Your browser is old and dusty. Try Google Chrome!

Details for 6803t15

ORF 6803t15
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -259 -273 0.196253 0.215
NP_441061.1_3 Forward -195 -176 18.9765 0.0783
NP_440795.1_7 Forward -160 -153 11.7405 0.0778
NP_441418.1_6 Forward -267 -248 -8.55534 0.0273
NP_441418.1_6 Reverse -258 -277 -22.3217 0.175
NP_440897.1_6 Reverse -46 -65 -2.8529 0.225
NP_441453.1_1 Reverse -28 -46 6.70489 0.227
NP_441453.1_4 Forward -267 -259 6.80426 0.121
NP_441453.1_4 Forward -44 -36 6.80426 0.121
NP_441453.1_4 Reverse -35 -43 6.11594 0.121
NP_441453.1_4 Reverse -152 -160 4.73931 0.252
NP_441453.1_7 Reverse -231 -238 11.9372 0.298
NP_441453.1_7 Reverse -217 -224 11.6422 0.298
NP_441818.1_9 Reverse -207 -226 -9.14533 0.287
NP_440226.1_1 Forward -44 -25 5.99764 0.139
NP_442744.1_8 Reverse -230 -249 0.196116 0.235
NP_442173.1_1 Reverse -36 -44 12.0158 0.0316
NP_442173.1_1 Reverse -259 -267 5.72262 0.203
NP_442173.1_1 Forward -43 -35 4.83764 0.241
NP_442752.1_4 Forward -267 -260 13.8055 0.0199
NP_442752.1_4 Forward -44 -37 13.8055 0.0199
NP_443027.1_4 Forward -269 -259 10.9931 0.109
NP_443027.1_4 Reverse -309 -319 5.87989 0.294
NP_440784.1_7 Forward -266 -259 6.23397 0.241
NP_440784.1_7 Forward -43 -36 6.23397 0.241
NP_440784.1_7 Reverse -259 -266 6.13563 0.241
NP_440784.1_7 Reverse -36 -43 6.13563 0.241
NP_440061.1_9 Reverse -33 -47 9.24208 0.149
NP_440061.1_9 Reverse -244 -258 5.99717 0.264
NP_441054.1_2 Forward -87 -68 9.14423 0.299
NP_440878.1_4 Reverse -277 -295 12.9005 0.277
NP_442062.1_8 Forward -267 -257 8.73149 0.0721
NP_442242.1_4 Reverse -259 -266 10.8555 0.127
NP_440011.1_1 Reverse -39 -58 13.9625 0.228
NP_441935.1_1 Reverse -216 -235 7.27595 0.243
NP_442196.1_9 Reverse -180 -193 15.5556 0.297
NP_440518.1_9 Forward -80 -61 10.2259 0.293
NP_441925.1_4 Reverse -248 -267 -5.90115 0.184
NP_441083.1_3 Forward -127 -117 12.6642 0.248
NP_441083.1_5 Reverse -35 -45 17.7779 0.00336
NP_441083.1_5 Reverse -258 -268 0.766681 0.218
NP_441083.1_5 Forward -44 -34 -0.904945 0.283
NP_442827.1_8 Reverse -250 -269 -2.55791 0.282
NP_441738.1_2 Reverse -260 -267 15.28 0.0102
NP_441738.1_2 Reverse -37 -44 15.28 0.0102
NP_441558.1_5 Forward -46 -27 10.1275 0.105
NP_441955.1_8 Forward -273 -256 15.8701 0.163
NP_440209.1_1 Reverse -258 -266 11.9175 0.0184
NP_440209.1_1 Forward -267 -259 8.57422 0.0425
NP_440209.1_1 Forward -44 -36 8.57422 0.0425
NP_440209.1_1 Reverse -35 -43 5.52596 0.0821
NP_441444.1_1 Reverse -195 -214 18.289 0.0691
NP_442136.1_4 Forward -42 -23 14.3549 0.195
NP_441770.1_4 Reverse -217 -236 -3.73712 0.204
NP_441716.1_1 Reverse -107 -121 4.52282 0.255
NP_441327.1_5 Reverse -130 -139 14.356 0.192
NP_442111.1_4 Reverse -34 -48 5.21113 0.172
NP_442111.1_4 Reverse -257 -271 2.2612 0.283
NP_442111.1_4 Forward -268 -254 2.16287 0.286
NP_441163.1_9 Reverse -26 -45 15.6341 0.206
NP_440851.1_6 Reverse -220 -237 7.41366 0.263
NP_440906.1_5 Reverse -153 -160 9.47889 0.116
NP_440906.1_5 Forward -266 -259 6.23397 0.234
NP_440906.1_5 Forward -43 -36 6.23397 0.234
NP_440906.1_5 Reverse -259 -266 6.13563 0.241
NP_440906.1_5 Reverse -36 -43 6.13563 0.241
NP_440747.1_10 Forward -47 -35 7.11881 0.00789
NP_440747.1_10 Reverse -255 -267 -2.61596 0.0556
NP_440747.1_10 Forward -270 -258 -11.7607 0.142
NP_440747.1_10 Reverse -32 -44 -12.4491 0.282
NP_441130.1_10 Reverse -33 -47 7.47274 0.158
NP_442848.1_1 Forward -273 -259 -1.77037 0.263
NP_441012.1_4 Reverse -260 -273 10.1474 0.266
NP_439978.1_1 Forward -21 -5 8.12167 0.297
NP_443018.1_3 Forward -266 -259 12.6255 0.0471
NP_443018.1_3 Reverse -36 -43 11.7405 0.0655
NP_443018.1_3 Forward -43 -36 5.44732 0.193
NP_443018.1_3 Reverse -259 -266 5.25066 0.214
NP_441634.1_8 Forward -46 -32 -2.95034 0.295
NP_441182.1_3 Reverse -217 -235 12.9005 0.256
NP_440376.1_1 Forward -44 -35 5.99792 0.111
NP_440376.1_1 Reverse -46 -55 2.06468 0.236
NP_440376.1_1 Reverse -223 -232 1.86802 0.238
NP_440376.1_1 Forward -267 -258 0.0980582 0.285
NP_440376.1_1 Reverse -258 -267 -0.196935 0.285
NP_440376.1_1 Reverse -35 -44 -0.196935 0.285
NP_442191.1_4 Reverse -211 -225 11.3809 0.262
NP_441846.1_10 Forward -267 -248 -14.7502 0.238
NP_441846.1_10 Forward -266 -247 -19.9617 0.256
NP_441846.1_10 Forward -268 -249 -21.24 0.256
NP_441846.1_10 Forward -45 -26 -22.9117 0.271
NP_442958.1_3 Forward -55 -36 7.47261 0.156
NP_442583.1_8 Reverse -247 -266 15.1424 0.141
NP_441013.1_2 Reverse -253 -271 -1.35749 0.282
NP_441422.1_7 Reverse -33 -50 8.00365 0.0992
NP_441422.1_7 Reverse -256 -273 -1.0428 0.178
NP_441950.1_7 Reverse -218 -237 0.884433 0.179
NP_440360.1_10 Reverse -248 -262 3.24451 0.239
NP_440236.1_2 Forward -399 -381 5.72234 0.15
NP_442658.1_1 Forward -269 -259 6.17443 0.235
NP_442658.1_1 Forward -234 -224 5.38779 0.269
NP_442658.1_1 Reverse -256 -266 5.28945 0.274
NP_442658.1_1 Reverse -33 -43 5.28945 0.274
NP_442658.1_9 Forward -88 -69 11.7992 0.286
NP_442782.1_2 Reverse -177 -191 5.1128 0.247
NP_442782.1_2 Forward -267 -253 5.01447 0.249
NP_442782.1_2 Forward -191 -177 1.17956 0.282
NP_441414.1_6 Forward -97 -78 4.32602 0.172
NP_441414.1_9 Forward -44 -25 8.55425 0.0271
NP_441414.1_9 Reverse -35 -54 -9.93197 0.272
NP_441487.1_1 Reverse -246 -265 14.0608 0.109
NP_441256.1_1 Reverse -255 -274 -9.83364 0.296
NP_442321.1_4 Forward -242 -223 -3.44213 0.276
NP_441958.1_5 Forward -45 -35 0.865012 0.12
NP_441958.1_5 Forward -268 -258 -6.31315 0.28
NP_441127.1_1 Reverse -123 -137 12.6843 0.206
NP_441127.1_1 Forward -44 -30 8.16106 0.3
NP_440203.1_5 Reverse -6 -16 11.091 0.205
NP_441338.2_5 Reverse -261 -280 1.86774 0.299
NP_442911.1_2 Forward -277 -258 -6.49039 0.184
NP_441580.1_6 Reverse -247 -266 -5.9004 0.235
NP_440153.1_5 Reverse -36 -50 1.57289 0.248
NP_440153.1_8 Reverse -246 -259 5.13249 0.18
NP_443055.1_6 Forward -281 -263 0.805058 0.239
NP_440138.1_1 Reverse -182 -200 5.42659 0.292
NP_442853.1_5 Reverse -184 -203 5.89851 0.287
NP_441099.1_5 Reverse -248 -267 2.16274 0.0581
NP_441099.1_5 Reverse -25 -44 -9.63698 0.229
NP_442002.1_1 Reverse -114 -132 -0.7675 0.192
NP_442002.1_9 Forward -268 -261 10.7572 0.185
NP_441646.1_7 Reverse -351 -365 15.4376 0.243
NP_441456.1_9 Forward -55 -36 18.9773 0.122
NP_441000.1_6 Reverse -34 -48 -4.62196 0.248
NP_440147.1_4 Forward -163 -150 5.91914 0.109
NP_440147.1_4 Forward -46 -33 3.95252 0.175
NP_441175.1_7 Reverse -35 -54 7.07928 0.239
NP_441550.1_8 Forward -46 -36 13.8442 0.0207
NP_441916.1_7 Reverse -258 -268 6.96153 0.0784
NP_441725.1_4 Forward -272 -258 1.96562 0.3
NP_441725.1_5 Reverse -259 -269 1.455 0.135
NP_439966.1_7 Reverse -33 -43 17.6791 0.00636
NP_439966.1_7 Reverse -256 -266 16.4008 0.0112
NP_439966.1_7 Forward -269 -259 8.73102 0.13
NP_439966.1_7 Forward -46 -36 5.58445 0.216
NP_439966.1_9 Forward -269 -260 0.983037 0.253
NP_442941.1_3 Reverse -36 -46 9.41981 0.0319
NP_442941.1_3 Reverse -259 -269 1.65166 0.147
NP_440289.1_2 Reverse -32 -45 0.904263 0.144
NP_440983.1_9 Forward -53 -34 4.42435 0.285
NP_440260.1_7 Reverse -186 -205 3.34271 0.241
NP_440260.1_8 Reverse -221 -239 2.18243 0.182
NP_441678.1_6 Reverse -272 -291 11.9958 0.235
NP_441678.1_9 Forward -55 -36 -0.4922 0.23
NP_442281.1_1 Forward -272 -258 6.98048 0.111
NP_442281.1_1 Reverse -253 -267 1.5723 0.296
NP_442256.1_2 Reverse -33 -51 -8.04399 0.217
NP_001035871.2_7 Reverse -43 -53 13.8447 0.219
NP_440437.1_1 Reverse -252 -271 2.85105 0.127
NP_441087.1_6 Forward -149 -131 -1.75153 0.27
NP_441556.1_10 Reverse -253 -267 10.4165 0.27
NP_440498.1_1 Reverse -249 -267 -2.53746 0.242
NP_441644.1_6 Reverse -35 -45 14.4342 0.0126
NP_443049.1_6 Forward -45 -35 14.4711 0.114
NP_443049.1_6 Forward -268 -258 13.6904 0.149
NP_440867.1_10 Reverse -215 -234 11.9958 0.244
NP_442177.1_5 Reverse -213 -227 11.8976 0.22
NP_442029.1_1 Forward -46 -27 -11.6036 0.229
NP_440929.1_8 Reverse -35 -44 7.07956 0.0713
NP_441346.1_4 Forward -45 -26 19.0757 0.161
NP_442933.1_10 Reverse -258 -267 6.48957 0.119
NP_441751.2_8 Reverse -259 -273 -2.55701 0.132
NP_442554.1_8 Reverse -36 -46 6.37155 0.12
NP_442554.1_8 Reverse -259 -269 4.0116 0.2
NP_442554.1_8 Forward -43 -33 2.24165 0.276
NP_441762.1_7 Forward -268 -256 4.46387 0.0477
NP_441762.1_7 Forward -45 -33 -4.68091 0.181
NP_441762.1_7 Reverse -257 -269 -5.27089 0.195
NP_441762.1_7 Reverse -151 -163 -5.56589 0.217
NP_442142.1_4 Forward -270 -257 12.4084 0.0458
NP_442142.1_4 Reverse -255 -268 11.8184 0.0518
NP_442142.1_4 Forward -47 -34 3.16532 0.265
NP_442292.1_1 Reverse -36 -45 8.65285 0.0335
NP_442292.1_1 Reverse -259 -268 -0.196935 0.239
NP_441865.1_3 Forward -152 -134 14.9655 0.235
NP_441715.1_4 Reverse -36 -46 7.55152 0.108
NP_441715.1_4 Reverse -259 -269 6.46988 0.143
NP_441448.1_1 Reverse -262 -281 3.83436 0.287
NP_441468.1_1 Forward -266 -259 6.13563 0.209
NP_441468.1_1 Forward -43 -36 6.13563 0.209
NP_441468.1_1 Reverse -259 -266 6.0373 0.223
NP_441468.1_1 Reverse -36 -43 6.0373 0.223
NP_441020.2_6 Reverse -43 -60 5.64371 0.293
NP_441015.1_10 Forward -266 -247 -5.01543 0.215
NP_441015.1_10 Forward -272 -253 -10.227 0.283
NP_441673.1_1 Forward -267 -258 1.37636 0.114
NP_441673.1_1 Forward -44 -35 1.37636 0.114
NP_441673.1_1 Reverse -258 -267 1.1797 0.163
NP_441673.1_1 Reverse -35 -44 1.1797 0.163
NP_441826.1_2 Forward -273 -259 8.35772 0.0759
NP_441826.1_2 Forward -50 -36 4.81781 0.0988
NP_441826.1_2 Reverse -252 -266 3.04785 0.115
NP_441826.1_5 Reverse -174 -193 2.45773 0.276
NP_442868.1_6 Forward -46 -36 9.51814 0.0447
NP_442868.1_6 Forward -56 -46 3.12662 0.202
NP_442868.1_6 Reverse -2 -12 2.24165 0.205
NP_442868.1_6 Reverse -256 -266 0.176696 0.247
NP_442868.1_6 Reverse -33 -43 0.176696 0.247
NP_442719.1_2 Reverse -17 -35 -0.473239 0.162
NP_441251.1_6 Reverse -253 -272 11.9958 0.163
NP_441251.1_8 Reverse -124 -137 13.0487 0.254
NP_441056.1_1 Reverse -35 -54 -8.16202 0.282
NP_442227.1_2 Reverse -28 -47 2.26107 0.235
NP_442227.1_2 Reverse -251 -270 -3.93378 0.3
NP_443058.1_9 Reverse -253 -271 11.3272 0.227
NP_442361.1_3 Forward -273 -260 13.4906 0.142
NP_442427.1_8 Reverse -26 -45 5.99764 0.25
NP_441944.1_3 Forward -277 -258 18.879 0.142
NP_442808.1_1 Reverse -34 -44 19.449 0.00201
NP_442808.1_1 Reverse -257 -267 17.5808 0.00507
NP_442808.1_1 Forward -56 -46 2.43787 0.266
NP_440145.1_3 Forward -54 -35 -2.26216 0.166
NP_441906.1_5 Forward -156 -137 8.35677 0.282
NP_442718.1_8 Forward -106 -87 15.4029 0.278
NP_442542.1_2 Reverse -33 -46 8.9674 0.142
NP_442342.1_9 Forward -134 -118 4.68009 0.245
NP_442789.1_4 Reverse -159 -178 -5.99873 0.281
NP_440923.1_4 Forward -349 -330 7.17762 0.143
NP_441878.1_6 Reverse -332 -342 0.275027 0.146
NP_441036.1_8 Forward -268 -258 7.05986 0.21
NP_441036.1_8 Reverse -257 -267 6.07655 0.242
NP_441036.1_8 Reverse -34 -44 6.07655 0.242
NP_441557.1_5 Forward -267 -258 1.08137 0.0794
NP_441557.1_5 Forward -44 -35 1.08137 0.0794
NP_441557.1_5 Reverse -258 -267 0.589713 0.134
NP_441557.1_5 Reverse -35 -44 0.589713 0.134
NP_441445.1_1 Forward -125 -106 -0.0988766 0.286
NP_442066.2_9 Reverse -31 -44 16.8339 0.0421
NP_441433.1_8 Forward -48 -29 8.35759 0.161
NP_442777.1_1 Forward -340 -321 4.12856 0.3
NP_442419.1_2 Reverse -253 -272 6.98095 0.144
NP_441458.1_10 Forward -119 -100 5.40766 0.216
NP_442347.1_2 Reverse -259 -268 10.9145 0.0571
NP_442347.1_2 Reverse -36 -45 10.3245 0.058
NP_442645.1_2 Forward -52 -33 -22.6167 0.292
NP_440547.1_8 Forward -251 -232 13.3725 0.298
NP_442888.1_5 Forward -158 -139 10.5209 0.292
NP_442888.1_7 Forward -257 -238 12.3892 0.281
NP_441633.1_3 Reverse -256 -269 -4.30728 0.191
NP_440136.1_2 Forward -266 -259 6.23397 0.171
NP_440136.1_2 Forward -43 -36 6.23397 0.171
NP_440136.1_2 Reverse -259 -266 6.13563 0.193
NP_440136.1_2 Reverse -36 -43 6.13563 0.193
NP_442590.1_10 Forward -267 -248 4.81767 0.27
NP_442998.1_5 Forward -212 -202 8.4365 0.263
NP_442998.1_10 Reverse -260 -267 15.5754 0.0102
NP_442998.1_10 Reverse -37 -44 15.5754 0.0102
NP_442998.1_10 Forward -150 -143 3.97235 0.297
NP_440299.1_1 Forward -271 -258 7.78685 0.105
NP_440299.1_1 Forward -48 -35 2.18201 0.294
NP_441799.1_1 Reverse -31 -45 5.30886 0.214
NP_441799.1_4 Forward -160 -141 -6.68705 0.283
NP_441007.1_10 Forward -18 -5 0.412608 0.23
NP_442334.1_10 Reverse -173 -192 -16.1268 0.223
NP_442201.1_10 Forward -55 -36 -5.70374 0.172
NP_440256.1_1 Forward -47 -28 1.96607 0.0697
NP_440256.1_1 Reverse -255 -274 -9.047 0.273
NP_440456.1_8 Forward -262 -248 14.4542 0.257
NP_441559.1_8 Reverse -41 -55 0.294584 0.169
NP_441559.1_8 Reverse -67 -81 -4.52363 0.227
NP_441559.1_8 Forward -136 -122 -5.11362 0.248
NP_441559.1_8 Reverse -40 -54 -7.08024 0.283
NP_441559.1_8 Reverse -253 -267 -7.47356 0.294
NP_440915.1_6 Forward -48 -34 9.04604 0.047
NP_442866.1_1 Reverse -262 -281 -9.047 0.288
NP_441464.1_1 Forward -281 -262 6.68596 0.285
NP_440026.1_7 Reverse -41 -56 18.8594 0.133
NP_441939.1_3 Forward -266 -247 7.96426 0.186
NP_442386.1_9 Reverse -34 -43 13.8639 0.0289
NP_442386.1_9 Reverse -257 -266 7.96411 0.213
NP_442386.1_9 Forward -268 -259 5.9975 0.23
NP_441340.1_5 Forward -43 -36 13.5105 0.0314
NP_441340.1_5 Forward -266 -259 6.23397 0.132
NP_441340.1_5 Reverse -259 -266 5.84064 0.208
NP_441340.1_5 Reverse -36 -43 5.84064 0.208
NP_442484.1_2 Reverse -247 -266 -1.47551 0.292
NP_442240.1_2 Reverse -36 -55 9.3409 0.0183
NP_442240.1_2 Reverse -259 -278 -7.57203 0.129
NP_441160.1_5 Reverse -132 -151 -6.29373 0.288
NP_440586.1_8 Forward -266 -259 14.69 0.026
NP_440586.1_8 Reverse -36 -43 9.47853 0.146
NP_440586.1_8 Forward -43 -36 5.74197 0.283
NP_442251.1_6 Reverse -259 -266 12.0355 0.0627
NP_441262.1_3 Forward -267 -260 14.7888 0.0223
NP_441262.1_3 Forward -44 -37 14.7888 0.0223
NP_443051.1_1 Forward -45 -36 7.47288 0.0571
NP_443051.1_1 Forward -268 -259 0.884706 0.125
NP_439937.1_8 Forward -269 -250 7.86593 0.191
NP_439937.1_8 Reverse -159 -178 -5.11376 0.286
NP_439937.1_9 Reverse -24 -41 -12.6465 0.274
NP_439937.1_9 Forward -361 -344 -13.0398 0.279
NP_442294.1_3 Forward -175 -161 12.782 0.274
NP_440408.1_3 Reverse -252 -271 -5.70374 0.294
NP_440408.1_7 Reverse -117 -136 10.9142 0.239
NP_440408.1_7 Forward -372 -353 10.7175 0.246
NP_440439.1_1 Forward -47 -34 -1.25902 0.259
NP_440439.1_1 Reverse -255 -268 -1.94734 0.288
NP_440439.1_1 Forward -270 -257 -2.04567 0.293
NP_440372.1_2 Forward -43 -36 13.8055 0.0214
NP_440372.1_2 Forward -266 -259 6.82395 0.0854
NP_440372.1_2 Reverse -259 -266 6.52896 0.188
NP_440372.1_2 Reverse -36 -43 6.52896 0.188
NP_442783.1_2 Reverse -217 -236 9.24257 0.278
NP_440316.1_10 Reverse -122 -132 7.25653 0.251
NP_441803.1_2 Forward -272 -253 4.71934 0.175
NP_441803.1_2 Forward -224 -205 -1.08219 0.294
NP_439977.1_5 Reverse -29 -48 -0.983855 0.239
NP_441572.1_7 Reverse -252 -271 4.03102 0.106
NP_442384.1_10 Reverse -35 -48 8.77074 0.0608
NP_442384.1_10 Forward -55 -42 1.69091 0.249
NP_442114.1_1 Forward -32 -13 17.7974 0.0525
NP_442790.1_4 Forward -276 -257 -15.4385 0.294
NP_442262.1_10 Reverse -36 -43 13.2155 0.0213
NP_442262.1_10 Forward -266 -259 12.9205 0.0422
NP_440163.1_10 Forward -270 -260 16.303 0.0762
NP_440344.1_10 Forward -274 -257 -9.69592 0.153
NP_440344.1_10 Forward -168 -151 -9.69592 0.153
NP_440282.1_3 Forward -347 -328 -4.03212 0.298
NP_440531.1_6 Forward -134 -115 2.65439 0.152
NP_441965.1_10 Reverse -32 -48 2.61514 0.285
NP_440297.1_9 Forward -341 -331 0.176696 0.282
NP_440297.1_9 Reverse -259 -269 -0.511621 0.289
NP_442187.1_3 Forward -45 -35 15.6147 0.105
NP_442280.1_10 Forward -54 -36 4.87002 0.292
NP_441592.1_4 Forward -239 -220 13.7658 0.0879
NP_440894.1_10 Reverse -253 -272 12.0942 0.135
NP_440894.1_10 Reverse -30 -49 7.66927 0.197
NP_440999.1_9 Reverse -254 -268 1.08123 0.171
NP_440999.1_9 Reverse -31 -45 -0.787057 0.217
NP_440888.1_2 Reverse -35 -49 13.8636 0.0231
NP_440491.1_1 Forward -270 -251 9.74328 0.206
NP_442948.1_2 Forward -268 -249 4.03102 0.274
NP_442033.1_10 Reverse -33 -52 2.26107 0.0882
NP_442033.1_10 Reverse -23 -42 -8.16202 0.191
NP_442033.1_10 Reverse -256 -275 -14.4552 0.298
NP_441543.1_2 Forward -160 -151 9.24284 0.0853
NP_441543.1_2 Reverse -259 -268 8.65285 0.0968
NP_441543.1_2 Reverse -36 -45 7.07956 0.131
NP_441543.1_2 Forward -266 -257 7.07956 0.131
NP_440208.1_1 Reverse -175 -194 0.687771 0.119
NP_441469.1_8 Forward -268 -259 6.39124 0.227
NP_441469.1_8 Reverse -257 -266 5.60459 0.258
NP_441469.1_8 Reverse -34 -43 5.60459 0.258
NP_442337.1_5 Forward -126 -107 16.3224 0.193
NP_441306.1_10 Reverse -325 -339 13.2736 0.25
NP_442578.1_7 Forward -266 -259 14.6904 0.026
NP_442578.1_7 Forward -43 -36 6.0373 0.18
NP_440148.1_8 Reverse -122 -132 17.0896 0.28
NP_441462.1_2 Forward -44 -34 7.55152 0.0543
NP_441462.1_2 Forward -267 -257 -0.0199663 0.177
NP_441621.1_7 Forward -269 -255 -1.96703 0.188
NP_441621.1_7 Reverse -256 -270 -3.83532 0.195
NP_441621.1_7 Reverse -247 -261 -6.58858 0.298
NP_443062.1_1 Reverse -258 -276 12.4462 0.0796
NP_443062.1_1 Reverse -35 -53 6.10824 0.209
NP_440519.1_6 Forward -137 -123 10.3243 0.29
NP_442204.1_1 Forward -48 -37 11.5634 0.0565
NP_442204.1_1 Forward -271 -260 9.69511 0.0736
NP_442204.1_1 Reverse -254 -265 -0.334653 0.295
NP_440516.1_2 Reverse -29 -47 -0.570838 0.256
NP_440516.1_6 Reverse -26 -40 12.192 0.196
NP_440516.1_8 Forward -44 -35 18.9776 0.00442
NP_440516.1_8 Forward -267 -258 10.5211 0.00816
NP_440516.1_8 Reverse -35 -44 5.01461 0.118
NP_442428.1_5 Forward -266 -259 6.13563 0.209
NP_442428.1_5 Forward -43 -36 6.13563 0.209
NP_442428.1_5 Reverse -259 -266 6.0373 0.212
NP_442428.1_5 Reverse -36 -43 6.0373 0.212
NP_442428.1_5 Reverse -153 -160 3.77569 0.277
NP_442428.1_8 Reverse -263 -282 2.45773 0.224
NP_441443.1_7 Forward -38 -19 3.73603 0.218
NP_441835.1_3 Forward -267 -253 19.6658 0.0539
NP_440673.1_3 Reverse -260 -267 12.4288 0.0426
NP_440673.1_3 Reverse -37 -44 12.4288 0.0426
NP_440673.1_3 Forward -130 -123 6.72562 0.277
NP_440865.1_9 Forward -273 -254 -8.06369 0.257
NP_441052.1_2 Reverse -35 -45 10.6981 0.0285
NP_441052.1_2 Forward -116 -106 5.48657 0.116
NP_441052.1_2 Forward -161 -151 4.40493 0.159
NP_441052.1_2 Reverse -258 -268 1.25834 0.249
NP_442219.1_9 Reverse -36 -45 7.96454 0.0696
NP_440436.1_4 Reverse -259 -268 8.55409 0.0997
NP_440436.1_4 Reverse -36 -45 7.57079 0.124
NP_441884.1_8 Reverse -257 -276 -5.99873 0.204
NP_441884.1_8 Forward -268 -249 -7.4737 0.251
NP_441719.1_4 Forward -266 -259 13.5105 0.026
NP_441719.1_4 Forward -43 -36 6.82395 0.0855
NP_441719.1_4 Reverse -259 -266 6.52896 0.188
NP_441719.1_4 Reverse -36 -43 6.52896 0.188
NP_441733.1_10 Forward -47 -34 8.08242 0.143
NP_441733.1_10 Forward -270 -257 7.19745 0.156
NP_441004.1_1 Reverse -293 -312 -9.047 0.206
NP_441004.1_1 Forward -86 -67 -12.6852 0.25
NP_441004.1_2 Forward -80 -61 -1.08219 0.259
NP_442813.1_4 Reverse -207 -226 10.8159 0.139
NP_442366.1_3 Reverse -257 -275 -1.65248 0.216
NP_440129.1_10 Forward -274 -260 15.8309 0.0373
NP_442873.1_3 Reverse -248 -267 7.76679 0.207
NP_442206.1_10 Reverse -258 -273 1.2582 0.236
NP_442854.1_6 Reverse -35 -54 1.86774 0.279
NP_443054.1_2 Reverse -245 -259 5.99778 0.212
NP_441851.1_10 Forward -268 -258 4.60159 0.259
NP_442208.1_5 Forward -304 -285 -5.99873 0.266
NP_442814.1_10 Forward -342 -323 3.24438 0.269
NP_442515.1_1 Reverse -106 -120 -3.44199 0.29
NP_441396.1_5 Forward -262 -253 7.76787 0.239
NP_441046.1_2 Reverse -132 -151 12.8808 0.182
NP_441349.1_10 Reverse -97 -116 -7.08038 0.242
NP_441349.1_10 Forward -54 -35 -8.45701 0.275
NP_442843.1_1 Forward -43 -24 -8.94866 0.264
NP_439960.1_10 Forward -51 -33 -1.45582 0.242
NP_442450.1_5 Forward -269 -259 6.07655 0.204
NP_440588.1_2 Reverse -249 -268 -2.95047 0.174
NP_441031.1_8 Forward -272 -253 2.55606 0.205
NP_442006.1_2 Reverse -333 -350 -12.8425 0.197
NP_440483.1_1 Forward -49 -30 -2.36049 0.208
NP_442243.1_1 Forward -50 -32 -2.63651 0.295
NP_441570.1_1 Forward -267 -249 -16.4021 0.245
NP_441570.1_1 Reverse -258 -276 -17.3854 0.273
NP_441570.1_2 Forward -237 -219 8.96727 0.267
NP_441078.1_4 Forward -267 -258 0.196389 0.205
NP_441078.1_4 Forward -44 -35 0.196389 0.205
NP_441078.1_4 Reverse -258 -267 -0.000272808 0.205
NP_441078.1_4 Reverse -35 -44 -0.000272808 0.205
NP_441663.1_8 Reverse -252 -271 1.47442 0.212
NP_442348.1_2 Reverse -222 -231 7.37455 0.28
NP_442443.1_1 Reverse -144 -163 -5.50708 0.282
NP_441432.1_8 Forward -45 -36 14.0611 0.0258
NP_441432.1_8 Reverse -106 -115 2.94966 0.28
NP_441432.1_9 Reverse -376 -389 8.11358 0.294
NP_441333.1_1 Reverse -387 -397 11.6853 0.241
NP_442320.1_8 Forward -273 -259 -5.01529 0.2
NP_440760.1_1 Forward -44 -25 -12.9802 0.0969
NP_440199.1_10 Reverse -104 -114 7.05986 0.242
NP_441945.1_10 Forward -342 -323 11.2092 0.238
NP_442489.1_7 Reverse -258 -267 7.47288 0.0613
NP_442489.1_7 Forward -267 -258 0.688044 0.152
NP_442489.1_7 Forward -44 -35 0.688044 0.152
NP_442489.1_7 Reverse -35 -44 0.688044 0.152
NP_442079.1_7 Forward -43 -24 4.916 0.184
NP_440559.1_1 Reverse -36 -45 7.76787 0.0918
NP_441659.2_8 Reverse -35 -45 5.48657 0.106
NP_441040.1_2 Reverse -214 -233 -14.4552 0.286
NP_441040.1_2 Forward -196 -177 -15.6352 0.286
NP_439956.1_7 Reverse -262 -281 2.26107 0.275
NP_440486.1_6 Reverse -223 -242 6.39097 0.283
NP_440459.1_2 Reverse -33 -50 15.1818 0.113
NP_440459.1_2 Forward -351 -334 7.31533 0.296
NP_441653.1_2 Reverse -247 -266 7.4916 0.215
NP_440010.1_3 Reverse -211 -230 -8.16202 0.294
NP_440847.1_3 Forward -280 -266 10.5204 0.291
NP_442603.1_7 Reverse -35 -49 14.9452 0.0563
NP_442603.1_7 Forward -44 -30 8.55376 0.171
NP_441888.1_7 Forward -272 -258 3.63784 0.225
NP_441888.1_7 Reverse -253 -267 1.08123 0.267
NP_441050.1_4 Reverse -301 -315 17.1092 0.156
NP_441948.1_4 Forward -274 -256 -4.01242 0.214
NP_441047.1_2 Reverse -118 -137 1.76941 0.239
NP_441833.1_4 Reverse -259 -266 6.52896 0.0924
NP_441833.1_4 Reverse -36 -43 6.52896 0.0924
NP_441833.1_4 Forward -266 -259 6.23397 0.163
NP_441833.1_4 Forward -43 -36 6.23397 0.163
NP_441329.1_6 Reverse -163 -182 1.95716 0.231
NP_441329.1_6 Forward -392 -373 -2.72194 0.294
NP_441895.1_10 Reverse -173 -192 -27.5332 0.282
NP_442162.1_9 Forward -43 -36 12.9205 0.0282
NP_442162.1_9 Reverse -36 -43 12.9205 0.0282
NP_442162.1_9 Forward -266 -259 6.62729 0.142
NP_442162.1_9 Reverse -259 -266 6.52896 0.178
NP_440671.1_4 Forward -273 -259 17.5025 0.0199
NP_440671.1_4 Forward -50 -36 8.75105 0.191
NP_441044.1_4 Reverse -243 -261 0.707465 0.293
NP_442140.1_3 Reverse -36 -46 8.23984 0.122
NP_442140.1_3 Forward -266 -256 6.76487 0.159
NP_442140.1_3 Forward -43 -33 6.76487 0.159
NP_442140.1_3 Reverse -153 -163 4.60159 0.242
NP_440875.1_9 Reverse -308 -318 9.73475 0.233
NP_440875.1_9 Reverse -260 -270 9.05339 0.233
NP_440875.1_9 Reverse -37 -47 8.37203 0.233
NP_441813.1_5 Reverse -33 -43 16.303 0.01
NP_441813.1_5 Reverse -256 -266 9.81313 0.0214
NP_441813.1_5 Forward -46 -36 8.4365 0.0432
NP_441813.1_5 Forward -269 -259 7.45319 0.0746
NP_442089.1_9 Forward -256 -237 12.0942 0.283
NP_440590.1_4 Reverse -36 -49 3.16588 0.0756
NP_440590.1_4 Forward -43 -30 2.2809 0.0939
NP_440590.1_4 Forward -266 -253 -5.19226 0.277
NP_440567.1_1 Reverse -259 -273 1.67122 0.196
NP_442497.1_10 Reverse -259 -268 0.589713 0.153
NP_442497.1_10 Reverse -36 -45 0.589713 0.153
NP_440821.1_4 Forward -269 -259 9.32148 0.03
NP_440821.1_4 Forward -46 -36 -0.314959 0.251
NP_441239.1_9 Reverse -33 -45 12.6253 0.0446
NP_441239.1_9 Reverse -256 -268 7.11881 0.169
NP_441239.1_9 Reverse -252 -264 3.77555 0.276
NP_441892.1_1 Forward -276 -259 6.82368 0.0931
NP_441769.1_1 Reverse -250 -269 10.2259 0.195
NP_440949.1_7 Forward -232 -213 9.7334 0.258
NP_440546.1_4 Forward -44 -34 14.0213 0.0459
NP_441230.1_5 Reverse -253 -272 1.57275 0.239
NP_440462.1_6 Reverse -33 -43 13.353 0.0279
NP_440462.1_6 Forward -269 -259 12.1731 0.0371
NP_440462.1_6 Reverse -256 -266 6.66654 0.105
NP_440868.1_4 Reverse -254 -266 10.2654 0.0398
NP_440868.1_4 Forward -48 -36 5.44718 0.0977
NP_440868.1_4 Reverse -31 -43 4.46387 0.118
NP_440868.1_4 Forward -271 -259 -0.846001 0.282
NP_440401.1_9 Forward -228 -221 12.6251 0.287
NP_442499.1_1 Forward -239 -220 3.83436 0.247
NP_442479.1_9 Forward -33 -14 -7.17871 0.266
NP_441474.1_1 Reverse -248 -267 18.1898 0.0944
NP_442402.1_4 Reverse -65 -84 -0.984623 0.189
NP_442402.1_4 Forward -148 -129 -8.94939 0.285
NP_441848.1_7 Forward -146 -127 -0.886293 0.244
NP_440653.1_5 Reverse -334 -353 6.78429 0.271
NP_442039.1_4 Forward -43 -36 11.6422 0.0747
NP_442039.1_7 Forward -85 -75 10.9931 0.257
NP_441811.1_1 Reverse -26 -45 5.99764 0.28
NP_442380.1_4 Forward -229 -210 4.22769 0.205
NP_440825.1_2 Reverse -52 -71 10.6192 0.108
NP_442837.1_3 Reverse -259 -266 12.1338 0.0702
NP_442837.1_3 Forward -266 -259 6.0373 0.25
NP_442837.1_3 Forward -43 -36 6.0373 0.25
NP_442837.1_3 Reverse -36 -43 6.0373 0.25
NP_442053.1_1 Reverse -35 -44 14.4544 0.0114
NP_442053.1_1 Reverse -258 -267 14.1594 0.0136
NP_442053.1_1 Forward -267 -258 7.86621 0.0863
NP_442053.1_1 Forward -44 -35 7.86621 0.0863
NP_440505.1_3 Forward -46 -36 16.7946 0.00614
NP_440505.1_3 Forward -15 -5 8.53483 0.141
NP_440505.1_3 Forward -269 -259 4.99491 0.252
NP_440505.1_7 Reverse -42 -61 -1.47551 0.276
NP_442360.1_5 Forward -86 -76 13.8447 0.258
NP_441252.1_6 Forward -83 -76 11.6422 0.288
NP_441252.1_6 Reverse -1 -8 11.6422 0.288
NP_441203.1_1 Reverse -36 -55 -19.4701 0.297
NP_440914.1_1 Reverse -35 -45 13.1043 0.0386
NP_441011.1_8 Forward -43 -34 11.7994 0.0629
NP_441011.1_8 Reverse -259 -268 7.07956 0.179
NP_441011.1_8 Forward -266 -257 5.70292 0.237
NP_442533.1_1 Forward -270 -251 -13.0786 0.236
NP_442533.1_1 Forward -264 -245 -14.6519 0.247
NP_442533.1_1 Forward -87 -68 -17.7001 0.293
NP_442533.1_6 Reverse -35 -44 4.42462 0.179
NP_442533.1_6 Forward -255 -246 2.06468 0.275
NP_442232.1_3 Forward -275 -256 -15.0452 0.288
NP_442322.1_4 Forward -58 -41 6.72462 0.158
NP_441482.1_7 Forward -273 -259 7.9644 0.0215
NP_441482.1_7 Forward -50 -36 -0.885388 0.0612
NP_441482.1_7 Reverse -117 -131 -11.8001 0.284
NP_439944.1_9 Forward -160 -150 5.09324 0.277
NP_441028.1_6 Reverse -30 -40 8.04271 0.217
NP_441028.1_6 Forward -137 -127 7.64939 0.218
NP_442202.1_4 Reverse -256 -270 13.3201 0.259
NP_441527.1_4 Forward -398 -379 -11.7937 0.284
NP_440115.1_6 Forward -47 -37 16.008 0.0325
NP_440007.1_9 Forward -48 -34 5.50613 0.254
NP_440007.1_9 Reverse -336 -350 3.93283 0.267
NP_441680.1_4 Forward -226 -207 5.01433 0.198
NP_443045.1_4 Forward -47 -28 18.4857 0.264
NP_441106.1_1 Forward -268 -259 8.45619 0.0548
NP_439903.1_6 Forward -135 -116 3.83357 0.206
NP_442588.1_6 Reverse -38 -57 7.27595 0.174
NP_442928.1_3 Reverse -332 -351 17.2516 0.205
NP_441286.1_1 Forward -45 -33 -4.38592 0.156
NP_440670.1_8 Forward -44 -35 8.75118 0.0606
NP_440670.1_8 Reverse -35 -44 6.19458 0.124
NP_441705.1_3 Reverse -117 -136 10.0292 0.167
NP_441930.1_2 Reverse -122 -132 14.1397 0.226
NP_440886.1_7 Reverse -34 -44 16.4991 0.0104
NP_440886.1_7 Reverse -257 -267 8.43603 0.0805
NP_440886.1_7 Forward -162 -152 7.25606 0.0993
NP_440886.1_7 Forward -268 -258 6.86274 0.113
NP_442072.1_9 Forward -268 -250 -22.9903 0.271
NP_442401.1_2 Forward -162 -143 7.27514 0.269
NP_442773.2_1 Forward -197 -178 22.1239 0.0883
NP_442264.1_2 Forward -277 -260 9.18362 0.199
NP_441626.1_2 Forward -43 -36 12.2322 0.0511
NP_441626.1_2 Forward -266 -259 6.13563 0.177
NP_441626.1_2 Reverse -259 -266 5.93897 0.231
NP_441626.1_2 Reverse -36 -43 5.93897 0.231
NP_442365.1_7 Forward -48 -29 -6.68705 0.299
NP_442794.1_1 Forward -48 -36 10.2654 0.0721
NP_442794.1_1 Reverse -254 -266 2.39892 0.29
NP_440387.1_1 Reverse -258 -274 -6.33298 0.279
NP_441488.1_8 Forward -49 -35 19.0751 0.0356
NP_441836.1_2 Reverse -29 -48 -0.295539 0.212
NP_441836.1_6 Reverse -261 -280 15.5357 0.298
NP_440114.1_10 Forward -44 -30 7.27608 0.239
NP_441510.2_7 Forward -231 -217 11.012 0.28
NP_440766.1_4 Forward -48 -34 12.8809 0.0431
NP_440766.1_4 Forward -271 -257 12.3893 0.054
NP_440766.1_4 Reverse -254 -268 6.19444 0.104
NP_441979.1_5 Reverse -252 -271 -1.96717 0.147
NP_442743.1_4 Reverse -36 -55 -7.96535 0.284
NP_440457.1_1 Forward -48 -36 9.87208 0.092
NP_440457.1_1 Forward -271 -259 8.00379 0.101
NP_441801.1_4 Forward -228 -218 2.63497 0.29
NP_440801.1_10 Forward -271 -252 16.0274 0.126
NP_441436.1_2 Reverse -116 -135 -5.21209 0.294
NP_442509.1_6 Reverse -334 -353 6.78429 0.294
NP_442509.1_9 Forward -232 -222 13.1559 0.061
NP_442509.1_9 Forward -44 -34 11.9759 0.107
NP_440554.1_4 Reverse -36 -46 5.97822 0.128
NP_440554.1_4 Reverse -259 -269 4.99491 0.167
NP_441885.1_5 Reverse -35 -45 1.25834 0.11
NP_441885.1_5 Forward -44 -34 0.0783647 0.183
NP_441885.1_5 Forward -161 -151 -0.904945 0.241
NP_442341.1_7 Reverse -257 -271 9.63603 0.0726
NP_442341.1_9 Reverse -33 -47 5.70218 0.258
NP_441173.1_9 Forward -303 -295 9.75379 0.284
NP_442395.2_4 Reverse -257 -276 3.24359 0.207
NP_440423.1_6 Forward -52 -33 -21.1417 0.284
NP_443000.1_7 Forward -46 -36 10.2065 0.0355
NP_440275.1_3 Forward -46 -36 12.5664 0.0316
NP_440679.1_10 Reverse -145 -164 -20.0601 0.283
NP_439962.1_4 Reverse -250 -269 -2.36049 0.226
NP_440149.1_8 Reverse -35 -54 -6.09707 0.24
NP_441875.1_3 Forward -240 -221 17.4032 0.252
NP_441875.1_7 Forward -82 -72 16.4013 0.227
NP_441105.1_3 Forward -278 -259 -6.1954 0.23
NP_442373.1_2 Reverse -140 -159 -7.08038 0.233
NP_440216.1_1 Forward -267 -253 -2.06536 0.0458
NP_440216.1_1 Reverse -35 -49 -2.85201 0.0608
NP_440216.1_1 Forward -44 -30 -12.0951 0.24
NP_440216.1_1 Reverse -46 -60 -12.4884 0.274
NP_440216.1_1 Forward -55 -41 -12.6851 0.296
NP_440172.1_1 Reverse -35 -45 2.24165 0.279
NP_442015.1_10 Reverse -254 -267 4.73917 0.162
NP_442015.1_10 Forward -48 -35 1.88757 0.204
NP_442015.1_10 Forward -271 -258 -0.0790467 0.25
NP_441226.1_7 Forward -43 -36 12.7234 0.0312
NP_441226.1_7 Reverse -36 -43 11.5435 0.0757
NP_441111.1_7 Reverse -259 -267 8.86921 0.0589
NP_441111.1_7 Reverse -36 -44 8.86921 0.0589
NP_441766.1_2 Reverse -35 -44 14.7494 0.00772
NP_441766.1_2 Reverse -258 -267 8.55452 0.054
NP_442417.1_5 Forward -267 -253 15.3392 0.0564
NP_442417.1_5 Reverse -258 -272 13.0776 0.0849
NP_442417.1_5 Reverse -35 -49 6.48943 0.219
NP_440416.1_9 Forward -274 -255 -5.70374 0.0814
NP_440416.1_9 Forward -51 -32 -9.93197 0.135
NP_440416.1_9 Reverse -251 -270 -17.0118 0.229
NP_440416.1_9 Forward -61 -42 -17.9951 0.25
NP_440416.1_9 Forward -133 -114 -18.0934 0.251
NP_440416.1_9 Forward -62 -43 -21.7317 0.296
NP_441135.1_4 Reverse -28 -47 6.58763 0.284
NP_440591.1_9 Forward -274 -256 4.34571 0.283
NP_442154.1_1 Forward -266 -248 -8.14232 0.157
NP_442154.1_1 Reverse -265 -283 -9.32229 0.178
NP_442154.1_1 Reverse -144 -162 -11.2889 0.213
NP_442564.1_10 Forward -218 -204 8.94771 0.296
NP_440261.1_5 Reverse -36 -49 -3.02898 0.108
NP_440261.1_7 Forward -343 -324 3.24438 0.148
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GTGAAAGTTATAAAAACAAGCAGTTAAAGGGTCAAGGTAACAGCACTGCTTCCCAAACAGCCTGGGCCCTAATTGGTTTGTTAGATGCCCTCAAATATTTACCCAGCCTGGGACAAGATGCCAAACTAACCACGGCGATCGAGGGGGGCGTGGCTTTTCTTGTCCAGGGACAAACCCCCAAGGGCACCTGGGAAGAAGCAGAATATACCGGCACCGGTTTTCCCTGTCACTTTTATATCCGCTATCACTACTACCGCCAATATTTTCCCCTCATTGCCCTAGCTCGTTATAGCCATTTACAAGCATCTTAATGAACCTTGGGGAACCTTGGGGTAATATTCGTCCGGTCAACCCCTGGCGATCGGGGGAAATGTGTCCTAAGATTGAGGGGGTTGCACCA

CDS

No sequence available

Protein

No sequence available