCGGAAAAAATTAAGCCCATTCAAGACGTAATTGTATCGGGCTTTTTTGCGCCCCATTATTGGCGGCTGTTGCATTGGTTGGCGGAATATTATTGCACCGAGTTAATCACCGTTATTCGCATGGCGTTGCCACCAGGTTTACTCCAGCGGTCCCAGCGTCGCATTAAATTGAATGGCGATCGCCTGCCATCGGACTGGCCATTGTTTTTGAGTCAACCGTCCCACCAGGGAGCAAGGCAAATTCTAACCCTACTGCAATCATCTAAGGAAGGGGATTATAGTTACCGTTACCTGCGGCAAAAAGTACCAGGGTTGACTAAGGCGTTGCGGGATTTGCTCAAACGACAATGGGTGGAAAGTTACCTGGAACCCCCCAAAGCGGTGCAGCCCCAGTTACCCAAAATGGTGACTTTATTAAATTTTGACCCCAGTTTCAAACTGACGGAGCTACAGGCCAGAACCCTGATAGTGCTCAAAAACCAGGGGGGGGAAATGTGGTTAGCGGATTTACTCAAAGCAGTGCCCTGTTCCGCCTCTACCATTCAATCCTTGGCAAAAAAAGGACTAGTGGCGATCGCCGAACGGGAAAAATTACGGCTTTTCCAGCAACCGTCGATTAATGCCAGCCAAGCTCCAGAACTAACTCCTGCGCAGAAGCAAGCTTGCCAAACTGTCCTGCCCCTCCAGGGTTACCATCAGGTTTTGCTCCACGGTGTCACCGGCTCCGGCAAAACGGAAGTTTACCTGCAAATCTGTGGCGATCGCCTGGGCAAGGGCCAATCGGTTTTAGTGCTAGTACCGGAAATTGGTTTGACCCCCCAGTTAACCGACCGTTTTCGGGCCCGTTTTGGCAATAAGGTGGCTGTGTACCATAGCGGCCTATCTTCCGGGGAAAAGTACGACACCTGGCGGCAAACTCTCCTAGGTCATGAACAGATTGTCATTGGTACCCGTTCCGCTATTTTTACGCCCCTGCCTAATCTGGGATTAATCATCCTTGATGAAGAACATGACAGTAGCTTTAAGCAAACCCAGTTAACTCCTAATTACCATGCCCGCACCGTGGCCCAACGCCGGGCCGAACTTGAACAATGCCCCCTCATCCTGGGTTCCGCTACCCCTTCTTTGGAAAGCTGGCATACAGTTCATCGCCATCAAAATGACCCCCAGCGACATTACCTAGAGTTACCAGAACGGGTGCAGTCCCGCCCCCTACCCCCGGTGCAAATTGTCGATATGCGGGCGGAATTAAAACAGGGCAATCGCTCCATTTTTAGTCGGGCTTTACAAACTGCCCTGGGGGAACTCAAAGCCAAACAACAGCAAGGTATTTTGTTTATTAACCGCCGGGGCCATAGCACCTTTGTCTCCTGTCGCAGTTGCGGTTATGTGTTGGAATGTCCCAACTGTGACGTTTCCCTTTCCTATCACTACGTCCAGGGCAATGGCCAACCTCTCCTGCGGTGCCATTACTGTAACCATGCGGAAATCCAGCCCAAAGTGTGTCCGGAATGTTCTTCCCCCTATCTGAAATTTTTTGGCAGTGGCACCCAAAAAGTAACCGAAGCCCTAACCCAAGAATTTCCCGATTTACGCTGGATTCGCTTTGACAGTGACACCACCCGCCGTAAAGGTGCCCATCGAGCCTTGTTGGATCAATTCCAACGGGGAGAAGCAGATTTACTGGTGGGAACGCAAATGTTAACCAAAGGGTTAGACCTGGCCCAGATTACCTTGGTGGGGGTGGTGGCCGCCGATAGTTTACTTAATTTTGCCGATTATCGTTCTGCTGAGCGGGGTTTTCAGACCTTAACCCAGGTGAGTGGCCGGGCTGGCCGGGGAGAAGAGCCGGGGCAAGTGATTATCCAAACCTATACCCCCCGCCATCCTGTGATCCAAGCCGTTAAAACCCACAATTACCATGGTTTTATCGCCCAGGAGTTACCCCAACGGGAAATGTTAAATTATCCCCCCTACGGCAAGTTAATTTTGCTCCGTTGTCTGGGGACCAATGAAAGGGAGGTGGAAAAAACGATCCAGGCGATCGCCGTTTTGTGTGAACAACTTTTACCCAAGACCGTGGAGATTTTGGGACCCGCCCCGGCCAGTATTCTCCGCATTGCCCAACGGTATCGCTGGCAGTTGTTAGTTAAATATCCCAGCTTCATCAAAGTAATTTTGCCGCTGGAGAGAATTAAACAAATTTGCCCTAGCTCCGTTTACCTGGATATTGACGTGGACCCCCTCAGCATTGATTAG

Protein

MTVSPSALAELGFNYQEEDSVRPWAAVLVDLPQNEGVYTYAIPPGLTVQDGDIVAVPFGNQQLGGIVVGCLTKLPPDLPPEKIKPIQDVIVSGFFAPHYWRLLHWLAEYYCTELITVIRMALPPGLLQRSQRRIKLNGDRLPSDWPLFLSQPSHQGARQILTLLQSSKEGDYSYRYLRQKVPGLTKALRDLLKRQWVESYLEPPKAVQPQLPKMVTLLNFDPSFKLTELQARTLIVLKNQGGEMWLADLLKAVPCSASTIQSLAKKGLVAIAEREKLRLFQQPSINASQAPELTPAQKQACQTVLPLQGYHQVLLHGVTGSGKTEVYLQICGDRLGKGQSVLVLVPEIGLTPQLTDRFRARFGNKVAVYHSGLSSGEKYDTWRQTLLGHEQIVIGTRSAIFTPLPNLGLIILDEEHDSSFKQTQLTPNYHARTVAQRRAELEQCPLILGSATPSLESWHTVHRHQNDPQRHYLELPERVQSRPLPPVQIVDMRAELKQGNRSIFSRALQTALGELKAKQQQGILFINRRGHSTFVSCRSCGYVLECPNCDVSLSYHYVQGNGQPLLRCHYCNHAEIQPKVCPECSSPYLKFFGSGTQKVTEALTQEFPDLRWIRFDSDTTRRKGAHRALLDQFQRGEADLLVGTQMLTKGLDLAQITLVGVVAADSLLNFADYRSAERGFQTLTQVSGRAGRGEEPGQVIIQTYTPRHPVIQAVKTHNYHGFIAQELPQREMLNYPPYGKLILLRCLGTNEREVEKTIQAIAVLCEQLLPKTVEILGPAPASILRIAQRYRWQLLVKYPSFIKVILPLERIKQICPSSVYLDIDVDPLSID