Your browser is old and dusty. Try Google Chrome!

Details for 6803t29

ORF 6803t29
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -213 -227 0.491246 0.207
NP_441418.1_6 Forward -266 -247 -22.2233 0.172
NP_440815.1_7 Reverse -62 -76 19.0758 0.196
NP_442877.1_4 Reverse -209 -228 19.6648 0.136
NP_441818.1_1 Forward -348 -337 11.5629 0.176
NP_441818.1_1 Reverse -331 -342 9.49793 0.241
NP_440150.1_6 Forward -224 -205 1.37609 0.293
NP_442655.1_10 Forward -184 -165 -13.0786 0.266
NP_442173.1_1 Reverse -331 -339 5.0343 0.24
NP_442173.1_1 Reverse -341 -349 4.93597 0.241
NP_442173.1_4 Forward -181 -162 12.6841 0.168
NP_442752.1_4 Reverse -149 -156 10.5605 0.1
NP_440784.1_10 Reverse -356 -375 14.4541 0.0756
NP_440061.1_9 Reverse -328 -342 8.3571 0.177
NP_441145.1_1 Forward -232 -213 4.03102 0.269
NP_442062.1_8 Reverse -340 -350 3.42162 0.272
NP_442242.1_4 Reverse -331 -338 9.47889 0.251
NP_442207.1_4 Reverse -269 -288 6.39097 0.285
NP_441925.1_4 Reverse -213 -232 -16.9142 0.287
NP_442827.1_8 Forward -166 -147 -0.0996487 0.218
NP_440447.1_5 Forward -305 -295 11.4848 0.291
NP_442570.1_3 Forward -213 -194 -8.26035 0.283
NP_441130.1_10 Forward -223 -209 4.52282 0.281
NP_442848.1_1 Reverse -124 -138 -3.63866 0.268
NP_439978.1_9 Forward -290 -271 23.1063 0.0325
NP_442687.1_7 Reverse -126 -136 4.0116 0.271
NP_442530.1_2 Reverse -19 -29 11.1898 0.284
NP_441013.1_3 Forward -351 -332 5.40766 0.291
NP_440691.1_5 Forward -174 -155 16.0274 0.184
NP_442658.1_1 Forward -351 -341 5.48612 0.265
NP_442658.1_1 Forward -223 -213 5.09279 0.284
NP_440141.1_8 Reverse -266 -285 7.86593 0.232
NP_440607.1_9 Reverse -47 -66 16.9946 0.243
NP_441478.1_5 Forward -230 -211 15.3391 0.236
NP_442836.1_5 Forward -345 -326 6.29264 0.18
NP_440984.1_7 Reverse -214 -228 4.91614 0.281
NP_441097.1_2 Forward -241 -224 2.79211 0.298
NP_439990.1_5 Reverse -335 -348 6.1158 0.255
NP_440153.1_5 Reverse -213 -227 7.27608 0.17
NP_440153.1_5 Reverse -258 -272 1.67122 0.245
NP_440993.1_3 Reverse -247 -266 1.6703 0.226
NP_441674.1_6 Forward -298 -279 1.67108 0.299
NP_440147.1_4 Reverse -217 -230 -0.669033 0.294
NP_441916.1_10 Forward -102 -83 1.17943 0.27
NP_440016.1_9 Reverse -194 -213 8.94757 0.278
NP_439966.1_9 Reverse -390 -399 4.71961 0.253
NP_442941.1_3 Forward -348 -338 4.69992 0.14
NP_442941.1_3 Reverse -331 -341 4.3066 0.14
NP_440983.1_9 Reverse -262 -281 4.42435 0.285
NP_441334.1_7 Forward -31 -12 -21.24 0.293
NP_441644.1_6 Forward -284 -274 5.28945 0.199
NP_442215.1_2 Reverse -258 -274 -2.49807 0.198
NP_442029.1_8 Reverse -213 -232 12.2908 0.218
NP_440929.1_8 Forward -221 -212 2.16301 0.262
NP_441310.1_10 Reverse -122 -132 14.9155 0.233
NP_442926.1_1 Forward -180 -161 -1.08219 0.278
NP_442926.1_3 Reverse -231 -250 2.45773 0.295
NP_442554.1_8 Reverse -213 -223 3.02829 0.245
NP_440045.1_3 Forward -34 -17 11.6411 0.138
NP_443009.1_5 Forward -340 -329 8.61296 0.104
NP_443009.1_5 Reverse -339 -350 5.26972 0.21
NP_442408.2_1 Forward -369 -350 5.40766 0.143
NP_440397.1_10 Reverse -176 -195 13.9616 0.261
NP_441715.1_4 Reverse -331 -341 13.5497 0.0431
NP_441198.1_8 Forward -351 -341 15.4199 0.0427
NP_440379.1_5 Forward -225 -206 -10.522 0.28
NP_441015.1_10 Forward -233 -214 3.24438 0.139
NP_441015.1_10 Forward -183 -164 -9.83364 0.282
NP_441015.1_10 Forward -268 -249 -11.7019 0.3
NP_441673.1_1 Forward -228 -219 -7.76842 0.168
NP_441673.1_1 Reverse -219 -228 -8.06341 0.254
NP_441731.1_1 Reverse -23 -41 12.7979 0.281
NP_441876.1_9 Reverse -192 -202 13.3526 0.267
NP_441330.1_1 Forward -34 -15 -9.93197 0.183
NP_441764.1_8 Forward -115 -105 12.842 0.284
NP_442719.1_2 Forward -38 -20 -6.17641 0.224
NP_441251.1_8 Reverse -21 -34 10.9479 0.27
NP_442227.1_2 Reverse -217 -236 3.83436 0.211
NP_442227.1_2 Reverse -156 -175 0.687771 0.252
NP_442227.1_2 Reverse -214 -233 -2.85214 0.283
NP_443058.1_7 Reverse -103 -122 3.24438 0.268
NP_440145.1_3 Forward -349 -330 -4.32711 0.228
NP_442542.1_9 Reverse -367 -381 7.3738 0.198
NP_441937.1_8 Reverse -249 -268 13.0775 0.0968
NP_440558.1_2 Forward -219 -200 -3.83545 0.239
NP_440274.1_2 Reverse -224 -238 16.6169 0.236
NP_441878.1_6 Forward -270 -260 0.963343 0.128
NP_441036.1_8 Forward -229 -219 11.0914 0.138
NP_442777.1_3 Reverse -214 -232 7.09821 0.195
NP_441308.1_8 Reverse -147 -157 8.63316 0.254
NP_441037.1_4 Forward -223 -213 10.0465 0.21
NP_442317.1_6 Reverse -335 -354 9.0459 0.211
NP_441633.1_3 Forward -296 -283 -2.04567 0.171
NP_441633.1_3 Reverse -210 -223 -3.81562 0.177
NP_440136.1_2 Forward -348 -341 3.97235 0.288
NP_442998.1_10 Forward -27 -20 10.4622 0.0819
NP_440299.1_1 Reverse -215 -228 4.73861 0.201
NP_441799.1_1 Reverse -302 -316 4.03056 0.269
NP_442201.1_10 Reverse -208 -227 -10.7186 0.263
NP_442452.1_3 Reverse -108 -127 7.86593 0.212
NP_440677.1_6 Reverse -351 -370 12.4875 0.196
NP_442386.1_9 Forward -222 -213 7.76745 0.217
NP_439976.1_4 Reverse -327 -346 6.39016 0.278
NP_442251.1_6 Reverse -331 -338 10.3639 0.134
NP_440027.1_3 Forward -276 -258 3.65664 0.267
NP_439937.1_9 Reverse -218 -235 -8.51661 0.176
NP_440439.1_1 Forward -231 -218 1.49425 0.153
NP_441803.1_2 Reverse -255 -274 -0.0988766 0.267
NP_442384.1_10 Forward -221 -208 1.19926 0.267
NP_441980.1_4 Forward -89 -70 9.14423 0.168
NP_442790.1_4 Forward -206 -187 -11.5053 0.229
NP_442262.1_10 Forward -382 -375 7.90559 0.266
NP_442244.1_6 Forward -318 -299 0.687771 0.291
NP_441103.1_9 Forward -132 -122 12.5872 0.291
NP_442033.1_10 Reverse -328 -347 -9.53865 0.217
NP_441543.1_3 Reverse -155 -169 8.65209 0.256
NP_442845.1_2 Reverse -126 -140 3.34284 0.294
NP_441319.1_3 Forward -318 -299 12.5858 0.256
NP_443064.1_6 Forward -158 -148 10.5308 0.148
NP_442286.1_1 Reverse -330 -349 6.78429 0.285
NP_441462.1_2 Reverse -219 -229 -0.609952 0.24
NP_442204.1_1 Forward -21 -10 6.74518 0.152
NP_442204.1_1 Reverse -16 -27 0.353664 0.281
NP_440618.1_1 Reverse -284 -303 -3.54046 0.196
NP_442219.1_8 Reverse -280 -299 8.74691 0.241
NP_440436.1_4 Reverse -341 -350 8.45576 0.105
NP_440436.1_4 Reverse -222 -231 4.12922 0.288
NP_441884.1_9 Forward -215 -196 -20.8467 0.211
NP_442864.1_7 Reverse -268 -286 7.98396 0.274
NP_441004.1_1 Forward -215 -196 -15.9302 0.279
NP_441004.1_1 Reverse -236 -255 -16.0285 0.281
NP_441004.1_1 Reverse -269 -288 -16.7168 0.287
NP_442873.1_9 Forward -301 -282 3.44025 0.289
NP_441851.1_4 Reverse -219 -238 9.3409 0.271
NP_441851.1_10 Reverse -329 -339 4.60159 0.259
NP_441851.1_10 Reverse -339 -349 4.20827 0.282
NP_441349.1_10 Forward -238 -219 -8.85033 0.279
NP_440432.1_9 Reverse -341 -356 -6.41162 0.299
NP_441003.1_9 Forward -32 -13 5.60432 0.261
NP_441570.1_1 Forward -315 -297 -1.65248 0.0583
NP_442729.1_8 Reverse -215 -228 6.01747 0.217
NP_440526.1_3 Reverse -222 -233 9.20294 0.0958
NP_440526.1_3 Reverse -341 -352 1.13984 0.267
NP_443024.1_3 Forward -351 -341 10.2065 0.289
NP_442320.1_8 Forward -355 -341 -2.95034 0.1
NP_440503.1_10 Forward -21 -2 15.1424 0.236
NP_440497.1_6 Forward -236 -217 -5.50708 0.264
NP_442003.1_4 Forward -348 -329 15.9291 0.19
NP_442797.1_2 Forward -227 -209 13.045 0.239
NP_442797.1_7 Reverse -211 -229 -1.25915 0.294
NP_442751.1_1 Reverse -195 -214 16.4369 0.222
NP_440559.1_1 Forward -348 -339 4.52295 0.26
NP_442346.1_5 Forward -340 -330 6.07655 0.216
NP_440545.1_3 Forward -225 -208 -6.94266 0.293
NP_440459.1_2 Forward -278 -261 12.3302 0.151
NP_440170.1_6 Reverse -255 -274 18.289 0.0959
NP_440875.1_9 Reverse -293 -303 8.08002 0.243
NP_440875.1_9 Forward -337 -327 7.00932 0.287
NP_440594.1_8 Reverse -21 -34 7.59019 0.272
NP_440073.1_2 Forward -317 -298 4.62101 0.245
NP_440590.1_4 Reverse -331 -344 -6.07724 0.299
NP_441239.1_9 Forward -223 -211 3.2839 0.289
NP_441239.1_9 Forward -351 -339 3.08724 0.296
NP_442270.1_6 Forward -104 -86 14.5721 0.293
NP_440546.1_4 Reverse -50 -60 7.04032 0.264
NP_442041.1_5 Forward -227 -208 0.687771 0.257
NP_440462.1_6 Reverse -298 -308 1.84832 0.294
NP_442340.1_3 Forward -283 -264 -6.29373 0.223
NP_441474.1_1 Reverse -155 -174 2.45694 0.247
NP_442039.1_4 Reverse -341 -348 10.8555 0.109
NP_442532.1_1 Forward -103 -89 9.91926 0.262
NP_442533.1_6 Forward -228 -219 2.16301 0.27
NP_442533.1_6 Reverse -254 -263 1.57302 0.294
NP_442322.1_4 Reverse -199 -216 -9.49991 0.295
NP_441028.1_6 Reverse -91 -101 7.84605 0.218
NP_441028.1_6 Reverse -191 -201 4.10949 0.278
NP_440115.1_6 Reverse -146 -156 4.60159 0.293
NP_441420.1_1 Reverse -148 -167 2.85105 0.166
NP_439903.1_6 Forward -32 -13 6.39016 0.167
NP_440886.1_7 Reverse -174 -184 9.12434 0.0805
NP_440886.1_7 Reverse -218 -228 5.38779 0.185
NP_440886.1_7 Reverse -221 -231 3.8145 0.265
NP_442382.1_9 Reverse -75 -94 9.34008 0.281
NP_440907.2_8 Reverse -341 -351 5.78111 0.188
NP_441021.1_1 Reverse -3 -22 -12.3902 0.286
NP_441463.1_7 Forward -21 -2 12.5858 0.285
NP_442365.1_5 Reverse -213 -232 8.45592 0.215
NP_442365.1_7 Forward -343 -324 -3.73712 0.222
NP_441174.1_2 Forward -231 -217 14.0609 0.176
NP_440293.1_3 Reverse -283 -302 -5.11376 0.272
NP_439988.1_3 Reverse -243 -257 8.65272 0.249
NP_439988.1_3 Reverse -208 -222 5.01447 0.292
NP_440457.1_1 Reverse -278 -290 6.33216 0.123
NP_440473.1_9 Forward -232 -213 -12.3902 0.297
NP_440554.1_4 Forward -382 -372 1.74999 0.29
NP_440628.1_1 Forward -103 -93 13.4873 0.279
NP_441173.1_9 Reverse -192 -200 10.8354 0.243
NP_442395.2_4 Forward -333 -314 -0.689632 0.299
NP_440423.1_6 Forward -83 -64 -21.4367 0.294
NP_443000.1_7 Forward -341 -331 6.66654 0.119
NP_440091.1_1 Reverse -326 -338 -0.551008 0.278
NP_442354.1_8 Forward -164 -145 8.84924 0.266
NP_443010.1_10 Forward -352 -335 4.41357 0.23
NP_439962.1_4 Forward -284 -265 -5.11376 0.276
NP_442495.1_4 Forward -25 -15 13.0581 0.198
NP_442495.1_5 Forward -227 -208 12.2908 0.23
NP_442418.1_4 Forward -42 -24 11.079 0.259
NP_442379.1_10 Reverse -253 -270 -2.12444 0.224
NP_442417.1_5 Forward -228 -214 5.1128 0.275
NP_440416.1_9 Reverse -323 -342 -15.3402 0.189
NP_440416.1_9 Reverse -205 -224 -18.5851 0.26
NP_443052.1_8 Forward -359 -340 -5.40875 0.13
NP_443052.1_9 Reverse -190 -209 -5.70374 0.273
NP_443052.1_9 Reverse -202 -221 -6.39206 0.282
NP_443052.1_9 Forward -286 -267 -7.27704 0.295
NP_442154.1_1 Reverse -268 -286 -7.749 0.148
NP_442154.1_1 Forward -211 -193 -17.6804 0.262
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCAAACCCGGCCTCAGTTCAGATTGCAGGCTGCAACTCGCCTGCATGAAGGAGGAATCGCTAGTAATCGCAGGTCAGAATACTGCGGTGAATTCGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGCTGGTCACGCCCGAAGTCGTTACTCTAACCTTAGGGAGGAGGGCGCCGAAGGCAGGGCTAGTGACTGGGGTGAAGTCGTAACAAGGTAGCCGTACCGGAAGGTGTGGCTGGATCACCTCCTTTAAGGGAGACCTTTACCCCTTCATCTTGAAAGCAAAGTGCAAATAGAGAGAAGTTGGTCAACCAAAAGGTCGAGCAAGGGATTAACCGAGAGGTTAAAGAGTAGAAGTCTTTCAAACTATTGCCTAGGCGAGGTAAAAGGCAA

CDS

No sequence available

Protein

No sequence available