Your browser is old and dusty. Try Google Chrome!

Details for 6803t14

ORF 6803t14
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Reverse -158 -177 -29.7948 0.238
NP_440897.1_6 Forward -105 -86 -0.886293 0.187
NP_442151.1_6 Reverse -191 -205 11.701 0.0933
NP_441818.1_9 Forward -243 -224 -2.45882 0.203
NP_441934.1_8 Reverse -294 -313 14.6508 0.222
NP_440061.1_9 Reverse -169 -183 5.30886 0.29
NP_440761.1_4 Reverse -343 -362 -13.4719 0.257
NP_441995.1_6 Forward -353 -334 14.2574 0.286
NP_439918.1_2 Reverse -348 -367 -2.75381 0.249
NP_442726.1_1 Reverse -355 -374 8.06259 0.288
NP_441738.1_2 Forward -165 -158 6.52862 0.261
NP_442570.1_10 Forward -161 -142 13.1758 0.189
NP_441163.1_1 Forward -181 -164 10.5595 0.209
NP_442634.1_4 Reverse -346 -360 -4.62196 0.211
NP_440403.1_2 Forward -194 -175 10.4225 0.0774
NP_440842.1_10 Forward -388 -374 6.09611 0.251
NP_441012.1_4 Forward -361 -348 7.09911 0.272
NP_443018.1_3 Forward -199 -192 10.6589 0.0967
NP_443018.1_3 Reverse -192 -199 4.16902 0.278
NP_442687.1_7 Reverse -277 -287 8.63316 0.104
NP_442191.1_4 Forward -151 -137 11.5748 0.252
NP_440642.1_10 Forward -203 -189 1.17898 0.3
NP_440360.1_10 Reverse -314 -328 2.65453 0.261
NP_440662.1_4 Forward -326 -307 11.7008 0.182
NP_441414.1_9 Reverse -191 -210 -3.54046 0.138
NP_441414.1_9 Forward -200 -181 -4.72043 0.161
NP_439959.1_3 Forward -326 -307 9.83255 0.252
NP_441754.1_6 Forward -263 -244 22.0256 0.0309
NP_442536.1_7 Forward -151 -132 9.93088 0.273
NP_442438.1_10 Forward -322 -308 1.76955 0.188
NP_442771.1_1 Forward -316 -298 -0.865831 0.12
NP_441550.1_8 Reverse -189 -199 7.74772 0.149
NP_441916.1_7 Reverse -348 -358 2.83163 0.239
NP_440206.1_4 Forward -367 -348 -1.27961 0.29
NP_441041.1_4 Forward -357 -338 -13.4719 0.288
NP_440703.1_3 Forward -26 -7 18.417 0.253
NP_441725.1_5 Forward -199 -189 0.668351 0.156
NP_440983.1_5 Reverse -285 -304 -7.76869 0.291
NP_440983.1_9 Reverse -320 -339 0.0977854 0.295
NP_442847.1_2 Forward -141 -122 20.059 0.147
NP_441644.1_6 Forward -357 -347 10.5993 0.0628
NP_441644.1_6 Forward -200 -190 8.63269 0.097
NP_442029.1_6 Forward -151 -132 4.81767 0.261
NP_442247.1_7 Forward -314 -295 7.66927 0.228
NP_442554.1_8 Forward -356 -346 4.79825 0.173
NP_442554.1_8 Reverse -192 -202 2.33998 0.274
NP_442142.1_4 Forward -324 -311 6.21356 0.17
NP_440895.1_5 Forward -103 -85 17.5212 0.298
NP_443009.1_5 Reverse -307 -318 4.28642 0.254
NP_440183.1_1 Reverse -208 -227 6.39097 0.278
NP_440183.1_9 Reverse -135 -154 -20.5517 0.287
NP_440379.1_5 Forward -161 -142 -10.9153 0.285
NP_441468.1_1 Forward -151 -144 7.41394 0.121
NP_441468.1_1 Forward -199 -192 3.97235 0.277
NP_439939.1_3 Reverse -362 -381 -0.983855 0.214
NP_441015.1_10 Forward -326 -307 -9.44032 0.282
NP_441015.1_10 Forward -151 -132 -10.3253 0.284
NP_441015.1_10 Forward -260 -241 -10.6203 0.286
NP_441876.1_9 Reverse -255 -265 13.3526 0.267
NP_441426.1_3 Reverse -320 -339 12.29 0.256
NP_442719.1_2 Forward -357 -339 -10.208 0.271
NP_442808.1_1 Forward -174 -164 4.01116 0.212
NP_442808.1_1 Reverse -326 -336 3.71617 0.227
NP_442808.1_1 Reverse -307 -317 2.24121 0.274
NP_441101.1_10 Forward -385 -366 -0.688862 0.189
NP_442050.1_1 Forward -262 -243 6.88262 0.281
NP_442050.1_5 Forward -169 -159 8.43603 0.234
NP_440630.1_7 Reverse -297 -316 -4.03212 0.26
NP_441590.1_4 Reverse -304 -323 7.66846 0.249
NP_441590.1_4 Reverse -238 -257 2.06362 0.297
NP_442777.1_3 Reverse -244 -262 4.54162 0.261
NP_441458.1_8 Forward -71 -52 1.61936 0.296
NP_442183.1_1 Reverse -272 -286 9.2427 0.0999
NP_442397.1_9 Reverse -272 -291 5.40766 0.246
NP_440058.1_2 Forward -178 -159 3.53937 0.289
NP_442347.1_2 Forward -117 -108 3.83464 0.284
NP_442645.1_2 Reverse -351 -370 -16.1268 0.224
NP_442645.1_2 Reverse -270 -289 -20.7484 0.288
NP_442645.1_2 Forward -314 -295 -22.125 0.29
NP_441037.1_4 Reverse -295 -305 6.05075 0.283
NP_440899.1_1 Reverse -336 -355 15.0437 0.106
NP_440299.1_1 Reverse -304 -317 3.16532 0.256
NP_442334.1_2 Forward -324 -307 -14.4158 0.3
NP_440256.1_1 Reverse -155 -174 -1.18052 0.101
NP_440915.1_6 Forward -361 -347 0.589577 0.159
NP_441494.1_6 Forward -215 -202 5.82081 0.292
NP_442993.1_1 Forward -135 -119 -9.97122 0.201
NP_440677.1_3 Forward -362 -344 7.88563 0.286
NP_442386.1_9 Forward -201 -192 9.93072 0.144
NP_442386.1_9 Forward -363 -354 5.11253 0.266
NP_441750.1_1 Forward -225 -206 -13.1769 0.3
NP_441340.1_5 Reverse -192 -199 11.3472 0.0526
NP_441340.1_9 Forward -94 -84 16.0642 0.194
NP_440597.1_9 Reverse -125 -139 20.4524 0.149
NP_440211.1_7 Reverse -143 -161 7.78729 0.247
NP_440586.1_8 Forward -199 -192 5.74197 0.283
NP_440027.1_3 Forward -183 -165 3.06666 0.28
NP_443051.1_1 Reverse -190 -199 3.24465 0.123
NP_439937.1_9 Reverse -326 -343 -4.97671 0.157
NP_441657.1_5 Reverse -268 -287 0.58944 0.205
NP_440408.1_7 Reverse -347 -366 8.16093 0.282
NP_440171.1_3 Forward -226 -207 3.24438 0.284
NP_440819.1_5 Reverse -197 -205 7.98423 0.228
NP_440819.1_5 Reverse -118 -126 7.59091 0.272
NP_440316.1_10 Reverse -375 -385 5.38824 0.299
NP_440139.1_1 Reverse -272 -291 1.37531 0.263
NP_441572.1_7 Reverse -130 -149 -4.42544 0.235
NP_441604.1_4 Forward -365 -346 -2.75381 0.212
NP_442262.1_10 Forward -199 -192 12.0355 0.062
NP_440344.1_10 Forward -343 -326 -12.3509 0.25
NP_440531.1_8 Forward -338 -319 4.12936 0.269
NP_441898.1_2 Reverse -311 -330 15.5349 0.212
NP_440297.1_9 Forward -199 -189 9.22315 0.0917
NP_440999.1_9 Reverse -132 -146 2.45787 0.149
NP_441178.1_6 Reverse -130 -149 5.70185 0.268
NP_441918.1_1 Reverse -323 -342 16.4207 0.0541
NP_442337.1_8 Forward -334 -315 -1.08219 0.278
NP_442578.1_5 Reverse -132 -151 8.65258 0.227
NP_442578.1_7 Reverse -48 -55 9.38056 0.138
NP_440710.1_1 Forward -395 -377 -7.15901 0.234
NP_440220.1_4 Reverse -233 -252 -1.96793 0.265
NP_441621.1_7 Reverse -325 -339 -3.93365 0.198
NP_443062.1_1 Forward -200 -182 5.03566 0.242
NP_443062.1_1 Forward -357 -339 3.67056 0.289
NP_442204.1_5 Forward -183 -164 3.6377 0.186
NP_440454.1_2 Reverse -115 -129 12.4256 0.234
NP_440516.1_8 Reverse -191 -200 -0.68859 0.297
NP_442428.1_5 Forward -199 -192 4.36568 0.271
NP_440673.1_2 Reverse -338 -357 9.21897 0.254
NP_440436.1_4 Reverse -309 -318 7.76745 0.124
NP_440577.1_7 Forward -60 -41 15.9797 0.297
NP_441004.1_1 Reverse -321 -340 -16.0285 0.281
NP_440328.1_4 Reverse -279 -298 4.03102 0.17
NP_441195.1_6 Reverse -220 -239 8.35759 0.29
NP_440940.1_7 Reverse -298 -316 5.72158 0.225
NP_441409.1_6 Reverse -168 -187 -12.4886 0.228
NP_442843.1_1 Forward -356 -337 -3.54046 0.223
NP_441003.1_3 Reverse -58 -77 16.6174 0.245
NP_442243.1_1 Forward -363 -345 2.57501 0.204
NP_441078.1_4 Forward -281 -272 5.01461 0.122
NP_441078.1_4 Reverse -272 -281 -1.08191 0.222
NP_442729.1_8 Forward -285 -272 15.5556 0.0954
NP_442443.1_1 Forward -242 -223 0.58944 0.215
NP_442443.1_1 Forward -254 -235 -3.83545 0.267
NP_441094.1_1 Reverse -309 -323 17.6002 0.256
NP_442003.1_4 Forward -151 -132 15.3391 0.201
NP_442815.1_2 Reverse -337 -355 2.57575 0.295
NP_441805.1_2 Forward -368 -349 26.2538 0.00025
NP_441805.1_3 Forward -200 -181 30.5804 0.000287
NP_441805.1_4 Forward -254 -235 31.2687 0.0000982
NP_441805.1_5 Forward -179 -160 20.0581 0.0368
NP_441805.1_7 Forward -329 -310 27.7288 0.000482
NP_441805.1_8 Forward -224 -205 19.469 0.0554
NP_441805.1_9 Forward -305 -286 26.4505 0.00286
NP_440713.1_4 Forward -255 -236 10.0292 0.133
NP_442346.1_5 Reverse -347 -357 10.0098 0.11
NP_442346.1_5 Forward -184 -174 6.27322 0.208
NP_440352.1_5 Forward -104 -85 10.2223 0.278
NP_440486.1_4 Reverse -378 -396 1.78911 0.226
NP_441943.1_8 Reverse -189 -208 -4.42544 0.215
NP_441047.1_1 Reverse -221 -240 2.65439 0.205
NP_441329.1_1 Reverse -24 -43 12.3658 0.175
NP_440912.1_3 Forward -60 -41 10.0284 0.254
NP_442140.1_3 Reverse -279 -289 4.40493 0.243
NP_442140.1_3 Forward -199 -189 3.61828 0.288
NP_441671.1_10 Reverse -93 -112 -0.590531 0.297
NP_442547.1_7 Forward -331 -312 17.2306 0.141
NP_440594.1_6 Reverse -165 -184 7.07848 0.257
NP_440594.1_10 Reverse -249 -263 16.5185 0.263
NP_440719.1_1 Forward -262 -243 8.55425 0.194
NP_440821.1_4 Reverse -189 -199 -0.314959 0.251
NP_441239.1_9 Forward -154 -142 9.08543 0.115
NP_441239.1_9 Reverse -310 -322 5.93884 0.202
NP_441239.1_9 Forward -359 -347 4.46387 0.253
NP_441239.1_9 Reverse -131 -143 3.97222 0.269
NP_441009.1_4 Reverse -348 -367 10.2259 0.276
NP_441892.1_1 Forward -330 -313 8.10198 0.0829
NP_441892.1_1 Forward -394 -377 -1.33779 0.203
NP_440219.1_1 Forward -58 -39 13.3189 0.254
NP_440354.1_7 Reverse -185 -203 6.214 0.286
NP_441617.1_6 Forward -207 -188 -2.85214 0.258
NP_440546.1_4 Reverse -376 -386 10.046 0.109
NP_440546.1_4 Reverse -103 -113 6.8464 0.276
NP_440546.1_4 Forward -317 -307 6.74945 0.282
NP_440546.1_6 Reverse -332 -351 8.84924 0.253
NP_440705.1_4 Reverse -155 -174 6.78429 0.296
NP_441848.1_4 Forward -100 -84 12.8982 0.195
NP_442039.1_4 Forward -280 -273 6.43063 0.285
NP_441053.1_8 Reverse -357 -376 18.7807 0.0391
NP_440160.1_7 Reverse -148 -167 17.0107 0.17
NP_442053.1_1 Reverse -272 -281 4.12963 0.267
NP_441203.1_2 Forward -255 -236 6.19431 0.106
NP_440914.1_1 Forward -173 -163 6.27291 0.288
NP_442533.1_6 Reverse -308 -317 5.21127 0.15
NP_442533.1_6 Reverse -348 -357 5.11294 0.155
NP_442533.1_6 Forward -357 -348 4.12963 0.191
NP_442533.1_6 Reverse -174 -183 2.75299 0.241
NP_442533.1_6 Forward -321 -312 2.06468 0.275
NP_442232.1_3 Forward -329 -310 -15.1435 0.289
NP_442322.1_4 Reverse -305 -322 -1.92846 0.228
NP_442322.1_4 Forward -121 -104 -2.12512 0.228
NP_442322.1_4 Forward -365 -348 -4.2884 0.257
NP_441028.1_6 Forward -205 -195 5.19112 0.265
NP_440116.1_8 Reverse -279 -298 -5.01543 0.186
NP_441347.1_4 Forward -293 -275 18.2501 0.166
NP_441106.1_1 Reverse -347 -356 2.75299 0.261
NP_439903.1_6 Reverse -124 -143 1.86696 0.239
NP_440886.1_7 Forward -337 -327 9.321 0.0805
NP_442213.1_6 Forward -325 -306 8.25926 0.246
NP_442794.1_1 Forward -204 -192 5.74217 0.209
NP_441962.1_4 Forward -382 -363 -14.6519 0.291
NP_441962.1_9 Forward -111 -92 10.1275 0.258
NP_440387.1_1 Reverse -272 -288 -6.33298 0.279
NP_441431.1_2 Forward -360 -346 5.89884 0.284
NP_441993.1_1 Forward -327 -308 9.74328 0.135
NP_440293.1_3 Forward -329 -310 -3.44213 0.244
NP_439988.1_3 Reverse -349 -363 8.75105 0.249
NP_441237.1_9 Reverse -192 -202 11.3864 0.184
NP_440502.1_3 Reverse -316 -326 14.2769 0.251
NP_440457.1_1 Reverse -187 -199 -0.649339 0.271
NP_440142.1_7 Forward -327 -308 5.60432 0.287
NP_441885.1_5 Reverse -272 -282 0.471689 0.145
NP_441428.1_8 Forward -20 -1 2.85105 0.262
NP_442341.1_3 Reverse -349 -368 2.94938 0.236
NP_440191.1_6 Forward -127 -113 13.667 0.294
NP_440750.1_5 Forward -38 -24 6.98109 0.234
NP_440423.1_6 Forward -329 -310 -20.945 0.276
NP_441105.1_3 Forward -332 -313 -9.73531 0.295
NP_441226.1_7 Reverse -192 -199 12.4284 0.0404
NP_440416.1_1 Forward -136 -117 -12.6852 0.272
NP_440416.1_9 Reverse -301 -320 -1.96717 0.068
NP_443052.1_9 Reverse -212 -231 7.27595 0.134
NP_443052.1_9 Reverse -209 -228 0.982764 0.188
NP_440591.1_9 Forward -328 -310 3.65739 0.296
NP_442154.1_1 Forward -254 -236 -7.35568 0.141
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CAGAACGCCGTAAGGCCCGAGGGCTCAAACTCAACTATCCCGAAGCCGTGGCCTATATTTCCGCCGCTATCCTGGAAGGGGCCAGGGATGGTCGTACCGTAGCCGAGTTGATGAACTATGGCGCTACCCTATTGAGTCGGGACGAAGTCATGGAAGGGGTGCCGGAAATGTTACCGGAGGTACAGGTGGAAGCAACTTTTCCCGATGGCACTAAACTGGTGACGGTCCACGAACCCATTCGCTAGTAATGAGCTGGCCGGTCAGGGCGGACTGTTTTTTACCGTTAAACCCCAGGCCTGTTGACCGTAGAAAAAATTCATTGTCTAGGGTTGACAGTGATCAATCTTTATCGCTATATTTAAAAACGTCTGAAATAACGAACTGTTATCGAGACTGCCTA

CDS

No sequence available

Protein

No sequence available