Your browser is old and dusty. Try Google Chrome!

Details for 6803t16

ORF 6803t16
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Forward -245 -226 0.884433 0.265
NP_441418.1_6 Forward -274 -255 -21.7317 0.159
NP_441418.1_6 Forward -93 -74 -29.4015 0.224
NP_440815.1_2 Reverse -360 -374 14.0603 0.234
NP_442291.1_5 Reverse -152 -168 0.55019 0.162
NP_441453.1_1 Forward -281 -263 7.29487 0.216
NP_441453.1_4 Reverse -265 -273 7.19758 0.0757
NP_441453.1_4 Forward -93 -85 6.80426 0.121
NP_441453.1_4 Forward -274 -266 6.70593 0.121
NP_441453.1_4 Reverse -84 -92 6.11594 0.121
NP_441818.1_1 Reverse -85 -96 14.4145 0.0502
NP_440226.1_1 Reverse -265 -284 4.12936 0.202
NP_440226.1_1 Reverse -84 -103 3.6377 0.218
NP_441630.1_3 Reverse -257 -276 3.73603 0.186
NP_441630.1_3 Forward -101 -82 -1.37718 0.298
NP_443002.1_5 Reverse -127 -145 8.17984 0.299
NP_442173.1_1 Reverse -85 -93 12.0158 0.0316
NP_442173.1_1 Reverse -266 -274 5.82095 0.2
NP_442173.1_1 Forward -273 -265 5.72262 0.203
NP_442173.1_1 Forward -92 -84 4.83764 0.241
NP_442752.1_4 Forward -274 -267 13.8055 0.0199
NP_442752.1_4 Forward -93 -86 13.8055 0.0199
NP_443027.1_4 Forward -276 -266 9.41981 0.163
NP_443027.1_4 Forward -210 -200 7.64985 0.238
NP_439997.1_4 Reverse -260 -279 5.50599 0.287
NP_442975.1_10 Reverse -261 -275 8.16044 0.105
NP_440784.1_7 Reverse -266 -273 6.23397 0.241
NP_440784.1_7 Forward -92 -85 6.23397 0.241
NP_440784.1_7 Forward -273 -266 6.13563 0.241
NP_440784.1_7 Reverse -85 -92 6.13563 0.241
NP_442062.1_8 Forward -274 -264 8.1415 0.0801
NP_440761.1_4 Reverse -199 -218 -20.3551 0.287
NP_442242.1_4 Forward -273 -266 12.4288 0.0393
NP_441781.1_7 Reverse -198 -217 -2.45882 0.289
NP_441208.1_9 Reverse -262 -276 7.9644 0.219
NP_442110.1_7 Forward -377 -363 3.73617 0.21
NP_442110.1_7 Forward -99 -85 0.392915 0.261
NP_441082.1_10 Reverse -382 -395 10.1474 0.236
NP_441925.1_4 Forward -298 -279 -8.55607 0.21
NP_440856.1_4 Forward -281 -262 -0.000545616 0.173
NP_441083.1_5 Reverse -84 -94 17.7779 0.00336
NP_441083.1_5 Forward -274 -264 9.7148 0.0231
NP_441083.1_5 Forward -93 -83 7.05986 0.067
NP_441083.1_5 Reverse -159 -169 2.43831 0.195
NP_441083.1_5 Reverse -265 -275 2.04498 0.195
NP_442827.1_8 Forward -311 -292 1.86696 0.171
NP_441738.1_2 Reverse -267 -274 15.28 0.0102
NP_441738.1_2 Reverse -86 -93 15.28 0.0102
NP_440209.1_1 Forward -274 -266 14.8674 0.012
NP_440209.1_1 Reverse -265 -273 8.57422 0.0425
NP_440209.1_1 Forward -93 -85 8.57422 0.0425
NP_440209.1_1 Reverse -84 -92 5.52596 0.0821
NP_442889.1_8 Forward -15 -1 5.80051 0.213
NP_440178.1_7 Reverse -83 -102 -22.6167 0.268
NP_442570.1_3 Reverse -273 -292 -3.73712 0.225
NP_442570.1_3 Reverse -180 -199 -6.58872 0.258
NP_442570.1_3 Reverse -191 -210 -8.752 0.292
NP_442461.1_2 Reverse -102 -121 16.1257 0.216
NP_442111.1_4 Reverse -83 -97 9.63603 0.0593
NP_442111.1_4 Reverse -264 -278 1.67122 0.296
NP_441624.1_7 Forward -105 -91 8.25939 0.24
NP_441624.1_7 Reverse -204 -218 7.57108 0.249
NP_440906.1_5 Forward -273 -266 12.0355 0.0724
NP_440906.1_5 Reverse -266 -273 12.0355 0.0724
NP_440906.1_5 Forward -92 -85 6.23397 0.234
NP_440906.1_5 Reverse -85 -92 6.13563 0.241
NP_442596.1_10 Reverse -98 -117 6.39097 0.293
NP_440747.1_10 Forward -277 -265 7.31547 0.00577
NP_440747.1_10 Forward -96 -84 -2.61596 0.0556
NP_440747.1_10 Reverse -262 -274 -4.28759 0.0903
NP_440747.1_10 Reverse -81 -93 -4.38592 0.0974
NP_440747.1_10 Forward -211 -199 -12.2524 0.254
NP_441130.1_10 Reverse -82 -96 6.88276 0.173
NP_441854.1_10 Reverse -28 -47 1.57275 0.282
NP_442973.1_5 Reverse -256 -275 11.3075 0.249
NP_441486.1_1 Forward -96 -82 -2.36035 0.175
NP_442634.1_4 Reverse -263 -277 -3.147 0.161
NP_442634.1_4 Forward -210 -196 -4.22864 0.19
NP_441014.1_8 Reverse -77 -96 -7.96535 0.282
NP_441014.1_10 Forward -130 -111 -2.45958 0.276
NP_442848.1_1 Forward -99 -85 -0.885388 0.263
NP_441012.1_4 Forward -217 -204 13.7856 0.209
NP_443018.1_3 Reverse -85 -92 11.7405 0.0655
NP_443018.1_3 Forward -92 -85 5.44732 0.193
NP_443018.1_3 Forward -273 -266 5.34899 0.212
NP_443018.1_3 Reverse -266 -273 5.34899 0.212
NP_441316.1_7 Reverse -263 -278 -2.18338 0.246
NP_440376.1_1 Forward -274 -265 9.73449 0.0365
NP_440376.1_1 Reverse -265 -274 9.73449 0.0365
NP_440376.1_1 Forward -93 -84 5.99792 0.111
NP_440376.1_1 Reverse -120 -129 1.76968 0.242
NP_440376.1_1 Reverse -84 -93 -0.196935 0.285
NP_442687.1_7 Reverse -264 -274 8.82982 0.1
NP_442687.1_7 Forward -275 -265 7.45319 0.132
NP_442687.1_7 Reverse -83 -93 5.97822 0.179
NP_442191.1_4 Reverse -206 -220 11.284 0.263
NP_441846.1_10 Reverse -103 -122 -21.83 0.256
NP_441846.1_10 Reverse -264 -283 -22.6167 0.264
NP_441029.1_4 Forward -89 -70 2.75272 0.22
NP_440533.1_9 Reverse -265 -284 8.25926 0.168
NP_442658.1_1 Reverse -263 -273 11.4843 0.082
NP_442658.1_1 Forward -113 -103 5.19112 0.28
NP_442658.1_9 Reverse -240 -259 15.1424 0.276
NP_440141.1_8 Reverse -88 -107 5.89931 0.271
NP_440662.1_2 Reverse -68 -87 -3.63879 0.276
NP_441414.1_9 Forward -93 -74 -9.44032 0.259
NP_440607.1_1 Reverse -241 -260 10.9142 0.272
NP_441256.1_8 Forward -71 -52 5.11266 0.272
NP_442321.1_1 Forward -276 -257 -2.95047 0.214
NP_441958.1_5 Forward -275 -265 11.6814 0.00361
NP_441958.1_5 Reverse -264 -274 10.7964 0.0099
NP_441958.1_5 Reverse -83 -93 0.865012 0.12
NP_441958.1_5 Forward -94 -84 0.865012 0.12
NP_439905.1_1 Reverse -85 -98 10.049 0.216
NP_440984.1_7 Reverse -260 -274 5.21113 0.265
NP_439990.1_5 Forward -279 -266 14.7689 0.0753
NP_439990.1_9 Reverse -141 -157 18.9381 0.165
NP_442690.1_1 Forward -246 -227 -16.8151 0.291
NP_442911.1_2 Reverse -189 -208 -7.86702 0.221
NP_442911.1_2 Reverse -74 -93 -10.1286 0.27
NP_440153.1_5 Reverse -85 -99 11.3077 0.0763
NP_443055.1_6 Reverse -257 -275 2.87 0.203
NP_443055.1_6 Reverse -76 -94 -1.45654 0.279
NP_440827.1_3 Reverse -199 -218 12.0942 0.261
NP_440827.1_3 Forward -104 -85 11.4058 0.268
NP_441099.1_5 Reverse -74 -93 -6.88371 0.167
NP_441099.1_5 Forward -218 -199 -10.7186 0.261
NP_442002.1_4 Forward -231 -213 19.0954 0.272
NP_440411.1_10 Reverse -202 -221 15.6292 0.194
NP_442438.1_10 Reverse -194 -208 7.57108 0.0921
NP_441398.1_9 Forward -218 -199 14.8466 0.288
NP_441000.1_5 Forward -127 -108 4.62021 0.284
NP_441000.1_6 Reverse -83 -97 4.52282 0.0953
NP_440147.1_4 Reverse -263 -276 10.5407 0.0355
NP_440147.1_4 Reverse -82 -95 1.59258 0.224
NP_440147.1_4 Forward -276 -263 1.19926 0.235
NP_441550.1_8 Forward -95 -85 13.8442 0.0207
NP_441550.1_8 Reverse -82 -92 13.0576 0.0273
NP_441550.1_8 Reverse -263 -273 8.53436 0.123
NP_441550.1_8 Forward -276 -266 6.46942 0.206
NP_441916.1_7 Reverse -265 -275 9.41981 0.0357
NP_441916.1_7 Forward -274 -264 7.05986 0.0779
NP_440206.1_4 Forward -218 -199 2.35861 0.289
NP_441041.1_7 Reverse -262 -274 8.00067 0.151
NP_441041.1_7 Reverse -124 -136 5.76558 0.241
NP_441041.1_7 Reverse -81 -93 5.6684 0.245
NP_441725.1_5 Forward -273 -263 1.94665 0.115
NP_441725.1_5 Forward -92 -82 0.0783647 0.215
NP_441725.1_5 Reverse -205 -215 -0.314959 0.246
NP_441725.1_5 Forward -207 -197 -1.10161 0.288
NP_439966.1_7 Forward -95 -85 5.58445 0.216
NP_439966.1_7 Forward -276 -266 4.50281 0.269
NP_442941.1_3 Reverse -266 -276 9.51814 0.0306
NP_442941.1_3 Reverse -85 -95 9.41981 0.0319
NP_440289.1_2 Forward -277 -264 -3.81562 0.271
NP_440289.1_2 Forward -96 -83 -4.9956 0.294
NP_441678.1_9 Forward -192 -173 -5.31042 0.297
NP_442281.1_1 Reverse -79 -93 12.0937 0.0409
NP_442281.1_1 Reverse -260 -274 4.03056 0.21
NP_442281.1_1 Forward -218 -204 3.53891 0.228
NP_442256.1_2 Reverse -82 -100 1.69077 0.107
NP_001035871.2_7 Forward -217 -207 13.5497 0.219
NP_440437.1_1 Reverse -256 -275 -2.55715 0.219
NP_440647.1_9 Reverse -263 -281 4.34571 0.249
NP_442012.1_1 Forward -280 -261 -1.08219 0.274
NP_442012.1_2 Forward -95 -76 2.94938 0.239
NP_441457.1_7 Reverse -71 -90 1.57275 0.276
NP_442068.1_1 Reverse -278 -297 1.96607 0.298
NP_441644.1_6 Reverse -84 -94 14.4342 0.0126
NP_441644.1_6 Forward -274 -264 11.3859 0.0502
NP_441644.1_6 Reverse -265 -275 10.206 0.0628
NP_441644.1_6 Forward -213 -203 3.71617 0.267
NP_443049.1_2 Forward -215 -196 20.944 0.0322
NP_443049.1_6 Forward -94 -84 14.4711 0.114
NP_442215.1_2 Reverse -202 -218 -1.12144 0.179
NP_440929.1_8 Reverse -265 -274 9.73449 0.0257
NP_440929.1_8 Forward -274 -265 9.4395 0.0326
NP_440929.1_8 Reverse -84 -93 7.07956 0.0713
NP_442933.1_10 Forward -274 -265 13.9627 0.0192
NP_442933.1_10 Reverse -265 -274 8.1612 0.0885
NP_441751.2_8 Reverse -266 -280 2.75286 0.0759
NP_441751.2_8 Reverse -200 -214 -4.91696 0.187
NP_442554.1_8 Reverse -266 -276 7.55152 0.0893
NP_442554.1_8 Reverse -85 -95 6.37155 0.12
NP_442554.1_8 Forward -273 -263 4.69992 0.176
NP_442554.1_8 Forward -212 -202 4.20827 0.193
NP_442554.1_8 Reverse -200 -210 3.71661 0.215
NP_442554.1_8 Reverse -205 -215 3.12662 0.239
NP_442554.1_8 Forward -92 -82 2.33998 0.274
NP_442554.1_9 Forward -156 -137 14.599 0.246
NP_441762.1_7 Forward -94 -82 -7.33585 0.287
NP_442142.1_4 Reverse -81 -94 6.0169 0.175
NP_442142.1_4 Forward -216 -203 3.95196 0.239
NP_442142.1_4 Reverse -262 -275 3.55864 0.251
NP_442292.1_1 Reverse -85 -94 8.65285 0.0335
NP_442292.1_1 Reverse -266 -275 7.76787 0.0615
NP_442292.1_1 Forward -273 -264 -0.295266 0.24
NP_440919.1_1 Forward -98 -79 0.884433 0.221
NP_440919.1_7 Forward -338 -320 8.05392 0.218
NP_442476.1_6 Reverse -85 -99 0.982901 0.233
NP_443009.1_5 Reverse -264 -275 13.8245 0.0266
NP_443009.1_5 Forward -275 -264 7.23633 0.135
NP_443009.1_5 Forward -209 -198 3.8931 0.274
NP_442408.2_1 Forward -99 -80 -2.75381 0.241
NP_441715.1_4 Reverse -85 -95 7.55152 0.108
NP_441715.1_4 Reverse -266 -276 7.05986 0.118
NP_442076.1_5 Reverse -224 -243 5.211 0.293
NP_440379.1_5 Forward -144 -125 -9.14533 0.259
NP_441468.1_1 Reverse -266 -273 6.13563 0.209
NP_441468.1_1 Forward -92 -85 6.13563 0.209
NP_441468.1_1 Reverse -85 -92 6.0373 0.223
NP_441468.1_1 Forward -273 -266 6.0373 0.223
NP_442099.1_1 Reverse -375 -393 13.8838 0.274
NP_441673.1_1 Reverse -265 -274 11.1111 0.0121
NP_441673.1_1 Forward -274 -265 11.0128 0.018
NP_441673.1_1 Forward -93 -84 1.37636 0.114
NP_441673.1_1 Reverse -84 -93 1.1797 0.163
NP_441731.1_1 Reverse -269 -287 14.5168 0.281
NP_441956.1_9 Forward -100 -81 6.19431 0.274
NP_441826.1_2 Forward -99 -85 3.24451 0.113
NP_441826.1_2 Forward -168 -154 1.08123 0.164
NP_441826.1_2 Forward -219 -205 -4.4253 0.296
NP_441826.1_5 Reverse -85 -104 2.45773 0.276
NP_441637.1_8 Forward -89 -72 11.9369 0.209
NP_442868.1_6 Forward -95 -85 9.51814 0.0447
NP_442868.1_6 Forward -276 -266 0.57002 0.217
NP_442719.1_2 Forward -234 -216 -9.42131 0.264
NP_442719.1_2 Forward -120 -102 -11.8796 0.297
NP_441251.1_8 Reverse -321 -334 10.9479 0.27
NP_442427.1_8 Reverse -75 -94 6.88262 0.227
NP_442808.1_1 Reverse -83 -93 9.71433 0.0481
NP_442808.1_1 Reverse -264 -274 7.45273 0.0783
NP_442808.1_1 Forward -291 -281 5.19112 0.168
NP_442692.1_1 Reverse -74 -93 -6.49039 0.296
NP_442050.1_1 Reverse -90 -109 9.93088 0.247
NP_442050.1_10 Reverse -203 -216 19.9805 0.179
NP_441493.2_10 Reverse -73 -92 8.06259 0.249
NP_440558.1_2 Reverse -348 -367 -6.98204 0.284
NP_440274.1_2 Forward -310 -296 11.602 0.26
NP_441878.1_6 Reverse -264 -274 10.5014 0.0176
NP_441878.1_6 Reverse -198 -208 1.65166 0.0795
NP_441878.1_6 Forward -214 -204 1.06167 0.116
NP_441878.1_6 Forward -275 -265 0.668351 0.139
NP_441878.1_6 Reverse -83 -93 0.57002 0.14
NP_441878.1_6 Reverse -248 -258 0.0783647 0.152
NP_441878.1_6 Reverse -203 -213 -0.0199663 0.163
NP_441878.1_6 Reverse -119 -129 -7.78811 0.266
NP_441036.1_8 Forward -275 -265 6.8632 0.213
NP_441036.1_8 Reverse -264 -274 6.8632 0.213
NP_441557.1_5 Reverse -265 -274 10.2261 0.0144
NP_441557.1_5 Forward -274 -265 10.1278 0.0188
NP_441557.1_5 Forward -93 -84 1.08137 0.0794
NP_441557.1_5 Reverse -84 -93 0.589713 0.134
NP_441445.1_1 Reverse -272 -291 4.52268 0.193
NP_441433.1_3 Reverse -79 -98 18.9773 0.0733
NP_442830.1_5 Forward -291 -277 7.57046 0.215
NP_442397.1_9 Reverse -198 -217 2.45773 0.276
NP_442444.1_6 Reverse -196 -214 12.1468 0.289
NP_441549.1_9 Forward -212 -194 -8.43732 0.228
NP_442347.1_2 Reverse -85 -94 10.3245 0.058
NP_442645.1_2 Forward -137 -118 -6.49039 0.0893
NP_442645.1_2 Forward -101 -82 -22.0267 0.29
NP_442645.1_4 Reverse -237 -256 7.47261 0.235
NP_442888.1_9 Reverse -329 -348 13.2741 0.274
NP_441037.1_4 Reverse -263 -273 7.70752 0.237
NP_441037.1_4 Forward -276 -266 6.14821 0.278
NP_441633.1_3 Forward -276 -263 -4.11062 0.181
NP_441633.1_3 Forward -95 -82 -6.56889 0.259
NP_440136.1_2 Forward -92 -85 6.23397 0.171
NP_440136.1_2 Reverse -266 -273 6.23397 0.171
NP_440136.1_2 Forward -273 -266 6.13563 0.193
NP_440136.1_2 Reverse -85 -92 6.13563 0.193
NP_442590.1_10 Reverse -84 -103 15.1424 0.113
NP_442998.1_5 Reverse -53 -63 14.533 0.149
NP_442998.1_5 Reverse -327 -337 10.3048 0.218
NP_442998.1_5 Reverse -110 -120 8.33817 0.264
NP_442998.1_10 Reverse -267 -274 15.5754 0.0102
NP_442998.1_10 Reverse -86 -93 15.5754 0.0102
NP_442998.1_10 Forward -272 -265 5.74231 0.255
NP_440899.1_2 Forward -285 -266 5.89851 0.273
NP_440299.1_1 Reverse -261 -274 7.00021 0.124
NP_441799.1_1 Reverse -80 -94 9.43874 0.0922
NP_441799.1_1 Reverse -261 -275 5.89884 0.19
NP_441007.1_10 Forward -279 -266 1.00259 0.209
NP_442333.2_5 Forward -110 -91 -9.83364 0.246
NP_440256.1_1 Forward -277 -258 -1.08219 0.0997
NP_440256.1_1 Reverse -207 -226 -7.08038 0.228
NP_441559.1_8 Forward -251 -237 2.65453 0.143
NP_441559.1_8 Forward -279 -265 1.08123 0.156
NP_441559.1_8 Reverse -193 -207 0.0979218 0.17
NP_441559.1_8 Forward -86 -72 -1.5737 0.184
NP_441559.1_8 Forward -213 -199 -7.37523 0.291
NP_442756.1_2 Reverse -76 -95 3.83436 0.296
NP_440915.1_6 Forward -97 -83 9.04604 0.047
NP_440915.1_6 Forward -278 -264 -0.0987402 0.182
NP_440915.1_6 Reverse -195 -209 -0.983719 0.217
NP_440749.1_1 Reverse -204 -223 2.0644 0.257
NP_442866.1_1 Forward -87 -68 0.392778 0.182
NP_442866.1_1 Reverse -199 -218 -5.60541 0.243
NP_441464.1_8 Forward -129 -115 5.70279 0.253
NP_441464.1_8 Reverse -247 -261 5.60446 0.253
NP_441464.1_8 Forward -274 -260 4.03116 0.283
NP_441464.1_8 Reverse -352 -366 4.03116 0.283
NP_441464.1_10 Forward -374 -360 10.1277 0.262
NP_442386.1_2 Forward -61 -42 16.5025 0.102
NP_442386.1_9 Reverse -83 -92 4.52254 0.297
NP_440570.1_5 Forward -73 -54 -0.983855 0.266
NP_441340.1_5 Forward -92 -85 13.5105 0.0314
NP_441340.1_5 Forward -273 -266 6.13563 0.175
NP_441340.1_5 Reverse -266 -273 5.93897 0.198
NP_441340.1_5 Reverse -85 -92 5.84064 0.208
NP_442484.1_2 Forward -104 -85 3.14605 0.21
NP_440161.1_3 Forward -95 -76 9.73422 0.238
NP_440161.1_3 Reverse -263 -282 9.24257 0.251
NP_440586.1_8 Forward -273 -266 11.4451 0.0645
NP_440586.1_8 Reverse -85 -92 9.47853 0.146
NP_440586.1_8 Forward -92 -85 5.74197 0.283
NP_442251.1_6 Reverse -266 -273 12.0355 0.0627
NP_440684.1_9 Forward -363 -349 6.6861 0.294
NP_441262.1_3 Forward -274 -267 14.7888 0.0223
NP_441262.1_3 Forward -93 -86 14.7888 0.0223
NP_443051.1_1 Forward -275 -266 9.93116 0.0146
NP_443051.1_1 Reverse -264 -273 8.35786 0.0371
NP_443051.1_1 Forward -94 -85 7.47288 0.0571
NP_443051.1_1 Reverse -83 -92 -1.18024 0.297
NP_439937.1_9 Forward -209 -192 -10.4832 0.229
NP_440439.1_1 Forward -277 -264 10.5407 0.0365
NP_440439.1_1 Forward -96 -83 2.96921 0.122
NP_440439.1_1 Forward -211 -198 1.39592 0.156
NP_440372.1_2 Forward -92 -85 13.8055 0.0214
NP_440372.1_2 Forward -273 -266 6.72562 0.0929
NP_440372.1_2 Reverse -266 -273 6.62729 0.151
NP_440372.1_2 Reverse -85 -92 6.52896 0.188
NP_442285.1_8 Reverse -57 -76 17.1082 0.247
NP_440819.1_5 Reverse -326 -334 7.8859 0.266
NP_441803.1_2 Forward -111 -92 1.86774 0.223
NP_441572.1_3 Reverse -200 -219 11.8975 0.185
NP_441572.1_7 Reverse -193 -212 3.14605 0.119
NP_441572.1_7 Reverse -91 -110 0.687771 0.162
NP_440267.1_2 Reverse -67 -81 5.01387 0.285
NP_442384.1_10 Reverse -265 -278 13.589 0.0195
NP_442384.1_10 Reverse -84 -97 10.344 0.0461
NP_442384.1_10 Reverse -199 -212 6.1158 0.11
NP_441018.1_7 Forward -139 -120 7.07928 0.277
NP_442790.1_4 Reverse -256 -275 -8.06369 0.164
NP_442790.1_4 Forward -102 -83 -14.3569 0.274
NP_442790.1_4 Forward -177 -158 -15.5368 0.294
NP_442262.1_10 Reverse -85 -92 13.2155 0.0213
NP_441689.1_5 Reverse -157 -167 5.38779 0.265
NP_440344.1_10 Reverse -77 -94 -1.92778 0.0588
NP_440531.1_6 Forward -282 -263 13.9625 0.0397
NP_442910.1_1 Reverse -77 -96 -4.72043 0.254
NP_440297.1_9 Reverse -205 -215 9.51814 0.0917
NP_440297.1_9 Forward -273 -263 -0.216628 0.282
NP_440297.1_9 Forward -207 -197 -0.216628 0.282
NP_440350.1_5 Forward -157 -138 -1.96717 0.215
NP_442187.1_3 Forward -94 -84 15.6147 0.105
NP_441592.1_4 Reverse -120 -139 -0.000545616 0.237
NP_441103.1_2 Forward -104 -86 8.86816 0.178
NP_440700.1_8 Reverse -328 -342 10.4227 0.292
NP_440894.1_10 Forward -323 -304 5.11266 0.238
NP_441894.1_1 Forward -201 -182 -5.01543 0.258
NP_440999.1_9 Forward -250 -236 -1.96703 0.254
NP_440888.1_2 Reverse -84 -98 15.8302 0.00862
NP_440888.1_2 Forward -396 -382 6.0955 0.249
NP_440600.1_4 Reverse -257 -275 1.19912 0.128
NP_442277.1_7 Reverse -137 -153 -2.09402 0.297
NP_441123.1_4 Reverse -84 -98 20.1568 0.0308
NP_440575.1_1 Forward -315 -296 -3.54122 0.294
NP_442512.1_4 Reverse -222 -240 6.01734 0.291
NP_441543.1_2 Reverse -85 -94 7.07956 0.131
NP_441543.1_2 Reverse -266 -275 6.19458 0.153
NP_442845.1_2 Forward -168 -154 5.50613 0.231
NP_441469.1_8 Reverse -198 -207 10.1278 0.227
NP_443064.1_6 Reverse -265 -275 9.75513 0.199
NP_442578.1_7 Forward -92 -85 6.0373 0.18
NP_442578.1_7 Forward -273 -266 5.93897 0.183
NP_440710.1_1 Forward -282 -264 -6.56903 0.225
NP_440710.1_1 Forward -216 -198 -9.22396 0.296
NP_441462.1_2 Forward -93 -83 16.1063 0.00406
NP_441462.1_2 Forward -274 -264 10.6981 0.00625
NP_441462.1_2 Reverse -265 -275 10.5014 0.00824
NP_443062.1_1 Reverse -199 -217 4.35311 0.264
NP_440277.1_4 Reverse -103 -122 14.8474 0.191
NP_442204.1_1 Forward -278 -267 11.2684 0.0565
NP_442204.1_1 Forward -97 -86 9.79344 0.0736
NP_441560.1_6 Reverse -199 -218 14.5524 0.241
NP_441560.1_10 Forward -189 -170 9.0459 0.235
NP_441560.1_10 Reverse -257 -276 5.01433 0.298
NP_442872.1_1 Forward -114 -95 -11.8986 0.252
NP_440516.1_6 Forward -312 -298 14.1586 0.188
NP_440516.1_8 Forward -93 -84 18.9776 0.00442
NP_440516.1_8 Forward -274 -265 15.6344 0.00582
NP_440516.1_8 Reverse -265 -274 7.47288 0.0581
NP_440516.1_8 Reverse -84 -93 5.01461 0.118
NP_442428.1_5 Reverse -266 -273 6.13563 0.209
NP_442428.1_5 Forward -92 -85 6.13563 0.209
NP_442428.1_5 Forward -273 -266 6.0373 0.212
NP_442428.1_5 Reverse -85 -92 6.0373 0.212
NP_441443.1_2 Forward -266 -247 -6.98204 0.295
NP_442120.1_10 Forward -383 -364 -11.0136 0.262
NP_441416.1_1 Forward -383 -369 18.0088 0.282
NP_440673.1_3 Reverse -267 -274 12.4288 0.0426
NP_440673.1_3 Reverse -86 -93 12.4288 0.0426
NP_441714.1_2 Reverse -212 -230 10.4422 0.277
NP_441052.1_2 Reverse -84 -94 10.6981 0.0285
NP_441052.1_2 Forward -274 -264 0.766681 0.256
NP_441052.1_2 Reverse -265 -275 0.668351 0.256
NP_442219.1_8 Reverse -44 -63 8.36037 0.249
NP_442219.1_9 Reverse -85 -94 7.96454 0.0696
NP_440436.1_4 Forward -273 -264 12.684 0.034
NP_440436.1_4 Reverse -85 -94 7.57079 0.124
NP_440436.1_4 Reverse -266 -275 5.9975 0.174
NP_442907.1_9 Reverse -194 -213 -5.50708 0.284
NP_441719.1_4 Forward -92 -85 6.82395 0.0855
NP_441719.1_4 Forward -273 -266 6.72562 0.093
NP_441719.1_4 Reverse -266 -273 6.62729 0.151
NP_441719.1_4 Reverse -85 -92 6.52896 0.188
NP_441004.1_1 Reverse -107 -126 -17.9951 0.296
NP_442694.1_4 Reverse -216 -225 12.9794 0.225
NP_442854.1_6 Forward -213 -194 8.35759 0.229
NP_440328.1_4 Forward -99 -80 2.55606 0.199
NP_441851.1_10 Reverse -264 -274 7.74818 0.132
NP_441851.1_10 Reverse -198 -208 4.89658 0.24
NP_442622.1_8 Forward -274 -256 -19.0571 0.296
NP_441542.1_4 Reverse -107 -121 4.91614 0.264
NP_441668.1_4 Reverse -74 -93 -0.39387 0.252
NP_442515.1_1 Forward -275 -261 -3.54032 0.292
NP_442515.1_1 Reverse -8 -22 -3.93365 0.298
NP_441396.1_5 Forward -371 -362 8.35786 0.224
NP_441349.1_10 Reverse -74 -93 -8.65367 0.278
NP_440432.1_9 Forward -273 -258 9.02635 0.0427
NP_440432.1_9 Reverse -266 -281 -4.54333 0.211
NP_439960.1_2 Forward -99 -80 16.2241 0.112
NP_440396.1_1 Reverse -336 -355 -0.000545616 0.196
NP_442450.1_5 Reverse -82 -92 8.23984 0.13
NP_442450.1_5 Reverse -263 -273 8.04317 0.13
NP_442450.1_5 Forward -215 -205 4.99491 0.271
NP_442006.1_2 Reverse -111 -128 -17.3657 0.274
NP_442243.1_1 Forward -99 -81 6.21323 0.178
NP_441570.1_1 Reverse -265 -283 -6.76569 0.0818
NP_441570.1_1 Forward -274 -256 -16.6971 0.252
NP_441078.1_4 Reverse -265 -274 9.93116 0.0203
NP_441078.1_4 Forward -274 -265 9.83282 0.0226
NP_441078.1_4 Reverse -199 -208 5.11294 0.118
NP_441078.1_4 Forward -93 -84 0.196389 0.205
NP_441078.1_4 Reverse -84 -93 -0.000272808 0.205
NP_442348.1_2 Reverse -215 -224 7.37455 0.28
NP_442443.1_1 Reverse -274 -293 4.62101 0.157
NP_442443.1_1 Reverse -69 -88 -4.72043 0.276
NP_440526.1_3 Forward -273 -262 0.156538 0.297
NP_441432.1_8 Forward -94 -85 14.0611 0.0258
NP_441432.1_8 Forward -275 -266 7.17789 0.102
NP_441732.1_2 Reverse -80 -96 -17.5427 0.27
NP_441030.1_6 Reverse -82 -101 14.8731 0.184
NP_442003.1_4 Reverse -85 -104 9.83255 0.299
NP_440760.1_1 Reverse -265 -284 -21.4367 0.237
NP_442797.1_1 Forward -397 -378 -0.000545616 0.223
NP_441805.1_1 Reverse -134 -153 -5.99873 0.3
NP_442510.1_3 Reverse -75 -94 13.9625 0.245
NP_442510.1_8 Reverse -263 -282 18.4857 0.255
NP_441023.1_1 Reverse -265 -283 11.8189 0.237
NP_440713.1_4 Forward -284 -265 1.76941 0.279
NP_442489.1_7 Reverse -265 -274 10.6195 0.00984
NP_442489.1_7 Forward -274 -265 10.3245 0.0193
NP_442489.1_7 Forward -93 -84 0.688044 0.152
NP_442489.1_7 Reverse -84 -93 0.688044 0.152
NP_442489.1_7 Reverse -199 -208 -1.6719 0.235
NP_442079.1_7 Forward -92 -73 1.76941 0.241
NP_440559.1_1 Forward -273 -264 7.86621 0.0856
NP_440559.1_1 Reverse -85 -94 7.76787 0.0918
NP_440559.1_1 Forward -92 -83 6.39124 0.134
NP_440559.1_1 Reverse -266 -275 5.40793 0.14
NP_441659.2_8 Forward -274 -264 16.008 0.0042
NP_441659.2_8 Reverse -265 -275 11.3864 0.0184
NP_441659.2_8 Reverse -84 -94 5.48657 0.106
NP_441659.2_8 Forward -93 -83 0.275027 0.27
NP_442913.1_10 Reverse -111 -130 -5.80207 0.279
NP_441040.1_2 Forward -101 -82 -13.7669 0.284
NP_442008.1_2 Reverse -81 -100 6.29264 0.223
NP_442776.1_1 Forward -219 -200 7.27595 0.209
NP_442346.1_5 Forward -275 -265 14.9263 0.00941
NP_442346.1_5 Reverse -264 -274 8.23984 0.143
NP_442346.1_5 Forward -214 -204 5.38824 0.248
NP_442346.1_5 Reverse -83 -93 4.3066 0.291
NP_440545.1_1 Forward -210 -192 23.5203 0.0331
NP_440545.1_3 Reverse -261 -278 1.8088 0.112
NP_440545.1_3 Reverse -200 -217 0.530496 0.137
NP_440545.1_3 Reverse -80 -97 -5.86102 0.262
NP_440545.1_3 Reverse -195 -212 -6.746 0.287
NP_440545.1_3 Forward -217 -200 -7.04099 0.295
NP_441856.1_3 Reverse -262 -281 3.14605 0.186
NP_440831.1_1 Reverse -198 -217 17.7974 0.198
NP_440486.1_6 Reverse -106 -125 11.8975 0.207
NP_440459.1_2 Reverse -82 -99 10.3636 0.2
NP_442603.1_7 Reverse -84 -98 16.7152 0.0291
NP_441585.1_5 Reverse -66 -85 7.17681 0.211
NP_441948.1_4 Reverse -258 -276 -3.6191 0.201
NP_441047.1_1 Forward -397 -378 7.27595 0.189
NP_441047.1_2 Reverse -232 -251 -3.63879 0.298
NP_440170.1_2 Forward -105 -86 4.22769 0.296
NP_441833.1_4 Reverse -266 -273 14.1004 0.0258
NP_441833.1_4 Reverse -85 -92 6.52896 0.0924
NP_441833.1_4 Forward -92 -85 6.23397 0.163
NP_441833.1_4 Forward -273 -266 6.13563 0.198
NP_441895.1_2 Reverse -362 -381 -18.0934 0.234
NP_441895.1_10 Reverse -323 -342 -27.7299 0.29
NP_442162.1_9 Forward -92 -85 12.9205 0.0282
NP_442162.1_9 Reverse -85 -92 12.9205 0.0282
NP_442162.1_9 Reverse -266 -273 6.62729 0.142
NP_442162.1_9 Forward -273 -266 6.52896 0.178
NP_440224.1_1 Forward -173 -154 -4.13045 0.29
NP_442073.1_6 Reverse -75 -94 1.67108 0.25
NP_442140.1_3 Forward -273 -263 12.0747 0.0664
NP_442140.1_3 Reverse -85 -95 8.23984 0.122
NP_442140.1_3 Forward -92 -82 6.07655 0.184
NP_442723.1_1 Forward -338 -319 12.88 0.238
NP_440875.1_9 Reverse -267 -277 16.5483 0.0145
NP_440875.1_9 Forward -211 -201 10.1241 0.231
NP_441813.1_5 Forward -95 -85 8.4365 0.0432
NP_441813.1_5 Forward -276 -266 8.33817 0.047
NP_441813.1_5 Reverse -82 -92 5.68323 0.113
NP_441813.1_5 Reverse -263 -273 -0.708283 0.272
NP_440590.1_4 Reverse -85 -98 11.7207 0.0187
NP_442497.1_10 Forward -273 -264 10.0295 0.0222
NP_442497.1_10 Reverse -266 -275 7.86621 0.0695
NP_442497.1_10 Forward -92 -83 1.08137 0.115
NP_442497.1_10 Reverse -85 -94 0.589713 0.153
NP_440821.1_4 Reverse -263 -273 1.25834 0.139
NP_440821.1_4 Forward -95 -85 -0.314959 0.251
NP_441239.1_9 Reverse -202 -214 17.5419 0.0146
NP_441239.1_9 Reverse -82 -94 9.18376 0.113
NP_441239.1_9 Forward -276 -264 6.72548 0.178
NP_441239.1_9 Forward -210 -198 3.48056 0.285
NP_441239.1_9 Reverse -247 -259 3.2839 0.289
NP_441951.1_4 Reverse -84 -103 0.294447 0.297
NP_441009.1_4 Forward -208 -189 10.2259 0.276
NP_441727.1_3 Reverse -77 -96 7.96426 0.213
NP_440400.1_1 Forward -112 -93 -1.67294 0.285
NP_441892.1_1 Reverse -256 -273 4.95539 0.105
NP_441892.1_1 Forward -108 -91 -3.50107 0.242
NP_442193.1_8 Reverse -196 -215 10.2251 0.286
NP_440833.1_6 Forward -292 -278 10.1271 0.255
NP_442216.1_4 Forward -79 -71 8.1805 0.255
NP_440949.1_10 Forward -353 -334 15.8299 0.165
NP_440354.1_7 Forward -280 -262 7.98396 0.256
NP_442138.1_10 Reverse -265 -284 0.0977854 0.142
NP_441782.1_5 Forward -282 -263 23.1072 0.0195
NP_442809.1_1 Forward -310 -291 11.2084 0.295
NP_440546.1_4 Forward -93 -83 14.9908 0.0459
NP_440546.1_4 Forward -274 -264 10.8217 0.104
NP_440462.1_6 Forward -276 -266 9.12481 0.0498
NP_440868.1_4 Forward -97 -85 8.00379 0.0602
NP_440868.1_4 Forward -278 -266 7.4138 0.0691
NP_440401.1_9 Reverse -360 -367 14.5917 0.287
NP_442479.1_9 Forward -53 -34 -8.94866 0.266
NP_441474.1_1 Forward -284 -265 -0.00131823 0.255
NP_440812.1_10 Reverse -284 -297 11.9173 0.259
NP_442402.1_4 Forward -306 -287 -10.326 0.299
NP_441848.1_4 Reverse -322 -338 8.98304 0.288
NP_441848.1_7 Forward -340 -321 -3.54122 0.284
NP_440653.1_10 Forward -219 -200 6.4893 0.208
NP_440696.1_3 Reverse -200 -218 0.0191479 0.237
NP_442039.1_4 Forward -92 -85 11.6422 0.0747
NP_442039.1_10 Forward -127 -109 10.2448 0.293
NP_442837.1_3 Reverse -266 -273 6.13563 0.25
NP_442837.1_3 Forward -92 -85 6.0373 0.25
NP_442837.1_3 Reverse -85 -92 6.0373 0.25
NP_442837.1_3 Forward -273 -266 5.93897 0.265
NP_442053.1_1 Reverse -84 -93 14.4544 0.0114
NP_442053.1_1 Reverse -265 -274 9.34117 0.0666
NP_442053.1_1 Forward -274 -265 8.55452 0.0784
NP_442053.1_1 Forward -93 -84 7.86621 0.0863
NP_440505.1_3 Forward -95 -85 16.7946 0.00614
NP_440505.1_3 Forward -276 -266 15.9097 0.00857
NP_440351.1_8 Reverse -322 -340 5.23069 0.282
NP_441701.1_3 Forward -91 -74 8.59364 0.247
NP_442456.1_5 Reverse -99 -117 11.2289 0.26
NP_442174.1_9 Forward -194 -175 6.19431 0.29
NP_440914.1_1 Reverse -265 -275 14.7634 0.00997
NP_440914.1_1 Reverse -84 -94 13.1043 0.0386
NP_441011.1_8 Forward -92 -83 9.24284 0.131
NP_441011.1_8 Reverse -266 -275 6.8829 0.18
NP_442101.1_10 Forward -282 -263 -13.3736 0.29
NP_442533.1_1 Reverse -378 -397 1.37609 0.118
NP_442533.1_1 Reverse -104 -123 -17.7001 0.293
NP_442533.1_6 Reverse -265 -274 7.66954 0.0897
NP_442533.1_6 Forward -274 -265 7.37455 0.0898
NP_442533.1_6 Reverse -199 -208 5.80125 0.128
NP_442533.1_6 Forward -213 -204 4.52295 0.179
NP_442533.1_6 Forward -129 -120 4.52295 0.179
NP_442533.1_6 Reverse -84 -93 4.42462 0.179
NP_442541.1_10 Forward -219 -205 2.16228 0.265
NP_442232.1_3 Reverse -191 -210 -15.7335 0.296
NP_442322.1_4 Forward -292 -275 -8.31994 0.286
NP_443016.1_1 Reverse -259 -278 -2.0655 0.223
NP_441482.1_7 Forward -99 -85 -10.2268 0.209
NP_439944.1_9 Forward -273 -263 6.8632 0.165
NP_440816.1_7 Forward -278 -259 11.2092 0.218
NP_441028.1_6 Forward -308 -298 7.15773 0.23
NP_441028.1_6 Forward -400 -390 6.0761 0.232
NP_441028.1_6 Forward -127 -117 5.68278 0.243
NP_440116.1_5 Forward -96 -79 2.30045 0.276
NP_440116.1_8 Forward -92 -73 -8.45701 0.253
NP_440115.1_6 Forward -96 -86 15.0247 0.0505
NP_440115.1_6 Forward -277 -267 14.0414 0.0615
NP_440007.1_9 Forward -217 -203 4.42448 0.267
NP_440007.1_9 Reverse -195 -209 2.75286 0.277
NP_441106.1_1 Forward -275 -266 8.65285 0.0522
NP_441106.1_1 Reverse -264 -273 6.39124 0.0899
NP_439903.1_6 Forward -277 -258 -0.984623 0.289
NP_442306.1_10 Forward -279 -260 -2.36049 0.0769
NP_441286.1_1 Forward -94 -82 5.05386 0.0259
NP_441286.1_1 Forward -275 -263 3.48056 0.0467
NP_440670.1_8 Reverse -265 -274 16.5193 0.00214
NP_440670.1_8 Forward -274 -265 9.4395 0.0559
NP_440670.1_8 Forward -93 -84 8.75118 0.0606
NP_440670.1_8 Reverse -84 -93 6.19458 0.124
NP_440886.1_7 Reverse -83 -93 6.76441 0.114
NP_440886.1_7 Forward -275 -265 4.10949 0.253
NP_442614.1_2 Reverse -119 -133 6.98109 0.276
NP_442614.1_2 Reverse -247 -261 6.29277 0.291
NP_442072.1_9 Forward -214 -196 -21.417 0.208
NP_442072.1_9 Reverse -83 -101 -23.482 0.297
NP_440907.2_8 Forward -273 -263 6.56775 0.161
NP_441021.1_1 Reverse -85 -104 -8.26035 0.194
NP_442459.1_7 Forward -245 -226 -0.39387 0.273
NP_441463.1_3 Reverse -74 -93 -6.49039 0.246
NP_442842.1_4 Reverse -205 -224 1.37609 0.29
NP_441626.1_2 Forward -92 -85 12.2322 0.0511
NP_441626.1_2 Forward -273 -266 6.0373 0.212
NP_441626.1_2 Reverse -266 -273 6.0373 0.212
NP_441626.1_2 Reverse -85 -92 5.93897 0.231
NP_440107.1_5 Forward -169 -150 -6.88371 0.272
NP_441431.1_2 Forward -277 -263 7.3738 0.244
NP_441431.1_2 Forward -96 -82 6.68548 0.263
NP_441488.1_8 Forward -98 -84 17.5018 0.0865
NP_440467.1_3 Reverse -91 -110 12.9165 0.214
NP_441510.2_9 Reverse -266 -285 8.55425 0.165
NP_440287.1_5 Forward -297 -278 10.0284 0.286
NP_440293.1_3 Reverse -181 -200 5.80098 0.192
NP_440293.1_9 Reverse -199 -213 9.50821 0.285
NP_440766.1_4 Forward -97 -83 10.3243 0.0871
NP_441237.1_9 Forward -92 -82 14.0414 0.0535
NP_441237.1_9 Forward -273 -263 13.1564 0.0927
NP_439910.1_2 Reverse -145 -162 -14.5141 0.183
NP_440457.1_1 Forward -97 -85 10.4621 0.092
NP_440457.1_1 Reverse -195 -207 -1.23932 0.3
NP_440798.1_6 Forward -92 -79 1.39592 0.217
NP_441984.1_6 Forward -264 -252 17.5419 0.145
NP_441332.1_6 Forward -396 -386 13.583 0.184
NP_441436.1_2 Reverse -87 -106 -3.14714 0.28
NP_442509.1_9 Forward -93 -83 13.1559 0.061
NP_442509.1_9 Reverse -265 -275 7.94438 0.195
NP_442509.1_9 Forward -274 -264 7.74772 0.205
NP_442509.1_9 Reverse -159 -169 7.15773 0.234
NP_442514.1_5 Reverse -76 -95 -4.81951 0.249
NP_442514.1_5 Forward -204 -185 -8.06442 0.284
NP_441610.1_2 Forward -105 -86 7.96426 0.186
NP_440554.1_4 Reverse -266 -276 8.4365 0.0749
NP_440554.1_4 Reverse -85 -95 5.97822 0.128
NP_441885.1_5 Forward -274 -264 1.84832 0.0957
NP_441885.1_5 Reverse -265 -275 1.65166 0.106
NP_441885.1_5 Reverse -84 -94 1.25834 0.11
NP_441885.1_5 Forward -93 -83 -0.0199663 0.186
NP_442341.1_7 Forward -169 -155 10.816 0.0596
NP_442341.1_7 Forward -107 -93 7.27608 0.109
NP_442341.1_9 Forward -95 -81 13.8636 0.0744
NP_442341.1_9 Forward -210 -196 11.4053 0.127
NP_442341.1_9 Forward -276 -262 4.52221 0.299
NP_441756.1_5 Reverse -80 -99 -5.01543 0.298
NP_441173.1_9 Forward -400 -392 11.3271 0.226
NP_443000.1_7 Forward -276 -266 10.5014 0.0345
NP_443000.1_7 Forward -95 -85 10.2065 0.0355
NP_441561.1_7 Forward -295 -276 6.09517 0.274
NP_440275.1_3 Forward -95 -85 12.5664 0.0316
NP_440275.1_3 Reverse -263 -273 7.05986 0.0901
NP_440275.1_3 Forward -276 -266 6.46988 0.105
NP_442275.1_1 Forward -207 -188 -0.000545616 0.295
NP_442451.1_2 Forward -298 -279 -8.85033 0.254
NP_442451.1_2 Forward -101 -82 -9.24366 0.259
NP_441207.1_7 Reverse -140 -154 8.19046 0.293
NP_439962.1_4 Reverse -249 -268 -8.94866 0.298
NP_440175.1_7 Reverse -206 -224 8.77756 0.288
NP_440149.1_8 Reverse -84 -103 -3.24547 0.185
NP_440216.1_1 Reverse -84 -98 -1.8687 0.0412
NP_440216.1_1 Reverse -265 -279 -2.06536 0.0458
NP_440216.1_1 Forward -274 -260 -4.4253 0.111
NP_440216.1_9 Reverse -232 -241 8.75118 0.286
NP_440216.1_9 Forward -195 -186 6.68623 0.289
NP_440172.1_1 Reverse -265 -275 8.04317 0.0692
NP_440172.1_1 Forward -93 -83 7.55152 0.0761
NP_440172.1_1 Forward -274 -264 6.46988 0.103
NP_440172.1_1 Reverse -84 -94 2.24165 0.279
NP_440046.1_7 Reverse -30 -49 8.55425 0.297
NP_442015.1_10 Forward -97 -84 2.2809 0.196
NP_442015.1_10 Reverse -80 -93 1.39592 0.204
NP_442015.1_10 Forward -278 -265 0.805932 0.218
NP_441045.1_4 Reverse -285 -304 11.4058 0.274
NP_441226.1_7 Forward -92 -85 12.7234 0.0312
NP_441226.1_7 Reverse -85 -92 11.5435 0.0757
NP_441757.1_3 Forward -275 -256 -1.47551 0.249
NP_441111.1_7 Reverse -266 -274 8.96754 0.0463
NP_441111.1_7 Forward -273 -265 8.86921 0.0589
NP_441111.1_7 Reverse -85 -93 8.86921 0.0589
NP_442379.1_10 Forward -215 -198 -0.944468 0.223
NP_442379.1_10 Reverse -197 -214 -2.71443 0.242
NP_441766.1_2 Reverse -84 -93 14.7494 0.00772
NP_441766.1_2 Reverse -265 -274 7.86621 0.0703
NP_441766.1_2 Forward -274 -265 7.66954 0.0723
NP_440416.1_9 Reverse -192 -211 -17.6018 0.243
NP_440416.1_9 Forward -100 -81 -20.0601 0.281
NP_443052.1_9 Forward -400 -381 -0.590531 0.213
NP_443052.1_9 Forward -397 -378 -2.95047 0.244
NP_442154.1_1 Reverse -334 -352 -15.8121 0.225
NP_442564.1_9 Forward -213 -199 13.7354 0.275
NP_440261.1_5 Reverse -266 -279 4.54251 0.0567
NP_440261.1_5 Reverse -85 -98 -4.60227 0.158
NP_440261.1_5 Reverse -205 -218 -12.2721 0.277
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTCCCCCAGTCCCACTAGAATCAGCTTTTTGATTGGGGTTTTACTGCCCACCCGAGACACCAACTTTTGTCCCGCTTTACCCTTAAACTCCTTTTCCTCAATCAGTTCCCGCAATACCCCTTCCAGGCGATCGTCCAATTGGGTCAGGTCCCCAGTAATTTCCGTTGCATTTTCAAAAAATCCCAGGGCCAGGGCATCTCCCTGCCAAGTCAAAGCTGTGTAGTCGGTTCCGCGGATCTGCATCGCTGTTTGTTTTTCTGTTGAGGGACTGTCCGTCCCCCATTTTGCCACACTCCCATAACCGCTGGCGATCGGGCAGTTAATGCCCCGGTTTATGGATTTGTCCAAAGAGCTTGTCAAGGTTGATACTTCTTGGTATGTTGTTAATGCGCTAAAAAA

CDS

No sequence available

Protein

No sequence available