Your browser is old and dusty. Try Google Chrome!

Details for 6803t35

ORF 6803t35
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -281 -295 18.2892 0.0205
NP_441061.1_2 Reverse -189 -203 3.63784 0.161
NP_441418.1_6 Forward -197 -178 -11.4069 0.0496
NP_441418.1_6 Forward -137 -118 -29.3032 0.221
NP_441418.1_6 Reverse -229 -248 -29.4998 0.228
NP_441418.1_6 Forward -362 -343 -29.7948 0.238
NP_441418.1_6 Forward -209 -190 -30.0898 0.256
NP_441418.1_6 Reverse -259 -278 -30.0898 0.256
NP_442272.1_7 Forward -194 -175 17.0107 0.199
NP_441453.1_4 Forward -55 -47 14.8674 0.00947
NP_441453.1_4 Reverse -139 -147 7.19758 0.0757
NP_441453.1_4 Reverse -46 -54 6.80426 0.121
NP_441453.1_4 Forward -197 -189 6.80426 0.121
NP_441453.1_4 Forward -148 -140 6.80426 0.121
NP_441453.1_8 Reverse -39 -56 18.1317 0.142
NP_442838.1_7 Reverse -41 -60 -10.0303 0.232
NP_440226.1_1 Forward -148 -129 13.4708 0.0356
NP_440226.1_1 Forward -55 -36 8.55425 0.0849
NP_442623.1_3 Reverse -140 -159 -9.047 0.129
NP_442287.1_1 Forward -284 -274 13.0576 0.288
NP_442173.1_1 Reverse -47 -55 13.8841 0.0225
NP_442173.1_1 Forward -54 -46 12.0158 0.0316
NP_442173.1_1 Forward -147 -139 7.68924 0.142
NP_442173.1_1 Reverse -189 -197 5.72262 0.203
NP_442173.1_1 Reverse -140 -148 5.72262 0.203
NP_442752.1_4 Forward -197 -190 13.8055 0.0199
NP_442752.1_4 Forward -148 -141 13.8055 0.0199
NP_442752.1_4 Reverse -46 -53 13.8055 0.0199
NP_442752.1_4 Forward -398 -391 5.44732 0.202
NP_440784.1_7 Forward -196 -189 6.23397 0.241
NP_440784.1_7 Forward -147 -140 6.23397 0.241
NP_440784.1_7 Reverse -47 -54 6.23397 0.241
NP_440784.1_7 Reverse -189 -196 6.13563 0.241
NP_440784.1_7 Reverse -140 -147 6.13563 0.241
NP_440784.1_7 Forward -54 -47 6.13563 0.241
NP_440061.1_9 Reverse -137 -151 6.39049 0.248
NP_440061.1_9 Reverse -339 -353 5.80051 0.272
NP_440061.1_9 Reverse -133 -147 5.01387 0.298
NP_440878.1_9 Reverse -64 -83 6.88262 0.174
NP_442062.1_8 Forward -148 -138 16.6963 0.00399
NP_442062.1_8 Forward -398 -388 9.51814 0.0613
NP_442062.1_8 Reverse -46 -56 7.94484 0.0848
NP_442062.1_8 Forward -55 -45 7.15819 0.107
NP_442062.1_8 Forward -197 -187 6.96153 0.112
NP_442062.1_8 Reverse -139 -149 5.09324 0.184
NP_442062.1_8 Forward -362 -352 4.79825 0.198
NP_441859.1_3 Forward -198 -179 14.3549 0.0705
NP_441859.1_3 Reverse -340 -359 6.39016 0.178
NP_441859.1_3 Forward -399 -380 2.16195 0.266
NP_440304.1_4 Forward -352 -342 5.97822 0.185
NP_440304.1_4 Reverse -111 -121 3.32329 0.299
NP_442242.1_4 Reverse -189 -196 10.8555 0.127
NP_442242.1_4 Reverse -140 -147 10.8555 0.127
NP_441781.1_7 Reverse -274 -293 2.0644 0.21
NP_441581.1_6 Reverse -126 -145 14.4312 0.283
NP_441935.1_7 Forward -357 -338 4.81767 0.247
NP_440893.1_3 Forward -170 -151 4.91521 0.262
NP_441208.1_9 Forward -58 -44 7.07942 0.227
NP_441594.1_6 Forward -277 -258 2.75272 0.244
NP_441594.1_6 Reverse -191 -210 2.0644 0.256
NP_441594.1_6 Forward -359 -340 1.27776 0.269
NP_441594.1_6 Reverse -272 -291 0.786102 0.281
NP_440370.1_10 Forward -64 -45 13.6675 0.12
NP_442110.1_7 Reverse -139 -153 2.2612 0.222
NP_442367.1_1 Forward -72 -53 -7.57203 0.26
NP_442367.1_1 Forward -210 -191 -10.4236 0.26
NP_441925.1_4 Forward -281 -262 -6.19614 0.185
NP_441925.1_4 Reverse -271 -290 -8.75273 0.212
NP_441925.1_4 Reverse -276 -295 -13.3743 0.257
NP_441083.1_5 Reverse -188 -198 9.7148 0.0231
NP_441083.1_5 Reverse -46 -56 6.96153 0.0717
NP_441083.1_5 Reverse -139 -149 1.74999 0.198
NP_441083.1_5 Forward -55 -45 0.865012 0.218
NP_441083.1_5 Forward -197 -187 0.0783647 0.245
NP_441083.1_5 Reverse -341 -351 -1.10161 0.295
NP_441434.1_7 Forward -142 -128 10.521 0.163
NP_441738.1_2 Reverse -190 -197 15.28 0.0102
NP_441738.1_2 Reverse -141 -148 15.28 0.0102
NP_441738.1_2 Forward -53 -46 15.28 0.0102
NP_441738.1_2 Reverse -391 -398 10.2652 0.101
NP_441558.1_5 Reverse -284 -303 9.93088 0.11
NP_441558.1_5 Forward -40 -21 4.81767 0.269
NP_441558.1_10 Reverse -197 -216 21.3373 0.0684
NP_440209.1_1 Reverse -188 -196 11.9175 0.0184
NP_440209.1_1 Forward -197 -189 8.57422 0.0425
NP_440209.1_1 Forward -148 -140 8.57422 0.0425
NP_440209.1_1 Reverse -46 -54 8.57422 0.0425
NP_440209.1_1 Reverse -139 -147 5.32929 0.139
NP_440209.1_1 Reverse -341 -349 2.08437 0.286
NP_442889.1_8 Reverse -136 -150 3.93223 0.27
NP_441713.1_1 Forward -61 -42 -16.0285 0.275
NP_440178.1_7 Forward -56 -37 -14.6519 0.156
NP_440178.1_7 Reverse -274 -293 -22.2233 0.258
NP_442570.1_3 Forward -211 -192 -1.37718 0.212
NP_442570.1_3 Forward -297 -278 -5.80207 0.25
NP_442111.1_4 Forward -149 -135 8.45605 0.0744
NP_441163.1_1 Forward -129 -112 22.1625 0.049
NP_441163.1_1 Reverse -279 -296 10.0679 0.217
NP_440906.1_5 Forward -196 -189 6.23397 0.234
NP_440906.1_5 Forward -147 -140 6.23397 0.234
NP_440906.1_5 Reverse -47 -54 6.23397 0.234
NP_440906.1_5 Reverse -189 -196 6.13563 0.241
NP_440906.1_5 Reverse -140 -147 6.13563 0.241
NP_440906.1_5 Forward -54 -47 6.13563 0.241
NP_440012.1_6 Forward -208 -189 6.98095 0.278
NP_440747.1_10 Forward -200 -188 5.25052 0.0154
NP_440747.1_10 Forward -151 -139 5.15219 0.0179
NP_440747.1_10 Forward -58 -46 -4.28759 0.0903
NP_440747.1_10 Reverse -277 -289 -12.0557 0.199
NP_440747.1_10 Reverse -350 -362 -12.2524 0.254
NP_440747.1_10 Reverse -136 -148 -12.3507 0.27
NP_440747.1_10 Forward -379 -367 -12.5474 0.297
NP_441486.1_1 Reverse -43 -57 14.0609 0.00683
NP_441486.1_1 Forward -35 -21 -3.54032 0.179
NP_441486.1_1 Forward -151 -137 -4.13031 0.189
NP_441486.1_1 Reverse -136 -150 -5.70361 0.254
NP_441265.1_3 Forward -356 -342 0.687908 0.243
NP_440842.1_10 Reverse -185 -199 2.45787 0.274
NP_441014.1_10 Forward -123 -104 -2.8529 0.289
NP_441012.1_4 Reverse -196 -209 11.6223 0.252
NP_441012.1_4 Reverse -121 -134 10.344 0.262
NP_443018.1_3 Forward -196 -189 12.6255 0.0471
NP_443018.1_3 Forward -147 -140 12.6255 0.0471
NP_443018.1_3 Forward -54 -47 11.7405 0.0655
NP_443018.1_3 Reverse -287 -294 9.38056 0.128
NP_443018.1_3 Reverse -47 -54 5.44732 0.193
NP_443018.1_3 Reverse -189 -196 5.25066 0.214
NP_443018.1_3 Reverse -140 -147 5.25066 0.214
NP_441634.1_9 Forward -300 -281 11.8967 0.23
NP_440376.1_1 Reverse -46 -55 5.89959 0.116
NP_440376.1_1 Forward -289 -280 2.55633 0.218
NP_440376.1_1 Forward -237 -228 1.86802 0.238
NP_440376.1_1 Forward -77 -68 0.393051 0.279
NP_440376.1_1 Forward -197 -188 0.0980582 0.285
NP_440376.1_1 Forward -148 -139 -0.000272808 0.285
NP_440376.1_1 Reverse -139 -148 -0.0986038 0.285
NP_440376.1_1 Forward -55 -46 -0.0986038 0.285
NP_440376.1_1 Reverse -188 -197 -0.196935 0.285
NP_441588.1_4 Reverse -190 -200 9.02648 0.14
NP_441588.1_4 Reverse -141 -151 9.02648 0.14
NP_441588.1_4 Forward -53 -43 6.96153 0.178
NP_442687.1_7 Reverse -45 -55 12.5664 0.0712
NP_442687.1_7 Reverse -187 -197 5.97822 0.179
NP_442485.1_3 Reverse -102 -121 1.76941 0.217
NP_441846.1_10 Reverse -259 -278 -23.1083 0.277
NP_442530.1_2 Forward -231 -221 12.4681 0.276
NP_440642.1_1 Reverse -280 -299 5.99764 0.289
NP_441013.1_2 Forward -159 -141 1.39578 0.248
NP_441013.1_2 Reverse -234 -252 -2.93078 0.287
NP_441013.1_2 Forward -300 -282 -3.52077 0.29
NP_441422.1_7 Reverse -137 -154 0.235503 0.147
NP_441422.1_7 Reverse -339 -356 -8.71262 0.279
NP_440667.1_10 Forward -316 -297 18.1907 0.161
NP_442296.1_9 Reverse -275 -294 -1.47551 0.204
NP_442658.1_1 Reverse -137 -147 6.56775 0.224
NP_442658.1_1 Forward -352 -342 6.37109 0.231
NP_442658.1_1 Reverse -44 -54 6.17443 0.235
NP_442658.1_1 Reverse -186 -196 5.87944 0.246
NP_442658.1_1 Reverse -351 -361 4.89613 0.292
NP_442658.1_1 Forward -123 -113 4.7978 0.297
NP_441855.2_4 Reverse -381 -400 9.42666 0.278
NP_442782.1_2 Reverse -269 -283 0.687908 0.286
NP_442782.1_2 Forward -148 -134 0.491246 0.289
NP_442782.1_2 Forward -294 -280 -0.000409212 0.297
NP_440656.1_8 Reverse -35 -54 -8.752 0.273
NP_441414.1_9 Forward -148 -129 3.6377 0.0578
NP_441414.1_9 Reverse -188 -207 -5.99873 0.185
NP_439968.1_8 Forward -299 -283 17.6598 0.124
NP_442300.1_10 Reverse -260 -279 12.2908 0.275
NP_441256.1_8 Forward -244 -225 5.01433 0.272
NP_442937.1_5 Forward -91 -72 9.63589 0.185
NP_441958.1_5 Reverse -45 -55 8.73149 0.0255
NP_441958.1_5 Forward -149 -139 1.55333 0.095
NP_441958.1_5 Forward -56 -46 0.963343 0.12
NP_441958.1_5 Reverse -187 -197 0.865012 0.12
NP_441958.1_5 Forward -198 -188 -6.31315 0.28
NP_441127.1_5 Reverse -267 -286 14.7358 0.274
NP_442486.1_4 Reverse -190 -209 18.584 0.0749
NP_440203.1_5 Reverse -191 -201 14.2375 0.0886
NP_440203.1_5 Reverse -142 -152 14.2375 0.0886
NP_440203.1_5 Reverse -344 -354 11.6809 0.182
NP_440995.1_8 Reverse -129 -148 4.52268 0.264
NP_440984.1_7 Reverse -269 -283 5.80112 0.24
NP_439990.1_5 Forward -202 -189 8.27909 0.179
NP_439990.1_5 Forward -153 -140 8.18076 0.18
NP_442911.1_2 Forward -207 -188 -3.14714 0.109
NP_442911.1_2 Forward -360 -341 -8.65367 0.239
NP_442911.1_2 Reverse -129 -148 -9.83364 0.264
NP_442911.1_2 Reverse -379 -398 -10.7186 0.286
NP_440153.1_5 Forward -304 -290 1.27789 0.262
NP_441591.1_10 Forward -307 -288 5.211 0.297
NP_442064.1_4 Reverse -343 -362 4.71854 0.285
NP_440200.1_5 Forward -59 -40 11.7992 0.212
NP_443055.1_6 Reverse -180 -198 0.510066 0.242
NP_443055.1_6 Reverse -105 -123 -1.9482 0.285
NP_440993.1_4 Reverse -280 -297 11.0519 0.21
NP_440993.1_4 Reverse -194 -211 2.10379 0.3
NP_440602.1_8 Forward -55 -41 18.0925 0.0898
NP_440138.1_6 Forward -294 -275 5.70185 0.227
NP_442002.1_9 Forward -351 -344 12.4288 0.185
NP_442002.1_9 Reverse -227 -234 11.1505 0.185
NP_442002.1_9 Reverse -45 -52 10.7572 0.185
NP_440809.1_9 Forward -64 -46 -7.84733 0.225
NP_441646.1_1 Forward -290 -271 14.4541 0.0811
NP_441646.1_1 Reverse -346 -365 3.04771 0.21
NP_441646.1_1 Forward -128 -109 -0.295539 0.26
NP_441292.1_2 Forward -155 -136 -4.91709 0.239
NP_442231.1_10 Forward -336 -317 16.1257 0.136
NP_441000.1_6 Forward -56 -42 4.81781 0.0933
NP_441000.1_6 Forward -149 -135 -3.73699 0.225
NP_440147.1_4 Forward -150 -137 6.31247 0.0963
NP_440147.1_4 Forward -199 -186 2.37923 0.208
NP_440147.1_4 Forward -57 -44 0.0192843 0.268
NP_440147.1_4 Reverse -44 -57 -0.0790467 0.271
NP_440147.1_4 Forward -72 -59 -0.570702 0.291
NP_441550.1_8 Forward -57 -47 11.8776 0.0415
NP_441550.1_8 Reverse -186 -196 6.96107 0.183
NP_441550.1_8 Forward -199 -189 5.38779 0.252
NP_441550.1_8 Forward -150 -140 5.38779 0.252
NP_441550.1_8 Reverse -44 -54 4.7978 0.283
NP_441916.1_7 Forward -55 -45 9.51814 0.0338
NP_441916.1_7 Reverse -139 -149 7.74818 0.0608
NP_441916.1_7 Forward -148 -138 6.66654 0.0875
NP_441916.1_7 Reverse -46 -56 5.09324 0.146
NP_441916.1_7 Forward -144 -134 3.42162 0.216
NP_440206.1_4 Reverse -276 -295 3.14526 0.282
NP_440206.1_4 Forward -207 -188 -0.29631 0.29
NP_440465.1_10 Reverse -271 -290 3.53937 0.248
NP_441041.1_4 Forward -55 -36 -1.37718 0.1
NP_441041.1_4 Forward -209 -190 -3.83545 0.126
NP_441041.1_4 Reverse -139 -158 -5.11376 0.148
NP_441041.1_4 Forward -160 -141 -13.8652 0.297
NP_441041.1_4 Forward -77 -58 -13.9635 0.299
NP_441041.1_7 Forward -58 -46 7.4176 0.167
NP_443063.1_7 Reverse -352 -368 6.45005 0.288
NP_442996.1_5 Forward -298 -279 4.62101 0.251
NP_442004.1_6 Reverse -341 -355 4.81781 0.202
NP_442004.1_6 Reverse -139 -153 4.62115 0.208
NP_442004.1_6 Reverse -188 -202 4.03116 0.227
NP_440703.1_9 Forward -283 -270 8.86849 0.226
NP_441725.1_4 Forward -355 -341 6.39049 0.277
NP_441725.1_5 Reverse -342 -352 7.35486 0.101
NP_441725.1_5 Forward -196 -186 7.05986 0.106
NP_441725.1_5 Forward -54 -44 1.455 0.135
NP_441406.1_2 Reverse -155 -174 13.6675 0.15
NP_439966.1_7 Reverse -44 -54 8.73102 0.13
NP_439966.1_7 Reverse -137 -147 7.45273 0.15
NP_439966.1_7 Reverse -186 -196 6.56775 0.177
NP_439966.1_9 Forward -400 -391 5.3096 0.253
NP_439966.1_9 Forward -240 -231 4.42462 0.253
NP_439966.1_9 Reverse -44 -53 0.983037 0.253
NP_442941.1_3 Forward -54 -44 1.65166 0.147
NP_442941.1_3 Reverse -189 -199 1.25834 0.15
NP_442941.1_3 Reverse -140 -150 1.25834 0.15
NP_440289.1_2 Reverse -43 -56 5.13249 0.0636
NP_440289.1_2 Reverse -185 -198 1.19926 0.135
NP_440289.1_2 Reverse -338 -351 -4.40561 0.288
NP_440983.1_5 Forward -89 -70 -5.21209 0.265
NP_440983.1_5 Forward -277 -258 -5.80207 0.273
NP_442281.1_1 Reverse -348 -362 10.8154 0.0537
NP_442281.1_1 Forward -153 -139 9.53707 0.0685
NP_442281.1_1 Reverse -41 -55 6.58715 0.122
NP_442281.1_1 Forward -202 -188 4.8172 0.18
NP_442281.1_1 Forward -60 -46 3.93223 0.213
NP_442281.1_1 Reverse -108 -122 2.5556 0.263
NP_440177.1_1 Forward -324 -306 6.01734 0.272
NP_442256.1_2 Reverse -186 -204 -0.7675 0.148
NP_440479.1_9 Forward -292 -274 11.8189 0.297
NP_441556.1_7 Reverse -285 -304 5.60352 0.198
NP_440375.1_8 Forward -147 -128 3.14605 0.22
NP_440375.1_8 Forward -54 -35 1.0811 0.252
NP_441644.1_6 Forward -55 -45 7.45273 0.124
NP_441644.1_6 Reverse -139 -149 6.0761 0.167
NP_441644.1_6 Reverse -188 -198 5.78111 0.176
NP_441644.1_6 Reverse -74 -84 5.78111 0.176
NP_441644.1_6 Reverse -286 -296 3.71617 0.267
NP_441644.1_6 Reverse -68 -78 3.71617 0.267
NP_443049.1_6 Forward -198 -188 16.5205 0.102
NP_443049.1_6 Forward -149 -139 12.3241 0.24
NP_442215.1_2 Forward -124 -108 -0.43312 0.167
NP_442215.1_2 Reverse -137 -153 -2.98973 0.207
NP_442215.1_2 Forward -85 -69 -5.34967 0.249
NP_442215.1_2 Forward -304 -288 -5.84132 0.26
NP_442029.1_1 Forward -133 -114 -10.3253 0.219
NP_442029.1_6 Forward -153 -134 7.37428 0.224
NP_442029.1_10 Reverse -278 -297 14.5524 0.145
NP_442247.1_8 Forward -199 -185 9.63603 0.247
NP_440253.1_2 Forward -55 -37 4.14905 0.106
NP_440929.1_8 Forward -55 -46 7.17789 0.0713
NP_442933.1_10 Reverse -139 -148 15.1427 0.00958
NP_442933.1_10 Forward -55 -46 8.06287 0.0885
NP_442933.1_10 Reverse -46 -55 7.96454 0.0937
NP_442933.1_10 Forward -148 -139 7.96454 0.0937
NP_442933.1_10 Reverse -188 -197 6.48957 0.119
NP_441751.2_8 Reverse -189 -203 6.6861 0.0348
NP_441751.2_8 Reverse -270 -284 -6.78525 0.283
NP_442926.1_1 Forward -140 -121 0.196116 0.238
NP_442926.1_3 Reverse -342 -361 10.6192 0.137
NP_442926.1_3 Reverse -189 -208 5.80098 0.214
NP_442554.1_8 Reverse -189 -199 5.48657 0.146
NP_442554.1_8 Reverse -140 -150 5.48657 0.146
NP_442554.1_8 Forward -54 -44 4.0116 0.2
NP_442554.1_8 Forward -294 -284 3.22496 0.235
NP_442554.1_8 Forward -76 -66 2.33998 0.274
NP_442554.1_8 Reverse -47 -57 2.24165 0.276
NP_442554.1_8 Reverse -287 -297 2.14332 0.281
NP_441762.1_7 Forward -56 -44 3.38223 0.0676
NP_441762.1_7 Reverse -138 -150 1.51394 0.0747
NP_441762.1_7 Forward -351 -339 1.31728 0.0747
NP_441762.1_7 Forward -198 -186 -5.07423 0.187
NP_442142.1_4 Forward -151 -138 9.16348 0.101
NP_442142.1_4 Reverse -283 -296 8.08184 0.124
NP_442292.1_1 Reverse -189 -198 8.65285 0.0335
NP_442292.1_1 Reverse -140 -149 8.65285 0.0335
NP_442292.1_1 Forward -54 -45 -0.196935 0.239
NP_442476.1_6 Forward -147 -133 1.08123 0.231
NP_440895.1_6 Forward -203 -190 11.1307 0.202
NP_443009.1_5 Forward -149 -138 7.53132 0.126
NP_443009.1_5 Forward -56 -45 6.94134 0.144
NP_443009.1_5 Reverse -227 -238 4.77807 0.23
NP_441715.1_4 Forward -304 -294 8.04317 0.107
NP_441715.1_4 Forward -147 -137 7.84651 0.107
NP_441715.1_4 Forward -54 -44 6.46988 0.143
NP_441715.1_4 Forward -361 -351 5.19158 0.224
NP_440357.1_3 Forward -240 -221 -0.4922 0.296
NP_441088.1_1 Forward -144 -125 6.78429 0.243
NP_441448.1_1 Reverse -263 -282 5.89931 0.26
NP_440183.1_9 Reverse -267 -286 -19.2734 0.277
NP_440379.1_5 Forward -125 -106 -9.44032 0.264
NP_440464.1_10 Reverse -189 -199 11.8623 0.275
NP_440464.1_10 Reverse -140 -150 11.8623 0.275
NP_441468.1_1 Forward -196 -189 6.13563 0.209
NP_441468.1_1 Forward -147 -140 6.13563 0.209
NP_441468.1_1 Reverse -47 -54 6.13563 0.209
NP_441468.1_1 Reverse -189 -196 6.0373 0.223
NP_441468.1_1 Reverse -140 -147 6.0373 0.223
NP_441468.1_1 Forward -54 -47 6.0373 0.223
NP_441020.2_6 Forward -400 -383 13.9035 0.0641
NP_441020.2_6 Forward -199 -182 11.8386 0.11
NP_441020.2_6 Forward -240 -223 9.57695 0.168
NP_441020.2_6 Forward -150 -133 6.52869 0.262
NP_441015.1_10 Forward -88 -69 -1.96717 0.176
NP_441015.1_10 Forward -143 -124 -5.70374 0.23
NP_441015.1_10 Forward -153 -134 -6.49039 0.249
NP_441015.1_10 Reverse -257 -276 -9.24366 0.281
NP_441015.1_10 Forward -367 -348 -10.0303 0.282
NP_441673.1_1 Forward -197 -188 1.37636 0.114
NP_441673.1_1 Forward -148 -139 1.27803 0.155
NP_441673.1_1 Reverse -139 -148 1.27803 0.155
NP_441673.1_1 Forward -55 -46 1.27803 0.155
NP_441673.1_1 Reverse -46 -55 1.27803 0.155
NP_441673.1_1 Reverse -188 -197 1.1797 0.163
NP_441731.1_3 Forward -205 -186 4.52268 0.159
NP_442253.1_5 Reverse -271 -288 12.9202 0.0647
NP_442253.1_5 Forward -125 -108 -5.86102 0.295
NP_442253.1_5 Forward -287 -270 -6.94266 0.298
NP_441826.1_2 Forward -154 -140 4.81781 0.0988
NP_441826.1_2 Forward -203 -189 3.63784 0.107
NP_441826.1_2 Reverse -68 -82 3.04785 0.115
NP_441826.1_2 Forward -188 -174 1.27789 0.157
NP_441826.1_2 Forward -128 -114 -1.18038 0.238
NP_441826.1_5 Forward -143 -124 3.73603 0.259
NP_441330.1_1 Reverse -134 -153 -13.9635 0.209
NP_442811.1_2 Forward -364 -345 3.24438 0.226
NP_442490.1_9 Forward -362 -343 3.6377 0.165
NP_442490.1_9 Forward -209 -190 -5.60541 0.273
NP_442868.1_6 Reverse -186 -196 6.66654 0.103
NP_442868.1_6 Forward -352 -342 3.81494 0.192
NP_442868.1_6 Forward -199 -189 0.0783647 0.248
NP_442868.1_6 Forward -150 -140 0.0783647 0.248
NP_441056.1_1 Reverse -139 -158 -6.09707 0.267
NP_442361.1_3 Forward -154 -141 14.0806 0.129
NP_442361.1_3 Reverse -40 -53 9.75405 0.272
NP_442808.1_1 Reverse -138 -148 8.63269 0.0481
NP_442808.1_1 Reverse -340 -350 8.23937 0.0547
NP_442808.1_1 Reverse -187 -197 7.84605 0.0668
NP_441101.1_7 Forward -136 -117 12.0942 0.29
NP_440145.1_3 Forward -65 -46 -3.83545 0.212
NP_442542.1_9 Reverse -39 -53 10.9137 0.111
NP_442050.1_5 Reverse -186 -196 9.91099 0.182
NP_440038.1_4 Reverse -117 -136 -0.0988766 0.277
NP_442342.1_9 Reverse -186 -202 4.28677 0.25
NP_441493.2_3 Reverse -291 -310 14.0608 0.125
NP_441114.1_3 Reverse -354 -363 14.5527 0.193
NP_441114.1_3 Reverse -114 -123 14.5527 0.193
NP_440558.1_2 Reverse -271 -290 20.059 0.0572
NP_440558.1_2 Forward -287 -268 13.5691 0.0718
NP_440558.1_2 Reverse -71 -90 -0.295539 0.2
NP_440558.1_2 Forward -157 -138 -4.13045 0.243
NP_440558.1_2 Forward -125 -106 -4.72043 0.248
NP_440558.1_2 Forward -191 -172 -6.49039 0.275
NP_442688.1_2 Forward -67 -48 15.1424 0.288
NP_441878.1_6 Forward -284 -274 0.963343 0.128
NP_441878.1_6 Forward -56 -46 0.668351 0.139
NP_441878.1_6 Reverse -187 -197 0.57002 0.14
NP_441878.1_6 Reverse -273 -283 0.0783647 0.152
NP_441878.1_6 Reverse -112 -122 -6.70647 0.194
NP_441878.1_6 Forward -122 -112 -7.49312 0.231
NP_441878.1_6 Reverse -352 -362 -7.59145 0.245
NP_441878.1_6 Reverse -274 -284 -7.98478 0.285
NP_441036.1_8 Reverse -45 -55 12.5664 0.0744
NP_441036.1_8 Reverse -138 -148 8.1415 0.176
NP_441557.1_5 Forward -148 -139 8.94785 0.0289
NP_441557.1_5 Reverse -46 -55 8.94785 0.0289
NP_441557.1_5 Forward -197 -188 1.08137 0.0794
NP_441557.1_5 Forward -55 -46 0.688044 0.128
NP_441557.1_5 Reverse -139 -148 0.688044 0.128
NP_441557.1_5 Reverse -188 -197 0.589713 0.134
NP_441445.1_1 Reverse -37 -56 1.0811 0.262
NP_441590.1_4 Forward -282 -263 17.0099 0.136
NP_441590.1_4 Reverse -282 -301 3.24359 0.29
NP_441308.1_8 Reverse -44 -54 8.4365 0.254
NP_442830.1_5 Reverse -351 -365 0.490664 0.294
NP_442469.1_2 Reverse -267 -285 12.9988 0.298
NP_442183.1_1 Forward -197 -183 17.2075 0.0118
NP_442397.1_9 Reverse -188 -207 1.27776 0.288
NP_442135.1_8 Reverse -35 -53 9.16393 0.264
NP_441574.1_1 Forward -89 -70 -1.08219 0.212
NP_441574.1_1 Reverse -296 -315 -5.80207 0.268
NP_441549.1_1 Reverse -190 -209 14.9449 0.281
NP_441549.1_9 Reverse -270 -288 -10.8956 0.291
NP_442347.1_2 Reverse -189 -198 12.2911 0.056
NP_442347.1_2 Reverse -140 -149 12.2911 0.056
NP_442347.1_2 Forward -54 -45 8.94785 0.0718
NP_442347.1_2 Reverse -390 -399 4.42462 0.284
NP_442645.1_2 Forward -156 -137 -14.9469 0.185
NP_442645.1_2 Reverse -272 -291 -16.3235 0.23
NP_442645.1_2 Forward -286 -267 -16.3235 0.23
NP_442965.1_2 Forward -294 -275 -2.55715 0.255
NP_442594.1_7 Forward -159 -140 5.2102 0.244
NP_442594.1_8 Forward -140 -121 14.4541 0.146
NP_441633.1_3 Forward -199 -186 0.904263 0.112
NP_441633.1_3 Reverse -339 -352 -4.50394 0.199
NP_440136.1_2 Forward -196 -189 6.23397 0.171
NP_440136.1_2 Forward -147 -140 6.23397 0.171
NP_440136.1_2 Reverse -47 -54 6.23397 0.171
NP_440136.1_2 Reverse -189 -196 6.13563 0.193
NP_440136.1_2 Reverse -140 -147 6.13563 0.193
NP_440136.1_2 Forward -54 -47 6.13563 0.193
NP_442590.1_10 Reverse -139 -158 11.4058 0.158
NP_442590.1_10 Forward -368 -349 9.43923 0.196
NP_442590.1_10 Forward -144 -125 4.71934 0.272
NP_442998.1_2 Reverse -120 -139 9.93006 0.171
NP_442998.1_5 Reverse -226 -236 16.4996 0.149
NP_442998.1_10 Reverse -190 -197 15.5754 0.0102
NP_442998.1_10 Reverse -141 -148 15.5754 0.0102
NP_442998.1_10 Forward -53 -46 15.5754 0.0102
NP_442998.1_10 Reverse -343 -350 12.5271 0.0457
NP_442998.1_10 Forward -36 -29 9.28223 0.117
NP_440299.1_1 Forward -152 -139 18.6032 0.00369
NP_440299.1_1 Forward -201 -188 9.95012 0.0631
NP_440299.1_1 Forward -59 -46 2.28034 0.292
NP_441799.1_1 Forward -59 -45 15.5352 0.0178
NP_441799.1_1 Forward -309 -295 8.84875 0.105
NP_441799.1_1 Forward -366 -352 6.58715 0.167
NP_441799.1_3 Reverse -338 -357 19.469 0.0953
NP_441007.1_10 Reverse -183 -196 7.00078 0.152
NP_441007.1_10 Forward -133 -120 -0.177378 0.268
NP_440256.1_1 Forward -151 -132 6.4893 0.0296
NP_440256.1_1 Forward -58 -39 -4.6221 0.161
NP_440256.1_1 Forward -379 -360 -7.67036 0.243
NP_440256.1_1 Forward -365 -346 -9.047 0.273
NP_440256.1_1 Reverse -197 -216 -10.0303 0.293
NP_441559.1_8 Reverse -348 -362 4.12949 0.132
NP_441559.1_8 Forward -242 -228 2.85119 0.143
NP_441559.1_8 Forward -241 -227 -5.01529 0.245
NP_440915.1_6 Forward -299 -285 10.1277 0.0346
NP_440915.1_6 Forward -201 -187 1.17956 0.145
NP_440915.1_6 Reverse -135 -149 -2.26202 0.265
NP_441296.1_8 Forward -295 -276 14.4541 0.258
NP_440717.1_3 Reverse -281 -295 8.45543 0.265
NP_441704.1_8 Reverse -18 -37 17.4032 0.0715
NP_441704.1_8 Forward -159 -140 7.27514 0.245
NP_442555.1_5 Forward -358 -339 20.5506 0.0644
NP_440748.1_5 Reverse -277 -296 6.29264 0.188
NP_442031.1_5 Forward -211 -192 12.8808 0.157
NP_441464.1_1 Forward -282 -263 8.35759 0.261
NP_440702.1_2 Reverse -257 -276 3.34271 0.241
NP_440026.1_7 Forward -283 -268 13.8446 0.28
NP_440695.1_5 Forward -197 -178 -0.885524 0.284
NP_441494.1_6 Forward -355 -342 10.049 0.227
NP_442993.1_1 Reverse -238 -254 -12.3312 0.27
NP_442993.1_1 Reverse -68 -84 -12.9212 0.282
NP_440677.1_1 Forward -206 -187 8.35759 0.215
NP_440677.1_1 Forward -92 -73 6.29264 0.275
NP_442386.1_9 Reverse -138 -147 6.9808 0.219
NP_442386.1_9 Reverse -45 -54 5.9975 0.23
NP_441340.1_5 Reverse -47 -54 13.5105 0.0314
NP_441340.1_5 Forward -196 -189 6.23397 0.132
NP_441340.1_5 Forward -147 -140 6.23397 0.132
NP_441340.1_5 Reverse -189 -196 5.84064 0.208
NP_441340.1_5 Reverse -140 -147 5.84064 0.208
NP_441340.1_5 Forward -54 -47 5.84064 0.208
NP_442484.1_2 Forward -159 -140 14.3558 0.0463
NP_442484.1_2 Reverse -342 -361 0.196116 0.25
NP_440327.1_6 Reverse -209 -228 3.73603 0.28
NP_442240.1_1 Forward -177 -158 7.96345 0.244
NP_442240.1_1 Forward -205 -186 3.44025 0.29
NP_442240.1_2 Forward -147 -128 -20.2567 0.295
NP_440586.1_8 Forward -196 -189 14.69 0.026
NP_440586.1_8 Forward -147 -140 14.69 0.026
NP_440586.1_8 Forward -54 -47 9.47853 0.146
NP_440586.1_8 Reverse -47 -54 5.74197 0.283
NP_442251.1_6 Reverse -189 -196 12.0355 0.0627
NP_442251.1_6 Reverse -140 -147 12.0355 0.0627
NP_442251.1_6 Reverse -342 -349 8.69224 0.199
NP_442251.1_6 Forward -37 -30 6.43063 0.298
NP_440192.1_5 Forward -149 -130 4.32602 0.254
NP_442959.1_4 Forward -289 -270 9.43923 0.216
NP_440684.1_9 Forward -203 -189 9.2427 0.221
NP_440684.1_9 Forward -304 -290 8.06273 0.24
NP_441262.1_3 Reverse -46 -53 14.7888 0.0223
NP_441262.1_3 Forward -197 -190 14.7888 0.0223
NP_441262.1_3 Forward -148 -141 14.7888 0.0223
NP_440027.1_3 Reverse -286 -304 6.70489 0.223
NP_440027.1_3 Reverse -112 -130 4.54162 0.257
NP_440027.1_3 Forward -144 -126 1.88669 0.295
NP_440027.1_8 Forward -298 -279 5.80018 0.279
NP_443051.1_1 Reverse -45 -54 7.47288 0.0571
NP_443051.1_1 Forward -198 -189 0.884706 0.125
NP_443051.1_1 Forward -149 -140 0.884706 0.125
NP_443051.1_1 Forward -56 -47 -1.08191 0.281
NP_443051.1_1 Reverse -187 -196 -1.18024 0.297
NP_443051.1_1 Forward -351 -342 -1.18024 0.297
NP_440451.1_10 Forward -367 -348 11.11 0.264
NP_439937.1_8 Forward -136 -117 -0.295539 0.239
NP_439937.1_8 Forward -400 -381 -3.63879 0.271
NP_439937.1_9 Reverse -340 -357 -1.7318 0.129
NP_439937.1_9 Reverse -45 -62 -17.1697 0.294
NP_440926.1_9 Reverse -227 -246 7.66927 0.275
NP_440836.1_6 Forward -240 -226 13.0776 0.214
NP_440408.1_7 Forward -295 -276 9.83255 0.255
NP_440439.1_1 Reverse -43 -56 8.77074 0.0497
NP_439943.1_7 Forward -153 -134 3.6377 0.29
NP_440372.1_2 Reverse -47 -54 13.8055 0.0214
NP_440372.1_2 Forward -196 -189 6.82395 0.0854
NP_440372.1_2 Forward -147 -140 6.82395 0.0854
NP_440372.1_2 Reverse -189 -196 6.52896 0.188
NP_440372.1_2 Reverse -140 -147 6.52896 0.188
NP_440372.1_2 Forward -54 -47 6.52896 0.188
NP_440770.1_10 Reverse -294 -311 20.9833 0.0919
NP_441789.1_7 Reverse -130 -149 -3.93454 0.28
NP_440316.1_10 Forward -296 -286 15.123 0.171
NP_442368.1_2 Reverse -190 -209 9.0459 0.214
NP_440139.1_1 Reverse -40 -59 16.6165 0.0474
NP_440139.1_1 Reverse -133 -152 11.5033 0.0797
NP_441572.1_7 Reverse -40 -59 -4.81876 0.244
NP_440267.1_2 Forward -283 -269 5.50552 0.264
NP_442384.1_8 Forward -175 -156 11.9958 0.258
NP_442384.1_10 Reverse -139 -152 7.39411 0.0822
NP_442035.1_8 Reverse -125 -139 14.6509 0.237
NP_441604.1_9 Reverse -263 -282 12.0942 0.289
NP_441877.1_6 Forward -61 -42 12.9791 0.219
NP_441018.1_7 Forward -299 -280 7.37428 0.272
NP_442790.1_4 Forward -140 -121 -12.1936 0.242
NP_442262.1_10 Forward -54 -47 13.2155 0.0213
NP_442262.1_10 Forward -196 -189 12.9205 0.0422
NP_442262.1_10 Forward -147 -140 12.9205 0.0422
NP_442262.1_10 Reverse -287 -294 9.47889 0.187
NP_441689.1_5 Reverse -44 -54 5.97777 0.197
NP_440163.1_10 Forward -80 -70 16.4996 0.0762
NP_440163.1_10 Reverse -43 -53 15.2213 0.0762
NP_440163.1_10 Forward -298 -288 7.84651 0.299
NP_440344.1_10 Forward -357 -340 -12.4492 0.254
NP_440344.1_10 Forward -275 -258 -12.6459 0.261
NP_440344.1_10 Reverse -181 -198 -12.7442 0.264
NP_440282.1_10 Forward -293 -274 -0.885524 0.213
NP_440282.1_10 Reverse -190 -209 -0.983855 0.216
NP_440282.1_10 Reverse -264 -283 -9.14533 0.272
NP_440531.1_6 Forward -245 -226 0.294447 0.195
NP_442910.1_1 Forward -204 -185 -7.4737 0.254
NP_440826.1_5 Reverse -157 -175 15.7703 0.231
NP_441965.1_3 Forward -207 -188 5.70265 0.151
NP_441965.1_10 Reverse -185 -201 4.77842 0.231
NP_441965.1_10 Reverse -136 -152 2.71347 0.284
NP_441640.1_1 Forward -391 -372 -1.67217 0.287
NP_442693.1_7 Forward -296 -277 8.25926 0.273
NP_440297.1_9 Forward -121 -111 3.91327 0.253
NP_440297.1_9 Forward -54 -44 -0.511621 0.289
NP_440350.1_1 Reverse -198 -217 -5.60541 0.293
NP_442187.1_3 Forward -198 -188 17.2863 0.0619
NP_440894.1_10 Reverse -183 -202 3.24438 0.276
NP_440999.1_9 Reverse -349 -363 5.60446 0.11
NP_440888.1_2 Forward -55 -41 13.372 0.0297
NP_440888.1_2 Forward -362 -348 8.45543 0.16
NP_442277.1_4 Reverse -232 -251 2.85027 0.237
NP_441538.1_2 Reverse -41 -60 20.5396 0.0518
NP_441543.1_2 Forward -147 -138 13.5694 0.0248
NP_441543.1_2 Forward -54 -45 8.65285 0.0968
NP_441543.1_2 Reverse -189 -198 7.07956 0.131
NP_441543.1_2 Reverse -140 -149 7.07956 0.131
NP_442845.1_2 Forward -203 -189 4.81781 0.251
NP_441918.1_7 Forward -138 -119 -0.000545616 0.297
NP_441469.1_4 Forward -131 -112 7.7676 0.282
NP_441469.1_8 Reverse -45 -54 6.39124 0.227
NP_442315.1_1 Forward -136 -118 6.60732 0.256
NP_442315.1_1 Forward -145 -127 2.87075 0.294
NP_443064.1_6 Reverse -46 -56 9.07643 0.247
NP_443064.1_6 Reverse -139 -149 8.88251 0.262
NP_443064.1_6 Reverse -188 -198 8.59164 0.278
NP_442337.1_8 Reverse -336 -355 0.0977854 0.258
NP_442578.1_7 Forward -196 -189 14.6904 0.026
NP_442578.1_7 Forward -147 -140 14.6904 0.026
NP_442578.1_7 Reverse -47 -54 6.0373 0.18
NP_440710.1_1 Reverse -131 -149 -0.7675 0.176
NP_441462.1_2 Reverse -46 -56 17.3846 0.00406
NP_441462.1_2 Forward -197 -187 8.53483 0.0354
NP_441462.1_2 Forward -148 -138 1.25834 0.0964
NP_441621.1_7 Reverse -186 -200 -4.81863 0.246
NP_443062.1_1 Reverse -188 -206 16.444 0.031
NP_443062.1_1 Reverse -139 -157 14.7864 0.0439
NP_443062.1_1 Forward -55 -37 8.54592 0.152
NP_443062.1_1 Forward -148 -130 4.2556 0.268
NP_441601.1_2 Reverse -23 -42 -0.39387 0.219
NP_440519.1_6 Forward -60 -46 10.3243 0.29
NP_442204.1_1 Forward -201 -190 8.7118 0.0852
NP_442204.1_1 Forward -152 -141 8.7118 0.0852
NP_442204.1_6 Forward -147 -128 12.7825 0.137
NP_440504.1_7 Forward -289 -270 -1.86883 0.238
NP_441351.1_8 Forward -130 -111 7.86593 0.192
NP_440516.1_8 Forward -197 -188 10.5211 0.00816
NP_440516.1_8 Reverse -46 -55 9.4395 0.0183
NP_440516.1_8 Forward -55 -46 5.11294 0.118
NP_440516.1_8 Forward -148 -139 0.983037 0.13
NP_440516.1_8 Forward -350 -341 0.786375 0.133
NP_440516.1_8 Forward -295 -286 -0.590259 0.283
NP_442428.1_4 Forward -78 -59 8.16093 0.18
NP_442428.1_5 Forward -196 -189 6.13563 0.209
NP_442428.1_5 Forward -147 -140 6.13563 0.209
NP_442428.1_5 Reverse -47 -54 6.13563 0.209
NP_442428.1_5 Reverse -189 -196 6.0373 0.212
NP_442428.1_5 Reverse -140 -147 6.0373 0.212
NP_442428.1_5 Forward -54 -47 6.0373 0.212
NP_440783.1_5 Forward -295 -276 -6.09707 0.29
NP_442859.1_2 Forward -147 -128 3.04771 0.262
NP_442120.1_10 Reverse -107 -126 -8.94866 0.242
NP_442120.1_10 Forward -89 -70 -9.73531 0.244
NP_440673.1_3 Forward -53 -46 12.4288 0.0426
NP_440673.1_3 Reverse -190 -197 12.4288 0.0426
NP_440673.1_3 Reverse -141 -148 12.4288 0.0426
NP_440673.1_3 Reverse -343 -350 9.77388 0.167
NP_441052.1_2 Reverse -188 -198 10.6981 0.0285
NP_441052.1_2 Forward -368 -358 1.94665 0.221
NP_441052.1_2 Reverse -139 -149 1.65166 0.233
NP_441052.1_2 Forward -335 -325 0.57002 0.256
NP_441052.1_2 Reverse -200 -210 0.176696 0.262
NP_442219.1_8 Forward -132 -113 20.053 0.0434
NP_442219.1_8 Forward -42 -23 12.1291 0.165
NP_442219.1_9 Reverse -189 -198 7.96454 0.0696
NP_442219.1_9 Reverse -140 -149 7.96454 0.0696
NP_440436.1_4 Forward -54 -45 8.55409 0.0997
NP_440436.1_4 Reverse -189 -198 7.57079 0.124
NP_440436.1_4 Reverse -140 -149 7.57079 0.124
NP_440436.1_4 Forward -147 -138 7.37413 0.132
NP_440436.1_4 Reverse -47 -56 5.11253 0.222
NP_441884.1_8 Forward -296 -277 -10.0303 0.268
NP_441884.1_9 Forward -140 -121 -22.8133 0.284
NP_441884.1_9 Reverse -110 -129 -23.1083 0.284
NP_441884.1_9 Reverse -350 -369 -23.895 0.284
NP_442086.1_6 Forward -362 -343 22.7139 0.0613
NP_441719.1_4 Forward -196 -189 13.5105 0.026
NP_441719.1_4 Forward -147 -140 13.5105 0.026
NP_441719.1_4 Reverse -47 -54 6.82395 0.0855
NP_441719.1_4 Reverse -189 -196 6.52896 0.188
NP_441719.1_4 Reverse -140 -147 6.52896 0.188
NP_441719.1_4 Forward -54 -47 6.52896 0.188
NP_441719.1_4 Forward -349 -342 3.77569 0.285
NP_441733.1_10 Reverse -43 -56 8.18076 0.14
NP_441733.1_10 Forward -353 -340 6.60746 0.179
NP_441733.1_10 Forward -151 -138 5.82081 0.203
NP_441733.1_10 Forward -200 -187 5.03416 0.231
NP_441004.1_1 Forward -89 -70 4.52268 0.106
NP_441004.1_1 Forward -137 -118 -11.0136 0.231
NP_441004.1_1 Forward -356 -337 -17.6018 0.292
NP_442366.1_3 Reverse -138 -156 2.96908 0.118
NP_442366.1_3 Reverse -187 -205 2.77242 0.123
NP_442366.1_3 Forward -56 -38 -0.275845 0.188
NP_442366.1_5 Forward -200 -190 14.0409 0.0497
NP_442366.1_5 Forward -151 -141 14.0409 0.0497
NP_442139.1_7 Forward -177 -158 8.35759 0.261
NP_442206.1_1 Forward -283 -264 -8.85033 0.219
NP_442854.1_6 Forward -295 -276 7.66927 0.229
NP_443054.1_2 Reverse -37 -51 0.589577 0.258
NP_442308.1_6 Forward -286 -267 16.5191 0.21
NP_441851.1_2 Reverse -290 -309 5.89931 0.181
NP_441851.1_10 Forward -149 -139 13.0581 0.0372
NP_441851.1_10 Forward -399 -389 8.92815 0.114
NP_441851.1_10 Reverse -45 -55 7.55152 0.137
NP_441851.1_10 Forward -198 -188 4.40493 0.271
NP_442026.1_10 Reverse -374 -393 16.1257 0.283
NP_442814.1_10 Reverse -98 -117 17.2074 0.116
NP_442011.1_1 Reverse -45 -64 -0.787193 0.268
NP_441668.1_4 Forward -207 -188 16.0274 0.0456
NP_441668.1_4 Forward -158 -139 6.88262 0.156
NP_442515.1_1 Forward -198 -184 6.48943 0.0975
NP_440593.1_3 Reverse -69 -88 -1.08219 0.211
NP_440593.1_3 Forward -133 -114 -6.88371 0.282
NP_440463.1_8 Forward -72 -53 8.37121 0.264
NP_440940.1_7 Forward -278 -260 6.01657 0.225
NP_441349.1_10 Forward -207 -188 -0.787193 0.0964
NP_441349.1_10 Forward -288 -269 -6.68705 0.235
NP_441051.1_1 Forward -243 -233 18.3679 0.292
NP_441409.1_6 Forward -61 -42 -12.8819 0.231
NP_442314.1_1 Forward -285 -267 -4.79907 0.272
NP_440432.1_9 Forward -54 -39 -1.88839 0.167
NP_440432.1_9 Forward -196 -181 -2.57671 0.174
NP_439960.1_10 Forward -296 -278 -4.50408 0.293
NP_440474.1_8 Forward -54 -40 5.50552 0.25
NP_440431.1_3 Forward -363 -344 -11.8986 0.292
NP_442450.1_5 Reverse -186 -196 8.33817 0.13
NP_440588.1_2 Forward -206 -187 5.70265 0.0625
NP_440588.1_2 Reverse -116 -135 -3.83545 0.197
NP_440954.1_4 Reverse -367 -386 5.30933 0.203
NP_442006.1_2 Reverse -145 -162 -7.92597 0.189
NP_442006.1_3 Forward -203 -185 -5.38906 0.298
NP_441003.1_9 Forward -280 -261 7.17762 0.237
NP_440483.1_1 Reverse -145 -164 -7.37537 0.262
NP_441078.1_4 Forward -197 -188 0.196389 0.205
NP_441078.1_4 Reverse -139 -148 0.0980582 0.205
NP_441078.1_4 Reverse -46 -55 0.0980582 0.205
NP_441078.1_4 Forward -148 -139 0.0980582 0.205
NP_441078.1_4 Forward -55 -46 0.0980582 0.205
NP_441078.1_4 Reverse -188 -197 -0.000272808 0.205
NP_441078.1_4 Reverse -353 -362 -1.47524 0.266
NP_442729.1_8 Reverse -184 -197 7.09911 0.166
NP_441663.1_8 Forward -203 -184 -2.85214 0.274
NP_442348.1_2 Reverse -112 -121 12.2911 0.218
NP_442348.1_2 Forward -238 -229 11.4061 0.235
NP_440707.1_9 Forward -313 -294 0.786102 0.293
NP_442443.1_1 Forward -245 -226 4.916 0.157
NP_441094.1_6 Reverse -269 -286 10.3628 0.257
NP_441432.1_8 Forward -198 -189 7.27622 0.101
NP_441432.1_8 Forward -149 -140 7.27622 0.101
NP_441432.1_8 Reverse -45 -54 5.50626 0.151
NP_442320.1_8 Reverse -40 -54 3.44117 0.0617
NP_442344.1_7 Forward -54 -35 -6.29373 0.171
NP_442344.1_7 Reverse -140 -159 -9.53865 0.257
NP_441732.1_2 Forward -201 -185 -17.2477 0.247
NP_440497.1_2 Forward -367 -348 13.3725 0.172
NP_442540.1_5 Reverse -281 -300 11.5033 0.234
NP_442003.1_9 Forward -237 -218 16.8141 0.154
NP_440760.1_1 Reverse -139 -158 -22.9117 0.274
NP_442797.1_6 Reverse -295 -314 11.0368 0.238
NP_442797.1_7 Reverse -340 -358 1.19912 0.262
NP_440199.1_10 Reverse -43 -53 14.533 0.0861
NP_440199.1_10 Forward -365 -355 6.76487 0.269
NP_440199.1_10 Reverse -356 -366 6.66654 0.287
NP_441057.1_3 Forward -245 -226 -9.63698 0.205
NP_441057.1_4 Reverse -258 -276 0.707465 0.253
NP_442353.1_4 Reverse -263 -282 -0.689632 0.29
NP_440713.1_3 Reverse -42 -61 0.982764 0.28
NP_440713.1_4 Forward -299 -280 10.9142 0.123
NP_440713.1_4 Forward -300 -281 8.75091 0.162
NP_442489.1_7 Reverse -139 -148 7.57121 0.057
NP_442489.1_7 Reverse -188 -197 7.47288 0.0613
NP_442489.1_7 Reverse -341 -350 4.91628 0.0892
NP_442489.1_7 Forward -55 -46 0.786375 0.152
NP_442489.1_7 Forward -197 -188 0.688044 0.152
NP_442489.1_7 Forward -148 -139 0.589713 0.17
NP_442489.1_7 Reverse -46 -55 0.589713 0.17
NP_442489.1_7 Reverse -353 -362 -1.6719 0.235
NP_442489.1_7 Forward -362 -353 -1.96689 0.28
NP_442079.1_7 Reverse -342 -361 5.01433 0.184
NP_442079.1_7 Reverse -140 -159 1.47442 0.251
NP_440559.1_1 Reverse -47 -56 14.651 0.0144
NP_440559.1_1 Reverse -189 -198 7.76787 0.0918
NP_440559.1_1 Reverse -140 -149 7.76787 0.0918
NP_440559.1_1 Forward -196 -187 6.09625 0.134
NP_440559.1_1 Forward -147 -138 5.80125 0.136
NP_441659.2_8 Forward -55 -45 6.56821 0.0714
NP_441659.2_8 Reverse -139 -149 6.27322 0.0797
NP_441659.2_8 Forward -197 -187 0.275027 0.27
NP_441659.2_8 Reverse -119 -129 0.176696 0.271
NP_441659.2_8 Reverse -46 -56 0.176696 0.271
NP_440363.1_9 Forward -292 -274 13.5888 0.249
NP_442913.1_10 Forward -130 -111 -2.95047 0.195
NP_441040.1_2 Forward -57 -38 -14.9469 0.286
NP_441040.1_2 Reverse -66 -85 -15.4385 0.286
NP_442008.1_2 Reverse -185 -204 3.04771 0.266
NP_442776.1_6 Reverse -44 -63 8.16093 0.26
NP_440779.1_5 Forward -55 -38 -14.9075 0.287
NP_442346.1_5 Forward -149 -139 7.05986 0.183
NP_442346.1_5 Forward -56 -46 5.97822 0.219
NP_442346.1_5 Forward -84 -74 4.89658 0.269
NP_442346.1_5 Reverse -187 -197 4.3066 0.291
NP_440545.1_3 Forward -287 -270 1.61214 0.116
NP_440545.1_3 Reverse -277 -294 -4.38605 0.224
NP_440545.1_3 Forward -201 -184 -5.07437 0.24
NP_440831.1_3 Reverse -259 -278 5.61052 0.28
NP_440486.1_6 Reverse -187 -206 8.45592 0.242
NP_440459.1_2 Reverse -137 -154 17.2468 0.0834
NP_440459.1_2 Reverse -59 -76 8.98696 0.243
NP_440010.1_4 Reverse -118 -137 -1.67294 0.267
NP_440010.1_4 Reverse -70 -89 -2.36125 0.281
NP_440010.1_10 Forward -200 -181 1.57275 0.297
NP_442137.1_6 Reverse -93 -112 18.1907 0.0318
NP_442551.1_4 Reverse -72 -87 14.9262 0.0946
NP_442551.1_4 Reverse -272 -287 0.766545 0.245
NP_442551.1_4 Forward -286 -271 -0.80675 0.245
NP_440847.1_3 Forward -162 -148 12.192 0.254
NP_442603.1_7 Forward -197 -183 5.70218 0.277
NP_442603.1_9 Reverse -267 -285 6.31233 0.292
NP_442603.1_9 Forward -297 -279 0.0191479 0.3
NP_441888.1_7 Reverse -348 -362 8.35772 0.194
NP_441833.1_4 Reverse -189 -196 6.52896 0.0924
NP_441833.1_4 Reverse -140 -147 6.52896 0.0924
NP_441833.1_4 Forward -54 -47 6.52896 0.0924
NP_441833.1_4 Forward -196 -189 6.23397 0.163
NP_441833.1_4 Forward -147 -140 6.23397 0.163
NP_441833.1_4 Reverse -47 -54 6.23397 0.163
NP_442162.1_9 Forward -54 -47 12.9205 0.0282
NP_442162.1_9 Reverse -47 -54 12.9205 0.0282
NP_442162.1_9 Forward -196 -189 6.62729 0.142
NP_442162.1_9 Forward -147 -140 6.62729 0.142
NP_442162.1_9 Reverse -189 -196 6.52896 0.178
NP_442162.1_9 Reverse -140 -147 6.52896 0.178
NP_440671.1_4 Forward -203 -189 8.75105 0.191
NP_440671.1_4 Reverse -40 -54 7.17775 0.226
NP_440671.1_4 Forward -154 -140 5.89945 0.27
NP_442404.1_9 Reverse -344 -358 16.6169 0.209
NP_442199.1_5 Forward -394 -375 -6.88371 0.283
NP_442199.1_5 Reverse -192 -211 -7.4737 0.296
NP_442140.1_3 Reverse -287 -297 7.35486 0.142
NP_442140.1_3 Forward -196 -186 7.35486 0.142
NP_442140.1_3 Forward -54 -44 6.27322 0.176
NP_442140.1_3 Forward -147 -137 4.69992 0.238
NP_442140.1_3 Reverse -47 -57 4.0116 0.265
NP_442723.1_1 Reverse -115 -134 11.11 0.238
NP_442021.1_3 Forward -89 -70 -8.06369 0.291
NP_441671.1_1 Forward -358 -339 0.294447 0.27
NP_440875.1_2 Forward -288 -269 7.57094 0.21
NP_440875.1_9 Reverse -288 -298 12.7522 0.104
NP_440875.1_9 Forward -142 -132 12.3628 0.12
NP_440875.1_9 Forward -53 -43 8.37203 0.233
NP_441813.1_5 Reverse -137 -147 9.02648 0.0313
NP_441813.1_5 Reverse -44 -54 7.45319 0.0746
NP_441813.1_5 Forward -57 -47 4.89658 0.143
NP_441813.1_5 Reverse -186 -196 -0.708283 0.272
NP_440594.1_6 Reverse -113 -132 14.8466 0.169
NP_440590.1_4 Reverse -140 -153 1.29759 0.127
NP_440590.1_4 Reverse -287 -300 -5.48725 0.28
NP_440590.1_4 Reverse -189 -202 -5.78224 0.289
NP_440567.1_1 Reverse -189 -203 6.88276 0.08
NP_440567.1_1 Reverse -342 -356 5.89945 0.0945
NP_440567.1_1 Reverse -140 -154 2.16287 0.182
NP_440567.1_1 Forward -147 -133 0.491246 0.244
NP_440567.1_1 Reverse -47 -61 0.392915 0.246
NP_442497.1_10 Reverse -47 -56 8.25953 0.047
NP_442497.1_10 Forward -196 -187 1.08137 0.115
NP_442497.1_10 Reverse -189 -198 0.589713 0.153
NP_442497.1_10 Reverse -140 -149 0.589713 0.153
NP_442497.1_10 Forward -54 -45 0.589713 0.153
NP_442497.1_10 Reverse -342 -351 0.196389 0.208
NP_442497.1_10 Forward -147 -138 -1.18024 0.256
NP_440821.1_4 Reverse -44 -54 9.32148 0.03
NP_440821.1_4 Reverse -186 -196 7.35486 0.072
NP_440821.1_4 Forward -352 -342 0.0783647 0.205
NP_440821.1_4 Forward -199 -189 -0.314959 0.251
NP_440821.1_4 Forward -150 -140 -0.314959 0.251
NP_441239.1_9 Reverse -284 -296 14.1003 0.03
NP_441239.1_9 Reverse -272 -284 13.707 0.0355
NP_441239.1_9 Forward -57 -45 10.4621 0.0783
NP_441239.1_9 Reverse -186 -198 4.8572 0.239
NP_441239.1_9 Reverse -66 -78 3.57889 0.283
NP_441239.1_9 Reverse -137 -149 3.2839 0.289
NP_441239.1_9 Reverse -44 -56 2.98891 0.3
NP_441951.1_9 Forward -245 -226 0.196116 0.261
NP_441892.1_1 Forward -206 -189 -1.33779 0.203
NP_441892.1_1 Forward -157 -140 -1.53445 0.208
NP_441892.1_1 Reverse -277 -294 -3.8944 0.251
NP_440604.1_6 Forward -398 -379 -1.47551 0.202
NP_442044.1_9 Forward -197 -178 1.47442 0.289
NP_442193.1_1 Forward -77 -59 7.29564 0.295
NP_441769.1_1 Reverse -333 -352 8.45592 0.256
NP_440876.1_5 Forward -112 -93 9.93088 0.263
NP_442809.1_6 Forward -362 -343 9.0459 0.256
NP_440546.1_4 Reverse -46 -56 15.4756 0.0459
NP_440546.1_4 Forward -295 -285 13.4395 0.0494
NP_440546.1_4 Forward -55 -45 10.046 0.109
NP_440462.1_4 Forward -297 -283 12.4876 0.205
NP_440462.1_4 Reverse -261 -275 5.60446 0.29
NP_440462.1_6 Reverse -137 -147 6.96153 0.0932
NP_440462.1_6 Reverse -44 -54 5.87989 0.135
NP_440462.1_6 Forward -400 -390 3.12662 0.26
NP_442340.1_3 Forward -281 -262 -10.522 0.289
NP_440868.1_4 Reverse -42 -54 5.93884 0.0879
NP_440868.1_4 Reverse -184 -196 2.39892 0.156
NP_440868.1_4 Reverse -135 -147 1.02229 0.193
NP_440868.1_4 Forward -42 -30 -0.846001 0.282
NP_442499.1_1 Forward -196 -177 3.34271 0.257
NP_442499.1_3 Forward -90 -72 4.54237 0.289
NP_441672.1_6 Forward -170 -151 13.8633 0.175
NP_442402.1_4 Reverse -192 -211 -4.81951 0.231
NP_440653.1_10 Reverse -189 -208 5.11266 0.234
NP_440696.1_3 Forward -148 -130 2.67408 0.215
NP_440696.1_3 Forward -59 -41 -0.374176 0.243
NP_440696.1_3 Reverse -135 -153 -1.16082 0.251
NP_441843.2_9 Forward -53 -35 10.9783 0.225
NP_441843.2_9 Forward -119 -101 9.5194 0.284
NP_442039.1_4 Reverse -47 -54 11.6422 0.0747
NP_440825.1_7 Reverse -189 -199 13.0072 0.152
NP_440825.1_7 Reverse -140 -150 13.0072 0.152
NP_442837.1_3 Reverse -189 -196 12.1338 0.0702
NP_442837.1_3 Reverse -140 -147 12.1338 0.0702
NP_442837.1_3 Forward -196 -189 6.0373 0.25
NP_442837.1_3 Forward -147 -140 6.0373 0.25
NP_442837.1_3 Forward -54 -47 6.0373 0.25
NP_442837.1_3 Reverse -47 -54 6.0373 0.25
NP_440160.1_2 Reverse -274 -293 -5.40875 0.274
NP_440160.1_2 Forward -284 -265 -6.09707 0.279
NP_442053.1_1 Reverse -188 -197 14.1594 0.0136
NP_442053.1_1 Forward -197 -188 7.86621 0.0863
NP_442053.1_1 Forward -55 -46 7.17789 0.104
NP_442053.1_1 Reverse -139 -148 6.8829 0.111
NP_442053.1_1 Reverse -341 -350 4.32629 0.254
NP_440505.1_3 Reverse -44 -54 12.2714 0.0543
NP_441701.1_3 Forward -293 -276 11.0519 0.213
NP_441959.1_10 Forward -149 -131 17.5982 0.178
NP_441252.1_6 Reverse -225 -232 14.3954 0.168
NP_442532.1_7 Forward -197 -183 3.34284 0.201
NP_441408.2_7 Reverse -137 -156 0.294447 0.228
NP_440914.1_1 Reverse -353 -363 12.0308 0.0684
NP_440914.1_1 Forward -121 -111 11.0549 0.11
NP_440914.1_1 Reverse -139 -149 7.24882 0.242
NP_441011.1_8 Reverse -47 -56 12.0944 0.0517
NP_441011.1_8 Forward -147 -138 8.55452 0.144
NP_441011.1_8 Forward -54 -45 7.07956 0.179
NP_440037.1_2 Forward -82 -63 8.06259 0.248
NP_442533.1_1 Reverse -256 -275 -7.37537 0.188
NP_442533.1_1 Forward -137 -118 -13.6686 0.237
NP_442533.1_6 Forward -283 -274 13.1761 0.0232
NP_442533.1_6 Reverse -68 -77 10.9145 0.0503
NP_442533.1_6 Reverse -200 -209 5.99792 0.121
NP_442533.1_6 Forward -148 -139 5.40793 0.14
NP_442533.1_6 Reverse -46 -55 5.40793 0.14
NP_442533.1_6 Forward -55 -46 4.52295 0.179
NP_442533.1_6 Forward -209 -200 4.22796 0.186
NP_442533.1_6 Reverse -275 -284 3.83464 0.202
NP_442533.1_6 Reverse -286 -295 3.7363 0.204
NP_442533.1_6 Reverse -74 -83 3.04799 0.228
NP_441089.1_10 Forward -301 -282 2.16274 0.294
NP_442541.1_10 Reverse -275 -289 3.53891 0.254
NP_442541.1_10 Reverse -274 -288 2.16228 0.265
NP_442322.1_4 Reverse -278 -295 -1.04349 0.226
NP_442322.1_4 Reverse -122 -139 -9.30325 0.29
NP_443016.1_1 Forward -203 -184 -2.95047 0.225
NP_441482.1_7 Forward -154 -140 -8.75187 0.193
NP_441482.1_7 Forward -356 -342 -9.04686 0.193
NP_441482.1_7 Forward -203 -189 -10.6202 0.211
NP_441028.1_6 Reverse -117 -127 5.78111 0.243
NP_440116.1_5 Forward -200 -183 14.9851 0.0596
NP_440116.1_8 Reverse -140 -159 19.3707 0.00742
NP_440116.1_8 Reverse -47 -66 1.17943 0.0926
NP_440115.1_6 Forward -353 -343 17.188 0.0284
NP_440115.1_6 Forward -200 -190 9.32148 0.115
NP_440115.1_6 Forward -151 -141 9.32148 0.115
NP_441059.1_2 Forward -321 -302 -7.17871 0.291
NP_443045.1_9 Reverse -61 -79 8.86816 0.239
NP_441170.1_4 Forward -292 -274 4.54237 0.244
NP_441170.1_4 Forward -293 -275 4.14905 0.253
NP_441972.1_5 Reverse -342 -361 10.0292 0.062
NP_441972.1_5 Reverse -189 -208 0.58944 0.148
NP_441972.1_5 Reverse -140 -159 0.294447 0.154
NP_441972.1_5 Forward -300 -281 -5.60541 0.224
NP_441106.1_1 Reverse -45 -54 8.45619 0.0548
NP_441106.1_1 Reverse -138 -147 7.66954 0.0776
NP_441420.1_1 Forward -129 -110 -5.50708 0.292
NP_439903.1_6 Forward -191 -172 -0.0996487 0.276
NP_441286.1_1 Forward -198 -186 13.8053 0.00558
NP_440670.1_8 Reverse -46 -55 8.65285 0.0627
NP_440670.1_8 Forward -55 -46 6.29291 0.124
NP_440670.1_8 Reverse -179 -188 3.24465 0.29
NP_441930.1_2 Forward -237 -227 12.0747 0.266
NP_440886.1_7 Reverse -124 -134 6.0761 0.147
NP_440886.1_7 Reverse -352 -362 3.61784 0.272
NP_442614.1_2 Reverse -46 -60 15.7325 0.0773
NP_442382.1_6 Reverse -122 -135 17.0346 0.177
NP_442382.1_9 Reverse -70 -89 8.16011 0.286
NP_441399.1_6 Forward -289 -270 24.188 0.0117
NP_442072.1_9 Forward -56 -38 -22.007 0.216
NP_440907.2_8 Forward -196 -186 7.0594 0.132
NP_440907.2_8 Forward -54 -44 6.0761 0.179
NP_440907.2_8 Reverse -47 -57 3.8145 0.297
NP_442264.1_2 Reverse -184 -201 7.217 0.246
NP_442264.1_2 Forward -360 -343 4.6604 0.295
NP_441463.1_3 Reverse -190 -209 -7.4737 0.258
NP_441463.1_6 Forward -364 -350 9.79811 0.242
NP_441463.1_6 Reverse -110 -124 6.12603 0.283
NP_441626.1_2 Reverse -47 -54 12.2322 0.0511
NP_441626.1_2 Forward -196 -189 6.13563 0.177
NP_441626.1_2 Forward -147 -140 6.13563 0.177
NP_441626.1_2 Reverse -189 -196 5.93897 0.231
NP_441626.1_2 Reverse -140 -147 5.93897 0.231
NP_441626.1_2 Forward -54 -47 5.93897 0.231
NP_440107.1_5 Reverse -279 -298 -0.295539 0.178
NP_442794.1_1 Forward -201 -189 12.232 0.0721
NP_442794.1_1 Forward -152 -140 12.232 0.0721
NP_442615.1_1 Forward -64 -46 12.0155 0.0156
NP_442467.1_4 Forward -55 -36 5.99764 0.287
NP_441962.1_4 Reverse -174 -193 -13.0786 0.268
NP_440387.1_1 Forward -148 -132 -3.48138 0.16
NP_440387.1_1 Forward -197 -181 -5.34967 0.227
NP_440387.1_1 Reverse -188 -204 -5.34967 0.227
NP_440855.1_5 Forward -297 -278 1.6703 0.295
NP_441431.1_2 Reverse -43 -57 7.3738 0.244
NP_441488.1_7 Reverse -223 -242 1.57275 0.289
NP_441836.1_1 Reverse -342 -361 12.2785 0.259
NP_441836.1_2 Reverse -133 -152 -0.197208 0.212
NP_441836.1_2 Forward -89 -70 -4.42544 0.255
NP_441836.1_2 Forward -134 -115 -6.49039 0.298
NP_441993.1_1 Forward -295 -276 4.87041 0.211
NP_440814.1_4 Forward -206 -187 -12.0953 0.229
NP_440467.1_3 Reverse -342 -361 19.948 0.04
NP_440114.1_10 Forward -55 -41 11.8976 0.0996
NP_441206.1_4 Forward -126 -107 -5.99873 0.263
NP_441510.2_7 Reverse -40 -54 14.9452 0.28
NP_440293.1_3 Forward -156 -137 -1.47551 0.239
NP_440293.1_3 Forward -205 -186 -1.67217 0.239
NP_440293.1_3 Forward -297 -278 -2.45882 0.241
NP_440293.1_3 Forward -291 -272 -2.45882 0.241
NP_440293.1_9 Forward -289 -275 9.21831 0.286
NP_440766.1_4 Reverse -42 -56 9.63603 0.0871
NP_440766.1_4 Forward -152 -138 3.04785 0.159
NP_440766.1_4 Forward -354 -340 2.5562 0.179
NP_440766.1_4 Forward -201 -187 0.786239 0.268
NP_441237.1_9 Forward -196 -186 14.828 0.0242
NP_441237.1_9 Reverse -189 -199 12.0747 0.139
NP_441237.1_9 Reverse -140 -150 12.0747 0.139
NP_441237.1_9 Reverse -342 -352 11.6814 0.164
NP_441237.1_9 Forward -397 -387 11.0914 0.2
NP_439910.1_2 Reverse -38 -55 -21.889 0.195
NP_439910.1_2 Reverse -333 -350 -22.0856 0.207
NP_439910.1_2 Forward -63 -46 -22.479 0.25
NP_442867.1_8 Forward -54 -35 4.916 0.277
NP_440457.1_1 Forward -354 -342 6.43049 0.121
NP_440457.1_1 Forward -294 -282 2.30059 0.214
NP_440457.1_1 Reverse -42 -54 2.30059 0.214
NP_440457.1_1 Forward -201 -189 -0.74767 0.273
NP_440457.1_1 Forward -152 -140 -0.74767 0.273
NP_440798.1_6 Forward -54 -41 4.05085 0.147
NP_440798.1_6 Reverse -47 -60 1.69091 0.205
NP_440801.1_8 Reverse -220 -239 2.26107 0.229
NP_440142.1_7 Forward -289 -270 7.96426 0.246
NP_441984.1_3 Reverse -57 -75 12.9988 0.157
NP_441984.1_3 Forward -306 -288 6.70565 0.267
NP_440473.1_1 Reverse -283 -302 12.9927 0.211
NP_442509.1_9 Forward -197 -187 6.37109 0.274
NP_441253.1_8 Reverse -384 -398 11.3443 0.26
NP_440554.1_4 Forward -54 -44 11.6814 0.0377
NP_440554.1_4 Forward -147 -137 8.82982 0.0646
NP_441885.1_5 Reverse -46 -56 7.84651 0.0419
NP_441885.1_5 Reverse -139 -149 1.35667 0.11
NP_441885.1_5 Reverse -188 -198 1.25834 0.11
NP_441885.1_5 Forward -148 -138 0.766681 0.123
NP_441614.1_1 Forward -289 -270 12.8808 0.194
NP_442341.1_7 Reverse -138 -152 8.06273 0.0947
NP_442341.1_7 Reverse -187 -201 5.70279 0.148
NP_442341.1_7 Reverse -165 -179 1.08123 0.299
NP_442341.1_9 Reverse -44 -58 8.45543 0.17
NP_442341.1_9 Forward -292 -278 7.96378 0.182
NP_441756.1_5 Forward -293 -274 0.196116 0.24
NP_441756.1_5 Reverse -349 -368 -1.57384 0.258
NP_442395.2_4 Reverse -340 -359 0.883656 0.258
NP_443000.1_7 Reverse -137 -147 1.06167 0.274
NP_443000.1_7 Forward -199 -189 0.57002 0.294
NP_443000.1_7 Forward -150 -140 0.57002 0.294
NP_440507.2_3 Reverse -71 -90 6.98015 0.293
NP_441842.1_10 Reverse -39 -53 7.17775 0.264
NP_440275.1_3 Reverse -44 -54 5.87989 0.13
NP_440275.1_3 Reverse -186 -196 1.25834 0.291
NP_440091.1_1 Reverse -42 -54 8.59377 0.0631
NP_440679.1_10 Forward -90 -71 -18.3884 0.278
NP_443010.1_10 Reverse -43 -60 5.28327 0.207
NP_442451.1_2 Reverse -127 -146 -11.0136 0.284
NP_439962.1_4 Forward -246 -227 -2.55715 0.231
NP_440175.1_4 Forward -370 -351 -11.7019 0.208
NP_440175.1_7 Forward -299 -281 16.7801 0.0997
NP_442495.1_5 Forward -361 -342 10.3242 0.246
NP_442495.1_5 Reverse -270 -289 9.53756 0.287
NP_442495.1_5 Reverse -275 -294 5.89931 0.291
NP_440149.1_8 Forward -38 -19 -3.83545 0.198
NP_440149.1_8 Reverse -139 -158 -4.13045 0.202
NP_440149.1_10 Forward -83 -64 -12.6852 0.295
NP_441105.1_3 Forward -208 -189 -0.590531 0.138
NP_441105.1_3 Reverse -275 -294 -2.0655 0.156
NP_441105.1_3 Forward -361 -342 -3.83545 0.185
NP_442373.1_2 Forward -140 -121 -2.36049 0.198
NP_440216.1_1 Forward -148 -134 6.6861 0.0139
NP_440216.1_1 Forward -55 -41 4.12949 0.0275
NP_440216.1_1 Reverse -46 -60 -12.4884 0.274
NP_440172.1_1 Reverse -46 -56 8.82982 0.0586
NP_440172.1_1 Forward -197 -187 7.55152 0.0761
NP_440172.1_1 Reverse -353 -363 7.15819 0.0897
NP_442015.1_3 Reverse -51 -70 11.3067 0.288
NP_442015.1_10 Forward -59 -46 1.49425 0.204
NP_442015.1_10 Forward -201 -188 0.60927 0.221
NP_442015.1_10 Forward -152 -139 0.510939 0.224
NP_442015.1_10 Reverse -349 -362 -0.472371 0.268
NP_441226.1_7 Reverse -47 -54 12.7234 0.0312
NP_441226.1_7 Forward -54 -47 11.5435 0.0757
NP_440198.1_3 Reverse -130 -149 15.7316 0.253
NP_442834.1_5 Forward -246 -227 21.6323 0.0408
NP_442834.1_9 Reverse -192 -211 13.6675 0.11
NP_441111.1_7 Reverse -189 -197 8.86921 0.0589
NP_441111.1_7 Reverse -140 -148 8.86921 0.0589
NP_441111.1_7 Forward -54 -46 8.86921 0.0589
NP_441766.1_2 Reverse -188 -197 8.55452 0.054
NP_441766.1_2 Reverse -46 -55 8.1612 0.0645
NP_441766.1_2 Forward -148 -139 8.1612 0.0645
NP_441766.1_2 Forward -55 -46 5.89959 0.103
NP_442417.1_5 Forward -148 -134 5.70279 0.252
NP_442179.1_3 Forward -147 -128 10.6192 0.192
NP_440416.1_1 Forward -70 -51 -12.0953 0.272
NP_440416.1_9 Forward -155 -136 -1.08219 0.0632
NP_440416.1_9 Reverse -193 -212 -7.86702 0.108
NP_440416.1_9 Reverse -39 -58 -9.63698 0.133
NP_440416.1_9 Reverse -128 -147 -18.6834 0.262
NP_440416.1_9 Forward -369 -350 -21.1417 0.291
NP_443052.1_8 Reverse -36 -55 0.196116 0.0669
NP_440885.1_6 Reverse -28 -47 12.6081 0.183
NP_442154.1_1 Forward -136 -118 -12.6655 0.217
NP_442154.1_1 Forward -139 -121 -16.6971 0.244
NP_441430.1_6 Reverse -236 -255 11.5042 0.251
NP_442564.1_10 Reverse -96 -110 8.06273 0.296
NP_440261.1_5 Reverse -342 -355 -10.6005 0.201
NP_440261.1_5 Forward -196 -183 -10.6988 0.203
NP_440261.1_5 Reverse -140 -153 -10.7971 0.21
NP_440988.1_10 Reverse -72 -86 8.57771 0.205
NP_440988.1_10 Forward -85 -71 3.9307 0.276
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GCGGGGATTGAACAGGTGAAGCCTGGTAATTACCTGATGGACATTGCCGGGGCAATCGAGGATTACGTTAAGCCCACCGGTTACACCATTGTGGAAGAGTTCACCGGCCATGGGGTGGGCCAGGCCCTCCACGAAGACCCCCATGTGTTTAACGTCCGCTGCCGGGATTTGCCCAACGTTAAACTTAAACCGGGCATGACCTTGGCGATCGAGCCAATTGTCAATGCTGGTTCCCGTTTCACCCGTACCCTTGGCGATCGATGGACGGTGGTGACGGTGGACAATGCCCTTTCGGCCCAGTTTGAGCATACGGTGTTGGTAACGGCCACGGGCTATGAGTTGCTGACCGATCGCCGTTTGGTCTAGATTGCCAACTCTGTTATAATAATTGGCCGGACAT

CDS

No sequence available

Protein

No sequence available