Your browser is old and dusty. Try Google Chrome!

Details for 6803t17

ORF 6803t17
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -188 -202 11.5043 0.051
NP_441061.1_2 Forward -297 -283 10.0294 0.0651
NP_441061.1_2 Forward -270 -256 0.0979218 0.218
NP_441418.1_6 Reverse -289 -308 -28.9099 0.213
NP_441418.1_6 Reverse -187 -206 -29.3032 0.221
NP_440815.1_2 Forward -72 -58 11.7003 0.262
NP_443032.1_8 Reverse -226 -245 0.294447 0.238
NP_442291.1_5 Forward -197 -181 -4.46469 0.276
NP_440897.1_6 Reverse -371 -390 5.89851 0.11
NP_441453.1_1 Reverse -355 -373 4.34495 0.26
NP_441453.1_4 Forward -196 -188 14.8674 0.00947
NP_441453.1_4 Forward -298 -290 7.19758 0.0757
NP_441453.1_4 Reverse -289 -297 7.00092 0.107
NP_441453.1_4 Reverse -187 -195 6.80426 0.121
NP_441453.1_7 Forward -322 -315 12.1338 0.295
NP_441623.1_1 Forward -70 -52 -1.45582 0.24
NP_441623.1_1 Reverse -96 -114 -2.93078 0.25
NP_442151.1_10 Reverse -288 -306 11.5239 0.292
NP_441818.1_1 Forward -297 -286 10.4812 0.232
NP_442169.1_1 Reverse -328 -347 -1.27885 0.265
NP_441630.1_3 Reverse -179 -198 10.4225 0.0907
NP_440813.1_1 Forward -304 -290 16.2235 0.267
NP_440150.1_6 Forward -84 -65 4.81767 0.232
NP_440150.1_6 Reverse -315 -334 4.12936 0.245
NP_442173.1_1 Reverse -188 -196 13.8841 0.0225
NP_442173.1_1 Forward -297 -289 12.9008 0.0296
NP_442173.1_1 Forward -195 -187 12.0158 0.0316
NP_442173.1_1 Reverse -290 -298 7.59091 0.163
NP_442752.1_4 Reverse -187 -194 13.8055 0.0199
NP_440784.1_7 Reverse -290 -297 6.3323 0.228
NP_440784.1_7 Reverse -188 -195 6.23397 0.241
NP_440784.1_7 Forward -297 -290 6.13563 0.241
NP_440784.1_7 Forward -195 -188 6.13563 0.241
NP_440061.1_9 Forward -198 -184 15.7319 0.0384
NP_440061.1_9 Forward -385 -371 6.39049 0.248
NP_440061.1_9 Forward -300 -286 5.99717 0.264
NP_441476.1_5 Forward -379 -360 -1.7705 0.205
NP_442062.1_8 Forward -298 -288 13.5497 0.0211
NP_442062.1_8 Reverse -187 -197 7.64985 0.0911
NP_442062.1_8 Forward -196 -186 5.38824 0.172
NP_440761.1_4 Reverse -284 -303 -14.5535 0.265
NP_441859.1_3 Forward -384 -365 13.9616 0.0767
NP_441859.1_3 Forward -299 -280 11.8967 0.103
NP_440304.1_4 Reverse -287 -297 15.713 0.0318
NP_442242.1_4 Forward -297 -290 11.8388 0.0776
NP_440044.1_8 Reverse -63 -82 -3.54046 0.286
NP_441781.1_7 Reverse -347 -366 -1.7705 0.279
NP_441581.1_1 Forward -326 -309 16.7551 0.157
NP_441594.1_6 Forward -380 -361 13.5691 0.109
NP_441594.1_6 Reverse -365 -384 5.01433 0.211
NP_441594.1_6 Forward -262 -243 1.47442 0.268
NP_442110.1_7 Forward -298 -284 9.2427 0.0755
NP_442110.1_7 Reverse -187 -201 7.47274 0.116
NP_442110.1_7 Forward -393 -379 4.81781 0.192
NP_441083.1_5 Forward -196 -186 8.82982 0.03
NP_441083.1_5 Reverse -187 -197 7.94484 0.048
NP_441083.1_5 Forward -298 -288 0.275027 0.237
NP_439957.1_9 Forward -257 -238 4.72643 0.3
NP_442827.1_8 Reverse -263 -282 2.75194 0.155
NP_441434.1_7 Forward -194 -180 3.93283 0.225
NP_441738.1_2 Forward -194 -187 15.28 0.0102
NP_441738.1_2 Reverse -291 -298 10.0685 0.125
NP_440209.1_1 Reverse -187 -195 8.57422 0.0425
NP_440209.1_1 Reverse -289 -297 8.37755 0.0576
NP_440056.1_9 Reverse -240 -259 13.4822 0.295
NP_441713.1_2 Reverse -305 -324 16.4207 0.291
NP_442570.1_3 Reverse -253 -272 -2.16383 0.212
NP_442570.1_3 Reverse -297 -316 -7.08038 0.265
NP_442570.1_8 Reverse -100 -118 19.292 0.0908
NP_442111.1_4 Forward -197 -183 10.816 0.0518
NP_440343.1_8 Reverse -360 -379 20.2556 0.101
NP_440906.1_5 Reverse -188 -195 6.23397 0.234
NP_440906.1_5 Forward -297 -290 6.13563 0.241
NP_440906.1_5 Reverse -290 -297 6.13563 0.241
NP_440906.1_5 Forward -195 -188 6.13563 0.241
NP_440747.1_10 Forward -301 -289 -2.4193 0.0434
NP_440747.1_10 Reverse -184 -196 -2.4193 0.0434
NP_440747.1_10 Forward -199 -187 -12.0557 0.199
NP_441854.1_10 Reverse -360 -379 0.392778 0.282
NP_441486.1_1 Forward -199 -185 3.44117 0.0597
NP_442330.1_4 Reverse -269 -288 14.5557 0.286
NP_442634.1_4 Reverse -287 -301 5.40779 0.0584
NP_442634.1_4 Reverse -185 -199 -3.24533 0.161
NP_440403.1_10 Reverse -365 -384 15.8307 0.113
NP_441014.1_8 Forward -330 -311 -2.45882 0.232
NP_441014.1_8 Forward -159 -140 -6.29373 0.276
NP_441014.1_8 Forward -337 -318 -7.08038 0.276
NP_441014.1_10 Reverse -92 -111 -2.45958 0.276
NP_442848.1_1 Forward -202 -188 3.8345 0.12
NP_442848.1_1 Reverse -283 -297 -4.52363 0.294
NP_442848.1_5 Forward -378 -360 -3.12744 0.29
NP_443018.1_3 Forward -297 -290 12.0355 0.0639
NP_443018.1_3 Forward -195 -188 11.7405 0.0655
NP_443018.1_3 Reverse -290 -297 5.64398 0.181
NP_443018.1_3 Reverse -188 -195 5.44732 0.193
NP_441634.1_9 Forward -367 -348 8.06178 0.294
NP_440376.1_1 Forward -298 -289 6.29291 0.104
NP_440376.1_1 Reverse -187 -196 5.89959 0.116
NP_440376.1_1 Reverse -289 -298 -0.0986038 0.285
NP_440376.1_1 Forward -196 -187 -0.0986038 0.285
NP_441857.1_3 Reverse -250 -269 19.3698 0.141
NP_442687.1_7 Reverse -288 -298 17.6796 0.00648
NP_442687.1_7 Reverse -186 -196 15.3197 0.0173
NP_442191.1_4 Reverse -138 -152 10.7992 0.288
NP_442485.1_3 Reverse -266 -285 -5.40875 0.291
NP_442485.1_3 Reverse -360 -379 -5.70374 0.295
NP_441846.1_10 Forward -91 -72 -13.6686 0.207
NP_441846.1_10 Reverse -373 -392 -14.2585 0.218
NP_441846.1_10 Forward -98 -79 -21.83 0.256
NP_441846.1_10 Forward -93 -74 -23.6 0.294
NP_440642.1_10 Reverse -59 -73 5.30886 0.241
NP_440642.1_10 Reverse -229 -243 1.67063 0.29
NP_440642.1_10 Reverse -60 -74 1.47397 0.293
NP_441013.1_2 Reverse -176 -194 3.26407 0.23
NP_441013.1_3 Reverse -347 -366 11.0125 0.204
NP_441422.1_7 Forward -300 -283 -1.53445 0.194
NP_441422.1_7 Forward -395 -378 -6.54933 0.252
NP_440360.1_10 Forward -296 -282 12.291 0.137
NP_442658.1_1 Reverse -287 -297 16.1058 0.00966
NP_442658.1_1 Reverse -185 -195 6.27276 0.234
NP_442658.1_1 Forward -339 -329 5.58445 0.262
NP_442782.1_2 Reverse -289 -303 10.521 0.173
NP_442782.1_2 Forward -270 -256 7.86607 0.202
NP_442782.1_2 Reverse -36 -50 4.22782 0.256
NP_442782.1_2 Forward -327 -313 1.27789 0.281
NP_442782.1_2 Forward -234 -220 0.982901 0.282
NP_440669.1_8 Reverse -94 -113 17.8948 0.235
NP_441414.1_9 Reverse -374 -393 -9.34199 0.259
NP_442937.1_5 Reverse -360 -379 10.7175 0.154
NP_442937.1_5 Reverse -278 -297 8.75091 0.212
NP_442321.1_4 Reverse -44 -63 -6.49039 0.284
NP_442321.1_4 Forward -155 -136 -9.44032 0.298
NP_441958.1_5 Reverse -186 -196 16.9913 0.00183
NP_441958.1_5 Reverse -288 -298 9.51814 0.0198
NP_441958.1_5 Forward -299 -289 1.65166 0.0872
NP_441127.1_1 Forward -377 -363 12.1926 0.215
NP_440984.1_7 Reverse -182 -196 4.62115 0.296
NP_439990.1_5 Forward -303 -290 7.98409 0.183
NP_441338.2_9 Forward -64 -45 6.88262 0.252
NP_442376.1_2 Reverse -284 -303 -11.9969 0.286
NP_442911.1_2 Forward -206 -187 0.0977854 0.0702
NP_442911.1_2 Reverse -279 -298 -7.86702 0.221
NP_441580.1_6 Forward -291 -272 -9.047 0.282
NP_440153.1_8 Reverse -368 -381 -3.71729 0.299
NP_440325.1_4 Reverse -95 -114 15.2408 0.242
NP_442536.1_4 Forward -83 -65 6.80398 0.299
NP_443055.1_6 Forward -196 -178 4.54162 0.181
NP_443055.1_6 Forward -160 -142 -1.06322 0.271
NP_440993.1_2 Forward -303 -287 5.86006 0.234
NP_442002.1_9 Reverse -186 -193 14.1004 0.074
NP_442002.1_9 Reverse -288 -295 12.4288 0.185
NP_440809.1_9 Forward -205 -187 -7.749 0.225
NP_441646.1_1 Reverse -208 -227 2.0644 0.221
NP_441646.1_7 Forward -297 -283 12.9793 0.299
NP_442438.1_10 Forward -201 -187 4.71948 0.142
NP_441292.1_2 Reverse -250 -269 -3.73712 0.224
NP_441674.1_6 Forward -312 -293 9.3409 0.177
NP_440147.1_4 Forward -300 -287 8.08242 0.0561
NP_440147.1_4 Reverse -185 -198 6.70579 0.0856
NP_440147.1_4 Reverse -287 -300 6.4108 0.0939
NP_441550.1_8 Reverse -185 -195 16.8925 0.00906
NP_441550.1_8 Reverse -287 -297 10.3043 0.0709
NP_441550.1_8 Forward -198 -188 6.56775 0.201
NP_441550.1_8 Reverse -372 -382 5.87944 0.224
NP_441916.1_7 Forward -298 -288 8.1415 0.0493
NP_441916.1_7 Forward -196 -186 7.94484 0.0532
NP_441916.1_7 Reverse -289 -299 7.15819 0.0745
NP_441041.1_4 Reverse -283 -302 -8.06369 0.196
NP_441041.1_7 Reverse -286 -298 14.7059 0.0342
NP_441041.1_7 Forward -301 -289 10.5273 0.095
NP_441041.1_7 Reverse -184 -196 10.0414 0.103
NP_440569.1_6 Reverse -253 -272 4.12936 0.24
NP_442004.1_6 Forward -298 -284 1.86788 0.276
NP_440703.1_9 Forward -222 -209 11.5234 0.192
NP_440703.1_9 Reverse -215 -228 9.65513 0.216
NP_441725.1_4 Forward -303 -289 12.2903 0.0693
NP_441725.1_5 Forward -297 -287 17.188 0.0247
NP_441725.1_5 Forward -195 -185 1.94665 0.115
NP_439966.1_7 Forward -198 -188 6.56775 0.177
NP_439966.1_7 Reverse -287 -297 4.30615 0.279
NP_440736.1_3 Forward -148 -129 1.37609 0.282
NP_442941.1_3 Reverse -188 -198 7.64985 0.0628
NP_442941.1_3 Reverse -290 -300 6.96153 0.0903
NP_442941.1_3 Forward -195 -185 0.865012 0.163
NP_440289.1_2 Forward -199 -186 -2.63565 0.261
NP_440289.1_2 Reverse -286 -299 -4.89726 0.294
NP_440983.1_5 Forward -374 -355 -6.09707 0.276
NP_440983.1_9 Reverse -310 -329 5.99764 0.281
NP_440983.1_9 Forward -196 -177 2.26107 0.292
NP_440260.1_8 Forward -274 -256 0.707465 0.196
NP_442281.1_1 Forward -201 -187 14.4536 0.0183
NP_442281.1_1 Reverse -284 -298 10.2254 0.0608
NP_442281.1_1 Forward -303 -289 8.16044 0.0845
NP_442281.1_1 Reverse -182 -196 6.88214 0.113
NP_442012.1_5 Reverse -282 -301 8.16093 0.252
NP_442288.1_3 Reverse -55 -72 7.02034 0.257
NP_441644.1_6 Forward -196 -186 13.0576 0.0244
NP_441644.1_6 Forward -298 -288 9.41933 0.0767
NP_441644.1_6 Forward -374 -364 6.86274 0.144
NP_441644.1_6 Forward -270 -260 3.42118 0.282
NP_442029.1_10 Reverse -254 -273 5.30933 0.287
NP_440253.1_2 Reverse -187 -205 0.510803 0.184
NP_440929.1_8 Forward -196 -187 7.17789 0.0713
NP_440469.1_8 Forward -104 -85 8.16093 0.295
NP_440566.1_6 Reverse -185 -204 12.9791 0.18
NP_442933.1_10 Forward -196 -187 8.06287 0.0885
NP_442933.1_10 Reverse -187 -196 7.96454 0.0937
NP_442933.1_10 Reverse -289 -298 7.86621 0.103
NP_442933.1_10 Forward -298 -289 7.86621 0.103
NP_441751.2_8 Forward -297 -283 2.06454 0.0884
NP_441751.2_8 Forward -195 -181 -2.85201 0.134
NP_442926.1_3 Forward -382 -363 4.81767 0.248
NP_442926.1_5 Reverse -182 -201 13.6679 0.15
NP_442554.1_8 Forward -297 -287 7.74818 0.0846
NP_442554.1_8 Forward -195 -185 5.28991 0.153
NP_442554.1_8 Reverse -188 -198 3.91327 0.203
NP_441762.1_7 Forward -299 -287 -5.36923 0.203
NP_442142.1_4 Reverse -258 -271 2.37867 0.294
NP_442292.1_1 Reverse -188 -197 -0.196935 0.239
NP_442292.1_1 Forward -297 -288 -0.295266 0.24
NP_442292.1_1 Forward -195 -186 -0.295266 0.24
NP_442292.1_5 Reverse -51 -70 5.60432 0.219
NP_440919.1_7 Reverse -132 -150 5.45093 0.286
NP_441899.1_1 Reverse -377 -395 14.0805 0.162
NP_443009.1_5 Reverse -288 -299 14.7094 0.02
NP_443009.1_5 Forward -299 -288 9.00628 0.0965
NP_441715.1_4 Reverse -290 -300 5.78156 0.18
NP_441448.1_5 Reverse -49 -68 15.4374 0.287
NP_441198.1_8 Reverse -287 -297 15.6152 0.0427
NP_440379.1_5 Forward -274 -255 23.8939 0.0102
NP_441468.1_1 Forward -297 -290 6.3323 0.202
NP_441468.1_1 Reverse -290 -297 6.13563 0.209
NP_441468.1_1 Reverse -188 -195 6.13563 0.209
NP_441468.1_1 Forward -195 -188 6.0373 0.223
NP_441015.1_10 Reverse -363 -382 3.24438 0.139
NP_441673.1_1 Forward -298 -289 1.27803 0.155
NP_441673.1_1 Reverse -289 -298 1.27803 0.155
NP_441673.1_1 Forward -196 -187 1.27803 0.155
NP_441673.1_1 Reverse -187 -196 1.27803 0.155
NP_442253.1_5 Forward -227 -210 1.61214 0.159
NP_441826.1_2 Reverse -283 -297 6.09611 0.0946
NP_441826.1_2 Reverse -181 -195 -3.63866 0.286
NP_441330.1_1 Reverse -182 -201 -12.1936 0.183
NP_441330.1_1 Forward -303 -284 -14.9469 0.253
NP_442811.1_2 Reverse -275 -294 -3.3438 0.287
NP_442490.1_9 Reverse -359 -378 -7.17871 0.275
NP_442490.1_9 Reverse -362 -381 -8.94866 0.298
NP_442490.1_10 Forward -113 -95 9.55725 0.234
NP_442868.1_6 Reverse -287 -297 13.5497 0.038
NP_442868.1_6 Reverse -185 -195 8.82982 0.0555
NP_441056.1_1 Reverse -362 -381 -7.08038 0.271
NP_442227.1_2 Forward -395 -376 6.29264 0.201
NP_442227.1_2 Forward -398 -379 0.786102 0.252
NP_442361.1_3 Forward -202 -189 7.59077 0.3
NP_441101.1_10 Reverse -96 -115 -7.4737 0.29
NP_441101.1_10 Forward -321 -302 -7.76869 0.292
NP_441882.1_6 Reverse -92 -111 3.83436 0.142
NP_440145.1_3 Forward -308 -289 -1.67217 0.154
NP_442542.1_2 Reverse -185 -198 16.1456 0.0708
NP_442542.1_2 Reverse -287 -300 7.59077 0.176
NP_442542.1_9 Reverse -180 -194 5.01387 0.279
NP_442050.1_5 Forward -198 -188 13.4509 0.0343
NP_442050.1_5 Reverse -287 -297 12.4676 0.0617
NP_440558.1_2 Forward -301 -282 5.211 0.147
NP_440558.1_2 Reverse -68 -87 0.786102 0.185
NP_440558.1_2 Reverse -365 -384 -4.32711 0.244
NP_440558.1_2 Forward -274 -255 -5.31042 0.256
NP_442789.1_4 Reverse -269 -288 -3.14714 0.246
NP_441878.1_6 Reverse -288 -298 1.25834 0.108
NP_441878.1_6 Reverse -186 -196 0.668351 0.139
NP_441878.1_6 Forward -299 -289 -7.49312 0.231
NP_441878.1_6 Forward -224 -214 -7.88644 0.278
NP_441036.1_8 Forward -299 -289 5.5849 0.271
NP_442650.1_2 Reverse -187 -201 4.81781 0.163
NP_441557.1_5 Reverse -289 -298 8.94785 0.0289
NP_441557.1_5 Reverse -187 -196 8.94785 0.0289
NP_441557.1_5 Forward -298 -289 0.688044 0.128
NP_441557.1_5 Forward -196 -187 0.688044 0.128
NP_441590.1_1 Forward -378 -359 12.4875 0.256
NP_441433.1_8 Reverse -257 -276 -3.63879 0.283
NP_441433.1_8 Reverse -315 -334 -4.52377 0.294
NP_440101.1_3 Reverse -182 -201 7.47261 0.175
NP_442830.1_7 Reverse -254 -273 10.1275 0.16
NP_442183.1_1 Forward -298 -284 12.8809 0.05
NP_442183.1_1 Reverse -187 -201 4.42448 0.261
NP_441549.1_9 Reverse -252 -270 -10.9939 0.295
NP_442347.1_2 Forward -155 -146 4.32629 0.284
NP_440547.1_1 Forward -388 -369 10.2251 0.237
NP_441037.1_4 Reverse -347 -357 10.3389 0.205
NP_441037.1_4 Reverse -287 -297 9.26684 0.225
NP_442594.1_8 Forward -97 -78 7.47261 0.213
NP_442594.1_8 Forward -89 -70 7.17762 0.214
NP_442317.1_6 Forward -303 -284 12.7825 0.158
NP_441633.1_3 Forward -373 -360 -0.964025 0.151
NP_441633.1_3 Forward -300 -287 -1.75067 0.163
NP_441633.1_3 Forward -385 -372 -2.34066 0.177
NP_440136.1_1 Forward -263 -247 10.2842 0.238
NP_440136.1_2 Forward -297 -290 13.4121 0.0388
NP_440136.1_2 Reverse -290 -297 6.23397 0.171
NP_440136.1_2 Reverse -188 -195 6.23397 0.171
NP_440136.1_2 Forward -195 -188 6.13563 0.193
NP_442590.1_9 Forward -384 -365 4.03102 0.277
NP_442590.1_10 Forward -334 -315 7.66927 0.221
NP_442590.1_10 Forward -277 -258 6.78429 0.237
NP_442590.1_10 Forward -196 -177 6.39097 0.245
NP_442998.1_10 Forward -194 -187 15.5754 0.0102
NP_442998.1_10 Forward -296 -289 12.5271 0.0457
NP_440899.1_1 Forward -98 -79 8.50503 0.23
NP_440299.1_6 Forward -234 -215 6.78429 0.268
NP_440810.1_8 Reverse -166 -185 18.6815 0.149
NP_441799.1_1 Reverse -285 -299 3.63724 0.289
NP_441799.1_1 Reverse -183 -197 3.63724 0.289
NP_440640.1_9 Forward -112 -93 10.9142 0.298
NP_441007.1_10 Reverse -284 -297 2.96921 0.183
NP_442334.1_2 Reverse -279 -296 -5.36936 0.2
NP_442334.1_2 Reverse -364 -381 -5.66436 0.211
NP_442334.1_10 Reverse -359 -378 -6.88371 0.22
NP_441449.1_8 Forward -53 -34 13.4045 0.29
NP_441449.1_10 Forward -202 -184 19.9803 0.108
NP_440256.1_1 Reverse -184 -203 4.22769 0.0459
NP_440256.1_1 Forward -301 -282 -4.42544 0.155
NP_440256.1_1 Reverse -286 -305 -9.14533 0.275
NP_440087.1_1 Forward -233 -214 -8.26035 0.278
NP_441559.1_8 Forward -303 -289 0.392915 0.167
NP_441559.1_8 Reverse -220 -234 -6.49025 0.279
NP_441559.1_8 Forward -302 -288 -6.88358 0.281
NP_441559.1_8 Reverse -83 -97 -6.98191 0.281
NP_440915.1_6 Forward -302 -288 7.37441 0.0709
NP_440915.1_6 Reverse -285 -299 5.80112 0.0879
NP_440915.1_6 Forward -200 -186 0.589577 0.159
NP_442785.1_7 Reverse -259 -273 12.9793 0.228
NP_442866.1_1 Forward -276 -257 8.16093 0.108
NP_442866.1_1 Reverse -288 -307 -5.80207 0.245
NP_441939.1_3 Forward -297 -278 13.1758 0.0913
NP_441199.1_6 Forward -302 -283 -1.47551 0.292
NP_441494.1_6 Reverse -284 -297 11.0324 0.225
NP_442993.1_1 Reverse -187 -203 -9.08625 0.179
NP_442386.1_9 Forward -197 -188 11.0124 0.107
NP_440570.1_5 Forward -130 -111 1.86774 0.234
NP_441340.1_5 Reverse -188 -195 13.5105 0.0314
NP_441340.1_5 Reverse -290 -297 6.23397 0.132
NP_441340.1_5 Forward -297 -290 6.13563 0.175
NP_441340.1_5 Forward -195 -188 5.84064 0.208
NP_442186.1_9 Forward -79 -60 6.58763 0.228
NP_440622.1_7 Reverse -182 -201 14.8474 0.265
NP_440168.1_9 Reverse -287 -306 -1.18052 0.273
NP_442240.1_1 Reverse -60 -79 7.27514 0.253
NP_442240.1_2 Reverse -290 -309 -19.2734 0.295
NP_441027.1_1 Reverse -166 -180 15.0436 0.256
NP_440586.1_8 Forward -195 -188 9.47853 0.146
NP_440586.1_8 Reverse -188 -195 5.74197 0.283
NP_442251.1_6 Forward -297 -290 11.9372 0.0749
NP_441262.1_3 Reverse -187 -194 14.7888 0.0223
NP_441262.1_3 Forward -298 -291 10.6589 0.0722
NP_440027.1_3 Reverse -368 -386 4.34495 0.262
NP_440027.1_3 Forward -337 -319 4.14829 0.262
NP_440027.1_8 Forward -199 -180 7.96345 0.252
NP_443051.1_1 Reverse -186 -195 15.1427 0.00754
NP_443051.1_1 Reverse -288 -297 8.35786 0.0371
NP_443051.1_1 Forward -299 -290 0.393051 0.169
NP_439984.1_3 Reverse -180 -194 12.3887 0.276
NP_440408.1_7 Forward -87 -68 7.57094 0.287
NP_440439.1_1 Forward -301 -288 0.510939 0.188
NP_440439.1_1 Reverse -184 -197 0.510939 0.188
NP_440439.1_1 Reverse -381 -394 -1.06236 0.249
NP_439943.1_4 Forward -277 -258 3.44104 0.298
NP_440372.1_2 Reverse -188 -195 13.8055 0.0214
NP_440372.1_2 Reverse -290 -297 6.62729 0.151
NP_440372.1_2 Forward -297 -290 6.52896 0.188
NP_440372.1_2 Forward -195 -188 6.52896 0.188
NP_440171.1_3 Reverse -379 -398 12.4875 0.177
NP_441789.1_7 Forward -306 -287 -2.65624 0.258
NP_440819.1_5 Forward -181 -173 7.98423 0.228
NP_441803.1_2 Reverse -366 -385 5.99764 0.159
NP_439977.1_5 Forward -304 -285 1.37609 0.194
NP_440139.1_1 Reverse -181 -200 13.2733 0.0664
NP_440267.1_2 Forward -303 -289 11.602 0.125
NP_442384.1_10 Forward -196 -183 8.86907 0.0606
NP_442384.1_10 Forward -109 -96 2.77255 0.213
NP_442262.1_10 Forward -195 -188 13.2155 0.0213
NP_442262.1_10 Forward -297 -290 12.4288 0.0538
NP_441689.1_5 Forward -198 -188 15.3192 0.0403
NP_440344.1_10 Forward -203 -186 -7.33598 0.116
NP_440344.1_10 Reverse -282 -299 -9.89259 0.16
NP_440344.1_10 Forward -388 -371 -13.9242 0.298
NP_440531.1_6 Reverse -179 -198 -3.54046 0.268
NP_441060.1_6 Reverse -256 -272 11.2683 0.254
NP_441898.1_2 Forward -317 -298 15.8299 0.212
NP_442693.1_6 Reverse -255 -274 1.17943 0.278
NP_440297.1_9 Forward -297 -287 6.96153 0.161
NP_440297.1_9 Forward -195 -185 -0.216628 0.282
NP_440894.1_10 Forward -398 -379 6.58763 0.215
NP_440999.1_9 Reverse -285 -299 -0.000409212 0.195
NP_440999.1_9 Forward -302 -288 -1.5737 0.242
NP_440888.1_2 Forward -298 -284 7.17714 0.205
NP_440600.1_4 Forward -306 -288 1.78911 0.125
NP_439969.1_1 Reverse -175 -194 2.26107 0.184
NP_439969.1_1 Forward -275 -256 -7.17871 0.291
NP_442033.1_10 Reverse -287 -306 -9.83364 0.222
NP_441543.1_2 Reverse -188 -197 4.52295 0.234
NP_441304.1_10 Reverse -286 -295 13.1761 0.255
NP_441178.1_5 Reverse -353 -372 13.4708 0.152
NP_441469.1_8 Reverse -288 -297 10.8161 0.195
NP_443064.1_6 Forward -196 -186 8.88251 0.262
NP_441306.1_10 Reverse -316 -330 22.8117 0.0336
NP_442578.1_7 Reverse -188 -195 6.0373 0.18
NP_440710.1_1 Forward -306 -288 -1.06249 0.179
NP_440220.1_4 Reverse -124 -143 -1.77127 0.264
NP_441462.1_2 Reverse -289 -299 9.51814 0.0171
NP_441462.1_2 Reverse -187 -197 8.82982 0.03
NP_441462.1_2 Forward -298 -288 0.57002 0.144
NP_441462.1_2 Forward -196 -186 0.57002 0.144
NP_441621.1_7 Reverse -287 -301 -4.7203 0.242
NP_441601.1_4 Forward -395 -376 0.491109 0.262
NP_441601.1_4 Forward -325 -306 -5.31042 0.293
NP_442204.1_1 Forward -302 -291 3.10693 0.266
NP_442204.1_1 Reverse -183 -194 1.92696 0.266
NP_442204.1_2 Forward -206 -187 10.4225 0.223
NP_440516.1_6 Reverse -224 -238 6.98048 0.285
NP_440516.1_8 Reverse -187 -196 9.4395 0.0183
NP_440516.1_8 Forward -196 -187 5.11294 0.118
NP_440516.1_8 Reverse -289 -298 -0.295266 0.232
NP_442428.1_5 Forward -297 -290 6.43063 0.148
NP_442428.1_5 Reverse -290 -297 6.13563 0.209
NP_442428.1_5 Reverse -188 -195 6.13563 0.209
NP_442428.1_5 Forward -195 -188 6.0373 0.212
NP_440818.1_1 Reverse -140 -159 -3.93378 0.28
NP_440818.1_6 Reverse -254 -273 9.14423 0.228
NP_442120.1_10 Reverse -283 -302 -4.22878 0.199
NP_442120.1_10 Reverse -265 -284 -14.3569 0.288
NP_441867.1_2 Reverse -356 -375 -20.3551 0.291
NP_440673.1_3 Forward -194 -187 12.4288 0.0426
NP_440673.1_3 Forward -296 -289 9.77388 0.167
NP_440865.1_9 Reverse -283 -302 -3.3438 0.194
NP_441052.1_2 Reverse -187 -197 0.57002 0.256
NP_442219.1_8 Forward -378 -359 8.65027 0.241
NP_442219.1_8 Reverse -364 -383 7.39404 0.267
NP_442219.1_9 Reverse -188 -197 8.75118 0.0681
NP_440436.1_4 Forward -297 -288 12.684 0.034
NP_440436.1_4 Reverse -188 -197 6.39082 0.162
NP_440436.1_4 Forward -195 -186 6.29249 0.164
NP_441884.1_8 Reverse -288 -307 9.93088 0.0541
NP_441884.1_9 Forward -396 -377 -21.24 0.235
NP_441884.1_9 Reverse -286 -305 -23.895 0.284
NP_440222.1_2 Forward -239 -223 9.30165 0.212
NP_441719.1_4 Reverse -188 -195 6.82395 0.0855
NP_441719.1_4 Reverse -290 -297 6.62729 0.151
NP_441719.1_4 Forward -297 -290 6.52896 0.188
NP_441719.1_4 Forward -195 -188 6.52896 0.188
NP_441004.1_1 Reverse -283 -302 -5.70374 0.179
NP_441004.1_1 Forward -239 -220 -9.83364 0.212
NP_441004.1_2 Forward -351 -332 1.67108 0.217
NP_442813.1_4 Forward -399 -380 0.0977854 0.21
NP_442813.1_4 Reverse -92 -111 -9.047 0.299
NP_442366.1_3 Reverse -186 -204 6.70565 0.0773
NP_442366.1_3 Forward -299 -281 -0.570838 0.194
NP_442366.1_5 Reverse -65 -75 11.9759 0.148
NP_440129.1_10 Reverse -367 -381 7.27608 0.177
NP_440129.1_10 Forward -369 -355 1.96621 0.28
NP_442873.1_9 Forward -206 -187 4.32522 0.287
NP_440296.1_10 Forward -130 -111 -13.4719 0.269
NP_441115.1_4 Forward -299 -281 7.78652 0.272
NP_442206.1_10 Reverse -289 -304 10.108 0.139
NP_442206.1_10 Reverse -187 -202 1.84819 0.215
NP_442854.1_6 Forward -302 -283 5.50599 0.249
NP_443054.1_2 Forward -300 -286 6.48943 0.191
NP_441851.1_10 Reverse -186 -196 9.02648 0.114
NP_441851.1_10 Reverse -288 -298 8.92815 0.114
NP_441851.1_10 Forward -98 -88 4.0116 0.291
NP_441195.1_6 Reverse -354 -373 7.57094 0.29
NP_442622.1_8 Forward -196 -178 0.805796 0.0626
NP_442856.1_7 Forward -380 -361 -6.29373 0.297
NP_442515.1_1 Forward -113 -99 -0.393733 0.222
NP_440593.1_3 Forward -379 -360 -4.91709 0.254
NP_440463.1_6 Forward -396 -377 6.19431 0.295
NP_440165.1_5 Reverse -288 -307 -5.21209 0.22
NP_440432.1_9 Forward -195 -180 -1.88839 0.167
NP_440474.1_8 Forward -370 -356 4.12889 0.291
NP_440588.1_10 Forward -87 -68 5.99764 0.239
NP_442006.1_2 Forward -103 -86 -10.1876 0.197
NP_442006.1_2 Reverse -313 -330 -14.6125 0.205
NP_442006.1_2 Forward -88 -71 -17.3657 0.274
NP_441570.1_1 Reverse -289 -307 -6.56903 0.0807
NP_441570.1_1 Forward -196 -178 -17.7788 0.291
NP_441078.1_4 Reverse -289 -298 0.589713 0.174
NP_441078.1_4 Forward -298 -289 0.589713 0.174
NP_441078.1_4 Reverse -187 -196 0.0980582 0.205
NP_441078.1_4 Forward -196 -187 0.0980582 0.205
NP_441663.1_8 Reverse -376 -395 -3.54046 0.291
NP_442443.1_1 Reverse -324 -343 -4.52377 0.272
NP_440526.1_3 Forward -297 -286 10.8746 0.0646
NP_441432.1_8 Reverse -288 -297 9.34117 0.0755
NP_441432.1_8 Reverse -186 -195 5.60459 0.147
NP_442320.1_8 Forward -202 -188 4.03116 0.0559
NP_442320.1_8 Reverse -283 -297 -2.06536 0.0851
NP_441732.1_2 Forward -302 -286 -15.4778 0.147
NP_441732.1_2 Forward -284 -268 -15.6744 0.155
NP_441732.1_2 Reverse -355 -371 -16.6577 0.186
NP_440290.1_1 Forward -51 -42 16.6071 0.24
NP_440760.1_1 Forward -298 -279 -4.91709 0.0475
NP_442797.1_7 Forward -350 -332 -1.25915 0.294
NP_440199.1_10 Reverse -154 -164 6.56821 0.296
NP_439900.1_1 Forward -95 -76 11.9958 0.251
NP_440913.1_1 Reverse -287 -305 6.01734 0.231
NP_440913.1_3 Reverse -368 -381 16.2439 0.214
NP_441072.1_2 Reverse -176 -195 11.2092 0.188
NP_441072.1_8 Forward -94 -75 11.5042 0.1
NP_442489.1_7 Forward -298 -289 7.86621 0.0448
NP_442489.1_7 Forward -196 -187 0.786375 0.152
NP_442489.1_7 Reverse -289 -298 0.589713 0.17
NP_442489.1_7 Reverse -187 -196 0.589713 0.17
NP_442079.1_7 Forward -382 -363 0.294447 0.286
NP_440559.1_1 Reverse -188 -197 14.7494 0.0118
NP_440559.1_1 Forward -195 -186 7.66954 0.0999
NP_440559.1_1 Forward -297 -288 7.47288 0.108
NP_440559.1_1 Reverse -290 -299 5.50626 0.14
NP_441659.2_8 Forward -196 -186 13.943 0.0106
NP_441659.2_8 Forward -298 -288 7.25653 0.0622
NP_441659.2_8 Reverse -289 -299 1.84832 0.224
NP_441040.1_2 Forward -275 -256 -8.35868 0.236
NP_442849.1_1 Reverse -372 -386 8.06273 0.282
NP_439956.1_7 Forward -276 -257 14.1591 0.144
NP_439956.1_7 Reverse -265 -284 4.916 0.257
NP_440779.1_5 Forward -298 -281 -5.36936 0.149
NP_442346.1_5 Reverse -288 -298 14.7297 0.0103
NP_442346.1_5 Reverse -186 -196 8.33817 0.14
NP_442346.1_5 Forward -299 -289 4.99491 0.267
NP_442346.1_5 Forward -197 -187 4.69992 0.276
NP_442346.1_10 Forward -276 -257 -0.4922 0.27
NP_440545.1_3 Forward -372 -355 -0.649475 0.157
NP_440545.1_3 Reverse -370 -387 -0.747806 0.157
NP_440545.1_3 Reverse -285 -302 -1.53445 0.17
NP_440486.1_6 Reverse -332 -351 17.994 0.207
NP_440459.1_2 Reverse -222 -239 8.39697 0.264
NP_440459.1_6 Forward -75 -56 15.8307 0.182
NP_441653.1_2 Reverse -176 -195 11.357 0.113
NP_441653.1_2 Reverse -278 -297 4.59259 0.255
NP_441653.1_2 Forward -219 -200 4.30269 0.258
NP_440010.1_10 Forward -389 -370 5.60432 0.232
NP_441943.1_8 Forward -243 -224 -13.3736 0.265
NP_442311.1_5 Reverse -326 -345 5.40766 0.245
NP_442603.1_9 Forward -272 -254 0.314141 0.293
NP_441585.1_5 Forward -305 -286 0.0970122 0.291
NP_441888.1_7 Forward -303 -289 11.3077 0.0879
NP_440449.1_6 Reverse -281 -299 7.2832 0.227
NP_441948.1_4 Reverse -355 -373 -3.81576 0.207
NP_441833.1_4 Forward -195 -188 6.52896 0.0924
NP_441833.1_4 Reverse -290 -297 6.23397 0.163
NP_441833.1_4 Reverse -188 -195 6.23397 0.163
NP_441833.1_4 Forward -297 -290 6.13563 0.198
NP_441329.1_6 Forward -49 -30 -1.86252 0.293
NP_442162.1_9 Forward -195 -188 12.9205 0.0282
NP_442162.1_9 Reverse -188 -195 12.9205 0.0282
NP_442162.1_9 Forward -297 -290 12.6255 0.0393
NP_442162.1_9 Reverse -290 -297 6.52896 0.178
NP_440671.1_4 Forward -304 -290 7.86607 0.207
NP_440671.1_4 Reverse -181 -195 7.27608 0.222
NP_440671.1_4 Forward -202 -188 6.98109 0.23
NP_442140.1_3 Forward -195 -185 9.51814 0.107
NP_442140.1_3 Forward -297 -287 5.68323 0.198
NP_440875.1_9 Reverse -291 -301 8.95605 0.233
NP_440875.1_9 Forward -194 -184 8.27469 0.233
NP_441813.1_5 Forward -198 -188 11.9764 0.0208
NP_441813.1_5 Reverse -185 -195 8.63316 0.0367
NP_441813.1_5 Forward -300 -290 7.55152 0.0735
NP_441813.1_5 Reverse -287 -297 -0.806614 0.285
NP_440590.1_4 Forward -297 -284 2.87088 0.0788
NP_440590.1_4 Reverse -188 -201 2.18257 0.0972
NP_440590.1_4 Forward -76 -63 -3.81562 0.255
NP_440567.1_1 Forward -297 -283 6.48943 0.0831
NP_440567.1_1 Reverse -188 -202 4.42448 0.121
NP_440035.1_10 Forward -305 -287 16.4865 0.229
NP_442497.1_10 Forward -297 -288 10.0295 0.0222
NP_442497.1_10 Forward -195 -186 10.0295 0.0222
NP_442497.1_10 Reverse -290 -299 5.99792 0.095
NP_442497.1_10 Reverse -188 -197 -1.18024 0.256
NP_440821.1_4 Reverse -287 -297 9.81313 0.0246
NP_440821.1_4 Reverse -185 -195 1.25834 0.139
NP_440821.1_4 Forward -198 -188 -0.314959 0.251
NP_441239.1_9 Reverse -287 -299 8.49544 0.131
NP_441239.1_9 Forward -385 -373 7.02048 0.173
NP_441239.1_9 Forward -300 -288 5.93884 0.202
NP_441239.1_9 Forward -198 -186 5.05386 0.231
NP_441239.1_10 Forward -298 -279 12.8808 0.208
NP_441951.1_9 Forward -382 -363 8.84924 0.229
NP_441892.1_1 Reverse -178 -195 4.46374 0.11
NP_441892.1_1 Reverse -280 -297 4.3654 0.111
NP_441892.1_1 Forward -307 -290 1.61214 0.15
NP_440665.1_2 Forward -349 -330 -3.3438 0.246
NP_441017.1_6 Forward -200 -186 17.7968 0.0431
NP_442629.1_3 Forward -353 -334 0.491109 0.294
NP_440900.1_1 Forward -130 -111 15.3391 0.11
NP_440833.1_6 Reverse -52 -66 7.3738 0.278
NP_441526.1_6 Reverse -296 -315 4.71934 0.271
NP_440949.1_7 Forward -210 -191 8.94676 0.264
NP_442052.1_8 Forward -154 -144 11.9764 0.297
NP_440546.1_4 Reverse -187 -197 12.6639 0.0641
NP_440546.1_4 Forward -196 -186 11.0156 0.0991
NP_440546.1_6 Forward -87 -68 10.9142 0.245
NP_441230.1_5 Reverse -182 -201 -0.0988766 0.277
NP_440462.1_6 Forward -300 -290 8.23984 0.0687
NP_440462.1_6 Forward -198 -188 4.10993 0.216
NP_442340.1_7 Reverse -288 -307 19.174 0.175
NP_440868.1_4 Reverse -183 -195 5.54551 0.0954
NP_440868.1_8 Reverse -285 -304 -4.32711 0.263
NP_441474.1_1 Forward -330 -311 7.66846 0.212
NP_442402.1_4 Forward -399 -380 -4.81951 0.231
NP_442402.1_4 Reverse -229 -248 -8.26108 0.278
NP_442402.1_10 Forward -390 -380 11.1893 0.269
NP_441084.1_6 Reverse -248 -262 9.15021 0.292
NP_442039.1_4 Forward -297 -290 14.3954 0.0271
NP_442039.1_4 Reverse -188 -195 11.6422 0.0747
NP_442039.1_7 Reverse -264 -274 15.418 0.211
NP_442039.1_7 Reverse -64 -74 7.15819 0.279
NP_441811.1_8 Reverse -302 -316 6.3911 0.273
NP_442837.1_3 Reverse -290 -297 6.0373 0.25
NP_442837.1_3 Forward -195 -188 6.0373 0.25
NP_442837.1_3 Reverse -188 -195 6.0373 0.25
NP_442837.1_3 Forward -297 -290 5.93897 0.265
NP_440160.1_9 Forward -271 -252 9.73422 0.235
NP_442053.1_1 Forward -196 -187 7.17789 0.104
NP_440505.1_3 Reverse -185 -195 8.04317 0.147
NP_440505.1_3 Reverse -287 -297 6.17489 0.192
NP_440505.1_3 Forward -300 -290 4.40493 0.292
NP_440505.1_7 Reverse -295 -314 -1.96717 0.287
NP_441788.1_10 Forward -98 -79 12.6841 0.252
NP_441252.1_6 Forward -343 -336 11.6422 0.288
NP_442971.1_5 Forward -389 -370 14.5524 0.2
NP_442255.1_5 Reverse -239 -258 9.3409 0.255
NP_441011.1_8 Reverse -290 -299 8.35786 0.144
NP_441011.1_8 Reverse -188 -197 5.99792 0.208
NP_441011.1_10 Forward -259 -240 12.4875 0.294
NP_442533.1_6 Reverse -289 -298 6.5879 0.106
NP_442533.1_6 Reverse -187 -196 5.40793 0.14
NP_442533.1_6 Forward -196 -187 4.52295 0.179
NP_442232.1_3 Reverse -281 -300 -11.5053 0.282
NP_442322.1_4 Forward -330 -313 7.70792 0.153
NP_441482.1_7 Forward -304 -290 4.42448 0.0493
NP_441482.1_7 Reverse -283 -297 -8.5552 0.193
NP_441482.1_7 Forward -202 -188 -10.6202 0.211
NP_441482.1_7 Reverse -181 -195 -10.6202 0.211
NP_439944.1_9 Reverse -188 -198 8.04317 0.121
NP_439944.1_9 Forward -297 -287 7.84651 0.127
NP_440816.1_2 Forward -122 -103 6.24133 0.284
NP_441028.1_6 Forward -389 -379 10.6976 0.197
NP_441028.1_6 Reverse -91 -101 9.02601 0.216
NP_440116.1_8 Reverse -188 -207 -5.11376 0.187
NP_441527.1_4 Forward -49 -30 -11.6027 0.284
NP_440115.1_6 Reverse -184 -194 16.303 0.0325
NP_440115.1_6 Reverse -286 -296 8.04317 0.144
NP_440115.1_6 Reverse -371 -381 7.15819 0.158
NP_439965.1_5 Reverse -281 -300 8.84842 0.299
NP_441680.1_4 Reverse -380 -399 -2.75381 0.272
NP_441972.1_3 Reverse -372 -391 11.0125 0.286
NP_441972.1_5 Forward -297 -278 -8.35868 0.263
NP_441972.1_5 Reverse -272 -291 -9.83364 0.293
NP_441106.1_1 Forward -299 -290 7.96454 0.0647
NP_439903.1_6 Forward -301 -282 13.175 0.0841
NP_439903.1_7 Reverse -316 -335 4.03102 0.281
NP_441286.1_1 Forward -197 -185 -3.50094 0.145
NP_441286.1_1 Forward -299 -287 -4.18925 0.152
NP_441286.1_1 Reverse -186 -198 -6.74586 0.278
NP_440670.1_8 Reverse -187 -196 8.65285 0.0627
NP_440670.1_8 Forward -196 -187 6.29291 0.124
NP_440670.1_8 Forward -298 -289 5.60459 0.149
NP_440670.1_8 Reverse -261 -270 3.14632 0.296
NP_440886.1_4 Forward -98 -79 13.2741 0.274
NP_440886.1_4 Forward -82 -63 12.6841 0.298
NP_440886.1_7 Forward -328 -318 5.28945 0.188
NP_440828.1_1 Forward -391 -372 7.96345 0.197
NP_440828.1_4 Reverse -358 -377 3.04693 0.152
NP_442614.1_2 Forward -81 -67 8.84938 0.244
NP_441399.1_6 Reverse -209 -228 10.7167 0.295
NP_442072.1_9 Reverse -186 -204 -22.892 0.266
NP_441808.1_8 Reverse -326 -345 7.47261 0.277
NP_440907.2_8 Forward -297 -287 9.616 0.103
NP_440907.2_8 Forward -195 -185 8.14104 0.117
NP_442264.1_2 Reverse -364 -381 4.6604 0.295
NP_441021.1_1 Forward -297 -278 0.687771 0.0877
NP_441463.1_3 Reverse -189 -208 -5.11376 0.22
NP_441463.1_6 Forward -282 -268 6.22266 0.279
NP_441626.1_2 Reverse -188 -195 12.2322 0.0511
NP_441626.1_2 Forward -297 -290 6.43063 0.147
NP_441626.1_2 Reverse -290 -297 6.0373 0.212
NP_441626.1_2 Forward -195 -188 5.93897 0.231
NP_442211.1_3 Reverse -372 -391 7.86106 0.275
NP_442238.1_3 Reverse -283 -302 6.19431 0.254
NP_442794.1_1 Reverse -58 -70 6.03717 0.198
NP_442615.1_1 Reverse -280 -298 -5.68405 0.22
NP_441962.1_4 Reverse -284 -303 -4.32711 0.157
NP_441962.1_4 Reverse -369 -388 -8.85033 0.208
NP_441962.1_4 Reverse -257 -276 -13.0786 0.268
NP_441962.1_4 Reverse -360 -379 -14.7502 0.293
NP_441431.1_2 Forward -301 -287 12.5853 0.114
NP_441431.1_2 Reverse -184 -198 5.60385 0.294
NP_441836.1_2 Forward -389 -370 -0.4922 0.212
NP_441836.1_2 Reverse -362 -381 -3.73712 0.244
NP_441836.1_2 Forward -380 -361 -4.72043 0.262
NP_441836.1_2 Forward -115 -96 -5.70374 0.284
NP_441993.1_1 Reverse -283 -302 16.5653 0.0589
NP_440814.1_4 Reverse -280 -299 -12.3902 0.23
NP_440114.1_10 Forward -298 -284 7.66941 0.229
NP_442323.1_7 Forward -303 -284 14.3549 0.076
NP_442087.1_2 Reverse -237 -256 16.7939 0.128
NP_441552.1_3 Forward -203 -184 17.0099 0.126
NP_440293.1_10 Reverse -312 -331 0.58944 0.219
NP_439988.1_3 Forward -352 -338 5.1128 0.289
NP_441237.1_9 Forward -297 -287 14.4347 0.0376
NP_440324.1_7 Forward -227 -210 15.7718 0.226
NP_439910.1_2 Forward -204 -187 -22.0856 0.207
NP_440457.1_1 Reverse -183 -195 12.7237 0.092
NP_440457.1_1 Forward -85 -73 8.39711 0.101
NP_440457.1_1 Reverse -285 -297 5.44718 0.141
NP_440457.1_1 Reverse -370 -382 -0.649339 0.271
NP_440798.1_6 Forward -195 -182 10.8357 0.0721
NP_440142.1_9 Reverse -220 -234 12.5853 0.284
NP_442130.1_8 Reverse -61 -80 10.9134 0.125
NP_441436.1_8 Reverse -373 -392 7.57094 0.293
NP_441489.1_3 Reverse -241 -255 9.08335 0.232
NP_442936.1_10 Reverse -164 -178 9.55098 0.268
NP_442514.1_5 Forward -192 -173 -8.26108 0.285
NP_442514.1_5 Reverse -70 -89 -9.34271 0.295
NP_440554.1_4 Reverse -290 -300 10.5014 0.0508
NP_440554.1_4 Forward -195 -185 5.87989 0.129
NP_441885.1_5 Reverse -187 -197 17.3846 0.00578
NP_441885.1_5 Reverse -289 -299 0.963343 0.116
NP_440478.1_9 Reverse -253 -272 12.2908 0.255
NP_442341.1_7 Reverse -186 -200 2.5562 0.252
NP_442341.1_7 Forward -167 -153 2.06454 0.271
NP_442341.1_9 Forward -105 -91 5.1122 0.279
NP_441756.1_5 Forward -395 -376 3.6377 0.199
NP_441173.1_9 Forward -250 -242 11.0321 0.228
NP_441173.1_9 Reverse -173 -181 9.75379 0.284
NP_442395.2_3 Forward -78 -60 16.6371 0.243
NP_442395.2_4 Reverse -370 -389 1.96529 0.229
NP_442395.2_4 Forward -375 -356 1.08032 0.254
NP_440423.1_6 Reverse -179 -198 -2.85214 0.126
NP_443000.1_7 Forward -300 -290 9.81313 0.0431
NP_443000.1_7 Forward -198 -188 6.56821 0.123
NP_443000.1_7 Reverse -185 -195 1.94665 0.226
NP_440507.2_3 Reverse -184 -203 10.3234 0.208
NP_443059.1_10 Forward -306 -287 -0.197979 0.275
NP_442513.1_5 Reverse -313 -332 6.58682 0.282
NP_441561.1_4 Reverse -120 -139 11.5042 0.169
NP_440275.1_3 Reverse -185 -195 14.4347 0.0216
NP_440275.1_3 Reverse -287 -297 9.81313 0.0507
NP_440275.1_3 Reverse -372 -382 6.17489 0.122
NP_440091.1_1 Forward -200 -188 1.7106 0.197
NP_442354.1_2 Reverse -266 -285 4.32602 0.299
NP_442275.1_1 Forward -233 -214 1.57275 0.284
NP_442275.1_3 Reverse -324 -343 15.3391 0.187
NP_441902.1_3 Forward -115 -105 12.3986 0.253
NP_440679.1_10 Forward -381 -362 -21.83 0.3
NP_439962.1_4 Forward -332 -313 -2.55715 0.231
NP_439962.1_4 Forward -331 -312 -6.39206 0.283
NP_442495.1_5 Reverse -278 -297 7.7676 0.291
NP_442495.1_5 Reverse -363 -382 5.11266 0.293
NP_440149.1_8 Reverse -187 -206 -3.54046 0.192
NP_441105.1_3 Reverse -278 -297 15.0441 0.0198
NP_441105.1_3 Forward -207 -188 3.24438 0.0932
NP_440216.1_1 Forward -196 -182 13.2743 0.00583
NP_440216.1_1 Reverse -289 -303 -12.2918 0.256
NP_440172.1_1 Reverse -289 -299 16.598 0.00854
NP_440172.1_1 Reverse -187 -197 7.55152 0.0761
NP_440172.1_1 Forward -196 -186 3.61828 0.222
NP_440172.1_1 Forward -298 -288 3.51995 0.224
NP_442015.1_10 Forward -200 -187 0.805932 0.218
NP_442015.1_10 Forward -101 -88 -0.275709 0.259
NP_441226.1_7 Reverse -188 -195 12.7234 0.0312
NP_441226.1_7 Forward -195 -188 11.5435 0.0757
NP_441226.1_7 Forward -70 -63 9.47853 0.147
NP_441226.1_7 Reverse -290 -297 5.64364 0.286
NP_441111.1_7 Forward -297 -289 8.86921 0.0589
NP_441111.1_7 Forward -195 -187 8.86921 0.0589
NP_441766.1_2 Reverse -289 -298 8.1612 0.0645
NP_441766.1_2 Reverse -187 -196 8.1612 0.0645
NP_441766.1_2 Forward -196 -187 5.89959 0.103
NP_441766.1_9 Reverse -179 -198 3.44104 0.218
NP_442417.1_5 Reverse -289 -303 5.30946 0.267
NP_440416.1_9 Forward -203 -184 4.42435 0.0355
NP_440416.1_9 Reverse -192 -211 -8.55534 0.117
NP_440416.1_9 Reverse -254 -273 -20.0601 0.281
NP_440416.1_9 Reverse -93 -112 -20.3551 0.284
NP_440416.1_9 Reverse -61 -80 -20.65 0.287
NP_440416.1_9 Forward -334 -315 -21.24 0.293
NP_443052.1_8 Reverse -337 -356 -1.57384 0.0805
NP_443052.1_9 Forward -385 -366 9.0459 0.113
NP_443052.1_9 Reverse -367 -386 0.58944 0.194
NP_443052.1_9 Reverse -364 -383 -2.65548 0.241
NP_440591.1_9 Reverse -282 -300 12.5072 0.0935
NP_440261.1_5 Forward -195 -182 6.60746 0.0318
NP_440261.1_5 Forward -297 -284 -10.2071 0.201
NP_440261.1_5 Forward -382 -369 -12.1738 0.272
NP_440988.1_10 Reverse -366 -380 4.89883 0.249
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATTTCCCGCCGCTTTCCTCCGGTGGCCCCGGTGACCACAGCATAGGTTAGCCCCCCTTGGTGCAACACTGCCCGCCCACCACTGGGCCTCGTTACCAACCCAAGCGATTGCCCCTGCCAAGTTAATTGCCGCCAATGGTCTGGCCAGGATTTTTGCAAATAACCTAGGGAAATGGTGGGCCTAGACCAACCGTAGAATCGCAATACCGATCGCCCGGTGCGGGGAAAATAATCTTCCAATAACCATTGATCCAAGGCCATTTGTAAATTACCGGGAGCTTGGATGTAGGGCAATAAACGCCAGGGGGAAGACTGAGCAGGGGGAAGGGTAGCCAACGGGAAAGTTCTCCTGACAAAAGTCTAGGCAAAATATGTTAGTCTTAAAAACGCTAGGACAACAC

CDS

No sequence available

Protein

No sequence available