Your browser is old and dusty. Try Google Chrome!

Details for 6803t13

ORF 6803t13
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -397 -383 2.06454 0.179
NP_441061.1_2 Forward -184 -170 -1.8687 0.274
NP_440795.1_7 Forward -172 -165 14.6904 0.0123
NP_440795.1_7 Reverse -165 -172 14.6904 0.0123
NP_440795.1_7 Reverse -390 -397 10.2655 0.154
NP_440795.1_7 Reverse -384 -391 7.80726 0.232
NP_441418.1_6 Forward -173 -154 -20.3551 0.111
NP_441418.1_6 Reverse -377 -396 -28.5165 0.205
NP_441418.1_6 Reverse -164 -183 -28.5165 0.205
NP_441453.1_4 Reverse -164 -172 16.539 0.00633
NP_441453.1_4 Forward -173 -165 16.539 0.00633
NP_441453.1_4 Reverse -291 -299 4.83764 0.237
NP_441453.1_4 Forward -398 -390 4.05099 0.268
NP_442151.1_6 Forward -173 -159 8.75105 0.164
NP_442151.1_6 Forward -398 -384 6.19444 0.244
NP_440226.1_1 Reverse -164 -183 13.2741 0.0374
NP_440259.1_4 Reverse -65 -79 17.5053 0.108
NP_440259.1_4 Reverse -64 -78 9.40713 0.278
NP_440150.1_2 Forward -360 -341 6.68515 0.256
NP_441816.1_6 Forward -131 -119 15.0836 0.256
NP_442655.1_1 Forward -178 -159 1.0811 0.238
NP_442173.1_1 Forward -172 -164 15.4574 0.00633
NP_442173.1_1 Reverse -165 -173 15.4574 0.00633
NP_442752.1_4 Forward -173 -166 13.8055 0.0199
NP_442752.1_4 Reverse -164 -171 13.8055 0.0199
NP_442752.1_4 Forward -358 -351 6.52896 0.154
NP_442752.1_4 Reverse -38 -45 5.44732 0.202
NP_443027.1_4 Forward -175 -165 13.2547 0.0521
NP_442975.1_10 Reverse -160 -174 2.75226 0.269
NP_440784.1_7 Forward -172 -165 15.9687 0.0123
NP_440784.1_7 Reverse -165 -172 15.9687 0.0123
NP_442909.1_7 Forward -172 -158 8.55376 0.172
NP_442909.1_7 Reverse -344 -358 7.96378 0.194
NP_440061.1_9 Forward -175 -161 11.5037 0.109
NP_440061.1_9 Forward -400 -386 11.2087 0.116
NP_440061.1_9 Reverse -343 -357 5.60385 0.279
NP_441054.1_4 Forward -183 -165 1.78911 0.17
NP_439979.1_9 Forward -367 -349 8.86894 0.26
NP_442062.1_8 Forward -173 -163 17.6796 0.00193
NP_442062.1_8 Reverse -164 -174 10.3048 0.0493
NP_442062.1_8 Forward -398 -388 4.50326 0.212
NP_442062.1_8 Reverse -38 -48 2.83163 0.293
NP_441995.1_6 Forward -367 -348 13.3725 0.286
NP_441859.1_3 Forward -174 -155 4.03023 0.228
NP_440304.1_4 Forward -175 -165 10.8948 0.051
NP_440304.1_4 Reverse -162 -172 9.91146 0.051
NP_442242.1_4 Forward -172 -165 14.3954 0.0124
NP_442242.1_4 Reverse -165 -172 14.3954 0.0124
NP_441781.1_7 Forward -191 -172 -0.39387 0.257
NP_441781.1_7 Forward -54 -35 -1.08219 0.268
NP_441208.1_9 Reverse -161 -175 17.2075 0.0647
NP_442110.1_7 Reverse -164 -178 2.5562 0.222
NP_441925.1_4 Reverse -342 -361 -17.4058 0.294
NP_440769.1_8 Reverse -49 -68 8.65258 0.229
NP_440856.1_4 Forward -180 -161 19.9606 0.0211
NP_440856.1_4 Forward -352 -333 -2.45882 0.211
NP_441083.1_3 Reverse -388 -398 15.2208 0.138
NP_441083.1_5 Forward -173 -163 19.3512 0.000718
NP_441083.1_5 Reverse -164 -174 11.2881 0.0159
NP_441083.1_5 Reverse -389 -399 1.16001 0.215
NP_441083.1_5 Forward -398 -388 0.963343 0.218
NP_441083.1_5 Forward -184 -174 -0.216628 0.261
NP_442827.1_8 Reverse -124 -143 1.17865 0.185
NP_441738.1_2 Forward -171 -164 15.28 0.0102
NP_441738.1_2 Reverse -166 -173 15.28 0.0102
NP_441738.1_2 Forward -182 -175 10.2652 0.101
NP_441738.1_2 Forward -45 -38 10.2652 0.101
NP_440209.1_1 Reverse -164 -172 18.1123 0.00295
NP_440209.1_1 Forward -173 -165 18.1123 0.00295
NP_440447.1_1 Forward -178 -160 2.67408 0.278
NP_440447.1_6 Reverse -156 -174 4.05072 0.181
NP_441713.1_1 Reverse -158 -177 -4.72043 0.113
NP_441713.1_1 Reverse -169 -188 -8.35868 0.148
NP_441713.1_1 Forward -179 -160 -16.2252 0.278
NP_441770.1_10 Reverse -339 -358 11.7992 0.226
NP_440178.1_7 Reverse -163 -182 -20.3551 0.188
NP_440178.1_7 Reverse -181 -200 -21.3384 0.218
NP_440659.1_9 Reverse -155 -174 8.25926 0.297
NP_442570.1_3 Reverse -226 -245 -9.14533 0.296
NP_441716.1_1 Forward -173 -159 7.9644 0.153
NP_441327.1_5 Forward -72 -63 12.7828 0.29
NP_442111.1_4 Reverse -163 -177 18.3875 0.00707
NP_442111.1_4 Forward -174 -160 17.5025 0.00997
NP_441163.1_1 Reverse -156 -173 9.28121 0.226
NP_441163.1_1 Reverse -228 -245 8.69123 0.226
NP_440343.1_3 Reverse -337 -355 3.8533 0.266
NP_440906.1_5 Forward -172 -165 15.8704 0.0124
NP_440906.1_5 Reverse -165 -172 15.8704 0.0124
NP_440906.1_5 Reverse -292 -299 8.79057 0.149
NP_442442.1_5 Reverse -51 -70 9.43923 0.224
NP_440747.1_10 Forward -176 -164 17.1486 0.000663
NP_440747.1_10 Reverse -161 -173 15.2803 0.0019
NP_440747.1_10 Reverse -172 -184 -2.4193 0.0434
NP_440747.1_10 Reverse -386 -398 -11.7607 0.142
NP_442973.1_5 Reverse -155 -174 21.2389 0.0357
NP_441486.1_1 Forward -176 -162 -2.26202 0.175
NP_442634.1_4 Forward -175 -161 7.76774 0.0479
NP_442634.1_4 Reverse -162 -176 6.58777 0.0489
NP_441265.1_3 Forward -179 -165 3.24451 0.181
NP_441695.1_4 Reverse -351 -369 15.6538 0.155
NP_442848.1_1 Reverse -158 -172 -0.885388 0.263
NP_442848.1_5 Forward -393 -375 2.67408 0.276
NP_442848.1_5 Forward -399 -381 -0.374176 0.276
NP_442848.1_9 Reverse -341 -360 -0.39387 0.278
NP_441012.1_4 Forward -396 -383 5.42749 0.297
NP_443018.1_3 Forward -172 -165 14.8871 0.0123
NP_443018.1_3 Reverse -165 -172 14.8871 0.0123
NP_443018.1_3 Reverse -390 -397 4.36568 0.254
NP_443018.1_3 Forward -397 -390 4.07068 0.299
NP_441316.1_7 Reverse -162 -177 -1.98672 0.24
NP_440376.1_1 Forward -173 -164 19.4693 0.000692
NP_440376.1_1 Reverse -164 -173 19.4693 0.000692
NP_440376.1_1 Forward -398 -389 7.37455 0.0786
NP_440376.1_1 Reverse -389 -398 7.07956 0.0869
NP_440376.1_1 Reverse -38 -47 3.7363 0.195
NP_440376.1_1 Reverse -175 -184 3.04799 0.21
NP_442687.1_7 Reverse -163 -173 18.5646 0.0028
NP_442687.1_7 Forward -174 -164 9.02648 0.0994
NP_442687.1_7 Forward -399 -389 5.09324 0.221
NP_442191.1_4 Forward -367 -353 11.4779 0.256
NP_442191.1_5 Reverse -345 -359 15.7319 0.297
NP_441077.1_6 Forward -77 -61 11.8641 0.136
NP_441846.1_10 Forward -368 -349 -12.6852 0.193
NP_441846.1_10 Forward -371 -352 -21.1417 0.256
NP_441846.1_10 Forward -365 -346 -21.3384 0.256
NP_441846.1_10 Forward -373 -354 -21.4367 0.256
NP_440642.1_10 Reverse -65 -79 14.4536 0.119
NP_441422.1_7 Reverse -36 -53 -6.64766 0.252
NP_442658.1_1 Reverse -162 -172 14.8275 0.0188
NP_442658.1_1 Forward -175 -165 14.2375 0.0237
NP_442198.1_7 Forward -188 -169 9.53674 0.27
NP_440617.1_3 Forward -181 -162 16.0274 0.0651
NP_441855.2_4 Reverse -156 -175 21.3811 0.0104
NP_442782.1_2 Reverse -164 -178 10.7177 0.173
NP_442782.1_2 Forward -131 -117 0.392915 0.29
NP_442544.1_6 Reverse -31 -50 -5.60541 0.298
NP_441414.1_6 Reverse -129 -148 -4.6221 0.26
NP_441414.1_9 Reverse -164 -183 -6.49039 0.196
NP_441478.1_6 Forward -205 -186 11.8967 0.229
NP_441256.1_1 Forward -395 -376 -3.44213 0.233
NP_442321.1_1 Forward -175 -156 -3.73712 0.214
NP_441958.1_5 Forward -174 -164 21.2195 0.000805
NP_441958.1_5 Reverse -163 -173 20.5312 0.000966
NP_441958.1_5 Reverse -388 -398 -6.90313 0.293
NP_440203.1_5 Forward -170 -160 14.3359 0.0886
NP_440984.1_7 Forward -178 -164 10.1277 0.126
NP_439990.1_6 Reverse -49 -68 11.9958 0.197
NP_442376.1_2 Reverse -159 -178 -12.5869 0.286
NP_442911.1_2 Reverse -379 -398 5.30933 0.0341
NP_442911.1_2 Reverse -154 -173 2.65439 0.0491
NP_442911.1_2 Forward -183 -164 -1.57384 0.0871
NP_441580.1_6 Reverse -325 -344 6.19431 0.117
NP_441580.1_6 Forward -184 -165 -6.39206 0.235
NP_440153.1_5 Reverse -165 -179 5.30946 0.191
NP_440153.1_5 Forward -108 -94 3.44117 0.212
NP_440153.1_8 Forward -398 -385 6.70579 0.17
NP_441591.1_10 Forward -361 -342 4.42435 0.297
NP_442064.1_1 Reverse -159 -178 -13.2752 0.285
NP_440993.1_2 Forward -178 -162 5.17175 0.237
NP_440993.1_3 Forward -183 -164 5.50519 0.151
NP_440827.1_1 Forward -365 -346 14.6508 0.24
NP_440138.1_6 Forward -189 -170 2.55527 0.267
NP_441099.1_5 Forward -183 -164 -7.37537 0.174
NP_442002.1_1 Forward -367 -349 1.49411 0.185
NP_442002.1_1 Forward -374 -356 -5.88071 0.249
NP_442002.1_9 Reverse -163 -170 14.1004 0.074
NP_441654.1_6 Reverse -59 -77 15.1852 0.229
NP_440809.1_9 Forward -182 -164 -8.04399 0.225
NP_440809.1_9 Forward -193 -175 -9.12563 0.297
NP_440475.1_2 Forward -224 -205 16.8412 0.256
NP_441294.1_7 Forward -188 -174 10.0185 0.213
NP_441646.1_1 Reverse -157 -176 7.96426 0.152
NP_441646.1_1 Forward -54 -35 2.16274 0.221
NP_442438.1_10 Reverse -384 -398 4.71948 0.142
NP_442438.1_10 Forward -178 -164 4.71948 0.142
NP_440377.1_1 Reverse -59 -76 19.6808 0.0615
NP_441000.1_6 Reverse -163 -177 5.70279 0.0933
NP_440147.1_4 Reverse -162 -175 20.2755 0.00228
NP_440147.1_4 Forward -175 -162 10.639 0.0355
NP_440147.1_4 Forward -302 -289 4.8375 0.146
NP_440147.1_4 Reverse -324 -337 3.65753 0.183
NP_440147.1_4 Forward -400 -387 -0.275709 0.279
NP_441175.1_7 Forward -173 -154 5.80098 0.271
NP_441550.1_8 Reverse -162 -172 17.6791 0.00754
NP_441550.1_8 Forward -175 -165 15.8108 0.0132
NP_441916.1_7 Reverse -164 -174 18.9579 0.00144
NP_441916.1_7 Forward -173 -163 16.893 0.00407
NP_441916.1_7 Reverse -291 -301 2.7333 0.243
NP_440345.1_3 Forward -155 -141 15.2903 0.209
NP_440465.1_10 Reverse -338 -357 3.24438 0.251
NP_441041.1_4 Reverse -164 -183 -8.55534 0.204
NP_441041.1_4 Forward -368 -349 -13.7669 0.295
NP_441041.1_7 Reverse -161 -173 18.01 0.00663
NP_441041.1_7 Forward -176 -164 13.3454 0.0485
NP_441041.1_7 Forward -303 -291 5.18252 0.272
NP_442004.1_6 Reverse -38 -52 7.37441 0.161
NP_442004.1_6 Forward -173 -159 5.99778 0.181
NP_441725.1_4 Reverse -159 -173 10.2254 0.129
NP_441725.1_4 Forward -178 -164 4.03056 0.278
NP_441725.1_5 Forward -172 -162 11.7798 0.0247
NP_441725.1_5 Reverse -165 -175 1.94665 0.115
NP_441406.1_2 Forward -368 -349 10.9142 0.257
NP_439966.1_7 Forward -175 -165 14.3359 0.0203
NP_442941.1_3 Reverse -165 -175 19.2529 0.00262
NP_442941.1_3 Forward -172 -162 2.53664 0.14
NP_442941.1_3 Reverse -390 -400 0.766681 0.171
NP_440289.1_2 Forward -176 -163 6.01747 0.0605
NP_440289.1_2 Reverse -161 -174 -2.43899 0.255
NP_440983.1_5 Forward -398 -379 0.392778 0.214
NP_442281.1_1 Reverse -159 -173 21.73 0.00192
NP_442281.1_1 Forward -178 -164 8.55376 0.0798
NP_442281.1_1 Forward -305 -291 4.12889 0.206
NP_441079.1_6 Forward -149 -130 19.8623 0.108
NP_442901.1_4 Reverse -364 -383 -1.57384 0.284
NP_442575.1_8 Forward -375 -356 -7.17871 0.298
NP_440177.1_9 Reverse -381 -400 14.4541 0.213
NP_442256.1_2 Forward -175 -157 -8.53565 0.227
NP_442012.1_1 Forward -179 -160 15.2408 0.058
NP_439983.1_1 Reverse -353 -371 14.9646 0.203
NP_440723.1_10 Reverse -53 -72 17.3803 0.24
NP_440498.1_1 Forward -182 -164 10.8356 0.0786
NP_440498.1_1 Forward -193 -175 -1.84914 0.232
NP_442982.1_5 Reverse -154 -173 -3.44213 0.298
NP_440375.1_8 Forward -183 -164 3.14605 0.22
NP_441644.1_6 Reverse -164 -174 19.0557 0.000803
NP_441644.1_6 Forward -173 -163 15.7125 0.0048
NP_441644.1_6 Reverse -389 -399 13.0576 0.0244
NP_441644.1_6 Forward -398 -388 6.0761 0.167
NP_442215.1_2 Forward -175 -159 0.0585348 0.157
NP_442215.1_2 Reverse -162 -178 -2.39974 0.197
NP_442215.1_2 Forward -358 -342 -6.33298 0.268
NP_441810.1_5 Reverse -348 -367 6.68596 0.297
NP_440929.1_8 Forward -173 -164 19.2726 0.000701
NP_440929.1_8 Reverse -164 -173 19.2726 0.000701
NP_442933.1_10 Forward -173 -164 17.601 0.00325
NP_442933.1_10 Reverse -164 -173 17.601 0.00325
NP_442933.1_10 Reverse -389 -398 5.11294 0.204
NP_441751.2_8 Reverse -165 -179 7.27608 0.0339
NP_441751.2_8 Forward -172 -158 -1.67204 0.13
NP_442554.1_8 Reverse -165 -175 17.2863 0.00543
NP_442554.1_8 Forward -172 -162 14.238 0.0144
NP_442554.1_8 Forward -397 -387 7.45319 0.092
NP_442554.1_8 Reverse -390 -400 5.38824 0.15
NP_441762.1_7 Reverse -163 -175 1.7106 0.0735
NP_441762.1_7 Forward -174 -162 0.432302 0.0747
NP_442142.1_4 Reverse -161 -174 12.5067 0.0442
NP_442142.1_4 Forward -176 -163 6.21356 0.17
NP_442292.1_1 Reverse -165 -174 17.5026 0.00435
NP_442292.1_1 Forward -172 -163 9.53783 0.0183
NP_442292.1_1 Forward -397 -388 5.99792 0.125
NP_442292.1_1 Reverse -390 -399 -0.68859 0.268
NP_442292.1_5 Reverse -372 -391 6.98095 0.157
NP_442476.1_6 Reverse -165 -179 10.521 0.0692
NP_442476.1_6 Forward -46 -32 2.06454 0.195
NP_442476.1_6 Forward -299 -285 0.982901 0.233
NP_440895.1_3 Forward -48 -29 15.7004 0.258
NP_443009.1_5 Forward -174 -163 17.0694 0.00659
NP_443009.1_5 Reverse -163 -174 16.7744 0.00677
NP_443009.1_5 Forward -48 -37 13.0378 0.0389
NP_443009.1_5 Reverse -376 -387 9.69459 0.0913
NP_441715.1_4 Reverse -165 -175 16.7946 0.0106
NP_441448.1_1 Reverse -329 -348 6.98095 0.236
NP_442076.1_5 Forward -126 -107 7.17762 0.256
NP_440183.1_9 Reverse -342 -361 -12.4886 0.256
NP_441198.1_8 Reverse -162 -172 12.5877 0.12
NP_440379.1_5 Forward -188 -169 -1.86883 0.194
NP_440379.1_5 Forward -368 -349 -7.27704 0.242
NP_440379.1_5 Forward -135 -116 -9.24366 0.262
NP_441468.1_1 Forward -172 -165 15.8704 0.0124
NP_441468.1_1 Reverse -165 -172 15.8704 0.0124
NP_441468.1_1 Reverse -390 -397 4.46401 0.224
NP_439939.1_4 Reverse -56 -75 -1.27885 0.278
NP_441020.2_6 Forward -367 -350 15.0835 0.0446
NP_441020.2_6 Forward -175 -158 11.3469 0.123
NP_441020.2_7 Forward -202 -183 7.4718 0.269
NP_441015.1_10 Forward -367 -348 0.58944 0.165
NP_441015.1_10 Forward -361 -342 -3.14714 0.185
NP_441015.1_10 Forward -369 -350 -8.752 0.277
NP_441673.1_1 Forward -173 -164 20.8459 0.000698
NP_441673.1_1 Reverse -164 -173 20.8459 0.000698
NP_441673.1_1 Reverse -389 -398 1.67135 0.0404
NP_441673.1_1 Forward -398 -389 1.47469 0.0936
NP_442253.1_5 Reverse -35 -52 7.90532 0.145
NP_441826.1_2 Reverse -158 -172 10.521 0.0471
NP_441826.1_2 Forward -179 -165 -3.34366 0.284
NP_441826.1_2 Reverse -235 -249 -4.7203 0.299
NP_441330.1_1 Forward -178 -159 5.01433 0.0304
NP_442811.1_2 Reverse -381 -400 -2.95047 0.281
NP_441764.1_8 Forward -71 -61 10.9279 0.291
NP_442868.1_6 Forward -175 -165 10.4031 0.038
NP_442868.1_6 Reverse -162 -172 9.12481 0.0539
NP_442868.1_6 Forward -400 -390 0.865012 0.205
NP_442719.1_2 Reverse -1 -19 -9.61797 0.267
NP_442719.1_2 Reverse -2 -20 -11.6829 0.294
NP_442559.1_3 Reverse -208 -227 7.47261 0.291
NP_442227.1_2 Reverse -349 -368 1.76941 0.243
NP_442808.1_1 Reverse -163 -173 8.73102 0.0481
NP_442808.1_1 Forward -174 -164 8.73102 0.0481
NP_441101.1_10 Reverse -342 -361 2.26107 0.173
NP_440145.1_3 Reverse -154 -173 1.57275 0.126
NP_440145.1_3 Forward -345 -326 -3.44213 0.198
NP_442542.1_2 Reverse -387 -400 12.2123 0.114
NP_442113.1_10 Reverse -340 -359 -0.590531 0.205
NP_442050.1_5 Forward -175 -165 15.9091 0.0091
NP_442050.1_5 Forward -186 -176 9.41933 0.193
NP_442050.1_5 Reverse -162 -172 6.96107 0.27
NP_440334.1_2 Forward -75 -62 14.3756 0.252
NP_440558.1_2 Forward -51 -32 -5.21209 0.254
NP_441878.1_6 Reverse -163 -173 20.2362 0.0046
NP_441878.1_6 Forward -174 -164 10.5014 0.0176
NP_441878.1_6 Reverse -388 -398 2.53664 0.0363
NP_441878.1_6 Reverse -233 -243 0.373358 0.144
NP_441878.1_6 Forward -244 -234 0.275027 0.146
NP_441878.1_6 Forward -399 -389 -0.118297 0.167
NP_441878.1_6 Forward -357 -347 -6.90313 0.198
NP_441878.1_6 Reverse -234 -244 -7.88644 0.278
NP_441036.1_8 Forward -174 -164 15.713 0.00724
NP_441036.1_8 Reverse -163 -173 8.4365 0.174
NP_441557.1_5 Forward -173 -164 19.9609 0.000699
NP_441557.1_5 Reverse -164 -173 19.9609 0.000699
NP_441557.1_5 Reverse -389 -398 0.786375 0.106
NP_441557.1_5 Forward -398 -389 0.589713 0.134
NP_442777.1_1 Reverse -355 -374 16.1249 0.158
NP_440101.1_3 Forward -178 -159 7.07928 0.18
NP_441458.1_10 Reverse -155 -174 1.27776 0.292
NP_442183.1_1 Forward -173 -159 9.2427 0.0999
NP_440676.1_1 Forward -214 -195 11.9958 0.262
NP_442397.1_9 Forward -54 -35 5.30933 0.246
NP_442397.1_9 Forward -191 -172 5.11266 0.249
NP_441549.1_9 Reverse -160 -178 -5.78238 0.198
NP_442347.1_2 Forward -172 -163 3.34298 0.284
NP_442347.1_2 Reverse -165 -174 3.34298 0.284
NP_442645.1_2 Forward -55 -36 -14.3569 0.173
NP_442645.1_2 Forward -181 -162 -22.42 0.291
NP_441037.1_4 Reverse -162 -172 17.3558 0.0127
NP_441037.1_4 Forward -175 -165 7.22024 0.237
NP_442594.1_7 Reverse -153 -172 4.91521 0.261
NP_441633.1_3 Forward -175 -162 5.72248 0.0481
NP_441633.1_3 Reverse -162 -175 -6.07724 0.236
NP_440136.1_2 Forward -172 -165 15.9687 0.0123
NP_440136.1_2 Reverse -165 -172 15.9687 0.0123
NP_440136.1_2 Reverse -292 -299 4.26735 0.218
NP_442998.1_5 Forward -71 -61 11.4848 0.184
NP_442998.1_10 Forward -171 -164 15.5754 0.0102
NP_442998.1_10 Reverse -166 -173 15.5754 0.0102
NP_440299.1_1 Reverse -160 -173 19.0949 0.00293
NP_440299.1_1 Forward -177 -164 7.39353 0.113
NP_440299.1_1 Reverse -385 -398 3.26365 0.251
NP_440299.1_1 Reverse -343 -356 2.08368 0.299
NP_440299.1_6 Reverse -336 -355 8.35759 0.237
NP_441799.1_1 Reverse -160 -174 10.8154 0.0668
NP_441799.1_1 Forward -177 -163 9.04542 0.1
NP_441799.1_1 Forward -188 -174 7.27547 0.147
NP_441007.1_10 Reverse -384 -397 9.16406 0.104
NP_441007.1_10 Forward -178 -165 1.39592 0.203
NP_441007.1_10 Reverse -159 -172 -0.669033 0.287
NP_440256.1_1 Reverse -161 -180 6.88262 0.0282
NP_440256.1_1 Reverse -172 -191 1.96607 0.0697
NP_440256.1_1 Forward -176 -157 1.57275 0.0733
NP_440087.1_1 Forward -358 -339 -4.72043 0.246
NP_441559.1_8 Forward -178 -164 8.65272 0.0676
NP_441559.1_8 Reverse -159 -173 -6.68692 0.279
NP_441559.1_8 Forward -350 -336 -6.78525 0.279
NP_441559.1_8 Reverse -34 -48 -7.17857 0.287
NP_441559.1_8 Forward -340 -326 -7.57189 0.295
NP_440915.1_6 Forward -177 -163 15.6342 0.0183
NP_440915.1_6 Reverse -160 -174 14.6509 0.0183
NP_440915.1_6 Reverse -385 -399 2.94952 0.11
NP_440915.1_6 Reverse -171 -185 -1.67204 0.243
NP_442855.1_3 Forward -200 -181 15.7324 0.157
NP_441296.1_9 Reverse -350 -363 11.1301 0.233
NP_440717.1_3 Reverse -119 -133 9.53707 0.25
NP_442785.1_7 Forward -228 -214 14.2576 0.228
NP_442785.1_7 Forward -175 -161 10.4227 0.228
NP_442785.1_7 Forward -186 -172 10.3243 0.229
NP_442452.1_3 Forward -381 -362 1.27776 0.282
NP_442866.1_1 Forward -178 -159 4.03102 0.151
NP_442866.1_1 Forward -190 -171 1.67108 0.158
NP_441464.1_8 Reverse -347 -361 11.5043 0.178
NP_440026.1_8 Forward -31 -13 12.9005 0.223
NP_441939.1_3 Reverse -165 -184 10.3242 0.126
NP_442386.1_9 Reverse -335 -344 8.06244 0.209
NP_442386.1_9 Forward -174 -165 6.39082 0.219
NP_442386.1_9 Reverse -163 -172 6.39082 0.219
NP_441340.1_5 Forward -172 -165 15.6737 0.0124
NP_441340.1_5 Reverse -165 -172 15.6737 0.0124
NP_441340.1_5 Forward -397 -390 3.97235 0.274
NP_441340.1_9 Forward -72 -62 8.25522 0.256
NP_442484.1_2 Forward -184 -165 4.32602 0.187
NP_442791.1_5 Forward -55 -36 2.75272 0.21
NP_440327.1_2 Forward -238 -219 15.4374 0.297
NP_440327.1_8 Forward -132 -113 14.5524 0.268
NP_442240.1_2 Forward -172 -153 -19.5684 0.295
NP_442240.1_2 Reverse -165 -184 -19.9617 0.295
NP_440161.1_3 Forward -175 -156 10.0292 0.235
NP_440586.1_8 Forward -172 -165 13.2151 0.026
NP_440586.1_8 Reverse -165 -172 13.2151 0.026
NP_442251.1_6 Forward -172 -165 15.2804 0.0124
NP_442251.1_6 Reverse -165 -172 15.2804 0.0124
NP_440684.1_9 Reverse -158 -172 6.58777 0.298
NP_441262.1_3 Reverse -164 -171 14.7888 0.0223
NP_441262.1_3 Forward -173 -166 14.7888 0.0223
NP_441262.1_4 Forward -296 -277 6.78429 0.268
NP_440027.1_8 Reverse -161 -180 6.29183 0.275
NP_443051.1_1 Forward -174 -165 19.5676 0.00335
NP_443051.1_1 Reverse -163 -172 18.0926 0.00402
NP_443051.1_5 Forward -78 -59 14.6508 0.171
NP_443051.1_5 Forward -77 -58 12.7825 0.202
NP_441232.1_10 Forward -184 -165 0.786102 0.296
NP_439937.1_8 Reverse -381 -400 -0.295539 0.239
NP_439937.1_9 Reverse -163 -180 -5.37003 0.157
NP_439937.1_9 Forward -174 -157 -16.4814 0.287
NP_440408.1_7 Reverse -164 -183 8.55425 0.276
NP_440408.1_7 Forward -370 -351 7.37428 0.29
NP_440408.1_7 Forward -208 -189 7.07928 0.292
NP_440439.1_1 Forward -176 -163 20.0788 0.0105
NP_440439.1_1 Reverse -161 -174 0.117615 0.202
NP_440439.1_1 Reverse -97 -110 -0.570702 0.226
NP_442239.1_8 Reverse -229 -248 4.62101 0.296
NP_439943.1_7 Reverse -159 -178 11.9958 0.14
NP_440372.1_2 Forward -172 -165 16.3621 0.0124
NP_440372.1_2 Reverse -165 -172 16.3621 0.0124
NP_441803.1_2 Forward -43 -24 -0.885524 0.291
NP_439977.1_5 Forward -179 -160 3.14605 0.161
NP_439977.1_6 Forward -200 -182 15.9488 0.271
NP_440139.1_1 Forward -179 -160 6.09517 0.145
NP_441572.1_7 Forward -179 -160 14.2574 0.0295
NP_441572.1_7 Reverse -158 -177 1.0811 0.156
NP_441572.1_7 Reverse -169 -188 -5.9004 0.276
NP_440267.1_2 Forward -178 -164 19.5668 0.0168
NP_442887.1_5 Reverse -53 -72 -13.5702 0.293
NP_442384.1_10 Forward -173 -160 18.0139 0.00545
NP_442384.1_10 Reverse -164 -177 17.9155 0.00564
NP_442384.1_10 Forward -47 -34 3.75586 0.179
NP_440221.1_8 Reverse -256 -275 13.3725 0.205
NP_441631.1_6 Reverse -167 -186 16.0274 0.279
NP_442790.1_4 Reverse -155 -174 -7.86702 0.158
NP_442262.1_10 Forward -172 -165 14.1988 0.0123
NP_442262.1_10 Reverse -165 -172 14.1988 0.0123
NP_441689.1_5 Forward -175 -165 8.3377 0.132
NP_440163.1_9 Forward -345 -326 16.1257 0.281
NP_440344.1_10 Reverse -157 -174 -1.33779 0.0527
NP_440344.1_10 Reverse -382 -399 -8.12263 0.123
NP_440282.1_10 Forward -183 -164 -7.37537 0.251
NP_440531.1_6 Forward -181 -162 -5.11376 0.293
NP_441060.1_4 Reverse -49 -67 7.00065 0.222
NP_442910.1_1 Reverse -157 -176 4.42435 0.118
NP_442910.1_1 Forward -180 -161 -5.01543 0.254
NP_441965.1_3 Forward -57 -38 7.7676 0.133
NP_440297.1_9 Forward -172 -162 9.61647 0.0917
NP_440297.1_9 Reverse -165 -175 -0.216628 0.282
NP_440297.1_9 Reverse -390 -400 -0.41329 0.283
NP_440894.1_2 Reverse -348 -367 -1.18052 0.291
NP_440894.1_2 Reverse -339 -358 -3.3438 0.296
NP_440999.1_9 Reverse -160 -174 0.786239 0.177
NP_440999.1_9 Forward -177 -163 -1.5737 0.242
NP_440888.1_2 Forward -398 -384 17.2068 0.00437
NP_440888.1_2 Reverse -164 -178 15.1419 0.0122
NP_440888.1_2 Reverse -356 -370 7.96378 0.175
NP_440600.1_4 Reverse -156 -174 -5.88071 0.282
NP_439969.1_3 Reverse -159 -178 7.66927 0.141
NP_442277.1_4 Forward -182 -163 1.86696 0.264
NP_441543.1_2 Reverse -165 -174 15.9293 0.00518
NP_441543.1_2 Forward -172 -163 9.34117 0.0818
NP_441543.1_2 Forward -397 -388 5.11294 0.209
NP_442845.1_2 Reverse -383 -397 6.09611 0.217
NP_442845.1_2 Forward -179 -165 5.40779 0.233
NP_442845.1_2 Forward -191 -177 3.93283 0.272
NP_441918.1_10 Forward -375 -357 12.5072 0.28
NP_441469.1_8 Reverse -163 -172 13.3727 0.073
NP_441469.1_8 Forward -174 -165 6.5879 0.227
NP_443064.1_6 Forward -173 -163 13.8273 0.0796
NP_443064.1_6 Reverse -164 -174 10.8217 0.13
NP_442578.1_7 Forward -172 -165 14.5921 0.026
NP_442578.1_7 Reverse -165 -172 14.5921 0.026
NP_440710.1_1 Forward -181 -163 -6.07737 0.22
NP_440220.1_4 Reverse -53 -72 0.686995 0.244
NP_441462.1_2 Reverse -164 -174 20.2362 0.000805
NP_441462.1_2 Forward -173 -163 20.1379 0.000967
NP_441462.1_2 Forward -398 -388 0.275027 0.159
NP_441462.1_2 Reverse -175 -185 -0.41329 0.225
NP_441621.1_7 Reverse -162 -176 2.65453 0.123
NP_443062.1_1 Reverse -164 -182 17.8091 0.0237
NP_443062.1_6 Reverse -156 -175 9.53756 0.125
NP_442204.1_1 Forward -177 -166 11.3667 0.0565
NP_442204.1_1 Reverse -160 -171 8.81013 0.0852
NP_442204.1_1 Forward -339 -328 0.353664 0.281
NP_442204.1_5 Forward -223 -204 0.294447 0.267
NP_441560.1_10 Reverse -156 -175 16.2241 0.0867
NP_440516.1_2 Reverse -158 -176 1.69077 0.189
NP_440516.1_8 Forward -173 -164 16.9127 0.00442
NP_440516.1_8 Reverse -164 -173 16.9127 0.00442
NP_442428.1_5 Forward -172 -165 15.8704 0.0124
NP_442428.1_5 Reverse -165 -172 15.8704 0.0124
NP_442428.1_5 Reverse -390 -397 4.759 0.223
NP_440783.1_5 Forward -363 -344 -6.1954 0.29
NP_442823.1_8 Reverse -164 -183 17.404 0.173
NP_441867.1_2 Forward -373 -354 -13.2752 0.277
NP_440673.1_3 Forward -171 -164 12.4288 0.0426
NP_440673.1_3 Reverse -166 -173 12.4288 0.0426
NP_440865.1_9 Forward -362 -343 -6.78538 0.232
NP_440865.1_9 Forward -179 -160 -9.047 0.273
NP_441052.1_2 Forward -173 -163 10.4031 0.0285
NP_441052.1_2 Reverse -164 -174 10.4031 0.0285
NP_441052.1_2 Reverse -389 -399 7.35486 0.0742
NP_441052.1_2 Forward -398 -388 7.35486 0.0742
NP_442219.1_9 Forward -172 -163 8.25953 0.0681
NP_442219.1_9 Reverse -165 -174 8.25953 0.0681
NP_442219.1_9 Forward -299 -290 5.70292 0.135
NP_440436.1_4 Forward -172 -163 15.9289 0.00508
NP_440436.1_4 Reverse -165 -174 9.24241 0.0871
NP_440436.1_4 Forward -397 -388 4.7192 0.244
NP_441884.1_8 Reverse -163 -182 -1.27885 0.138
NP_442864.1_7 Reverse -320 -338 7.88563 0.274
NP_442907.1_9 Reverse -159 -178 -7.17871 0.294
NP_441719.1_4 Forward -172 -165 16.3621 0.0124
NP_441719.1_4 Reverse -165 -172 16.3621 0.0124
NP_441733.1_10 Reverse -333 -346 6.90245 0.166
NP_441733.1_10 Forward -176 -163 4.05085 0.276
NP_441004.1_1 Forward -362 -343 -9.34199 0.206
NP_441004.1_1 Forward -225 -206 -14.1602 0.265
NP_441004.1_1 Forward -368 -349 -17.7001 0.294
NP_441004.1_4 Forward -330 -320 16.2046 0.154
NP_442813.1_4 Reverse -184 -203 -8.94866 0.299
NP_442366.1_3 Forward -174 -156 1.00246 0.16
NP_442366.1_5 Reverse -161 -171 14.0409 0.0497
NP_440129.1_10 Reverse -157 -171 6.58777 0.177
NP_441115.1_4 Reverse -163 -181 9.85146 0.198
NP_441115.1_4 Forward -174 -156 8.17984 0.257
NP_442206.1_4 Reverse -165 -184 6.39097 0.269
NP_442206.1_10 Forward -173 -158 2.43817 0.201
NP_440328.1_4 Reverse -158 -177 3.34271 0.181
NP_440094.1_2 Forward -31 -12 2.3594 0.254
NP_443054.1_2 Forward -175 -161 6.78443 0.18
NP_441851.1_10 Reverse -163 -173 17.4829 0.0027
NP_441851.1_10 Reverse -335 -345 9.91146 0.109
NP_441851.1_10 Forward -174 -164 8.53483 0.114
NP_441851.1_10 Reverse -388 -398 4.89658 0.24
NP_440611.1_8 Forward -352 -333 17.5024 0.195
NP_441668.1_4 Reverse -154 -173 12.9791 0.0735
NP_442515.1_1 Forward -399 -385 3.93283 0.11
NP_442515.1_1 Reverse -163 -177 -4.81863 0.298
NP_441683.1_1 Reverse -353 -372 12.9875 0.3
NP_442709.1_3 Reverse -157 -176 12.2908 0.109
NP_441349.1_10 Forward -183 -164 9.43923 0.0244
NP_441349.1_10 Reverse -154 -173 -0.4922 0.0947
NP_441349.1_10 Forward -57 -38 -7.96535 0.262
NP_441349.1_10 Reverse -373 -392 -8.26035 0.272
NP_441409.1_6 Reverse -158 -177 -7.4737 0.151
NP_440389.1_3 Reverse -338 -357 15.5357 0.176
NP_440432.1_9 Reverse -292 -307 -0.216765 0.164
NP_440432.1_9 Reverse -165 -180 -5.32998 0.245
NP_440396.1_1 Forward -137 -118 1.76941 0.156
NP_441596.1_2 Forward -126 -107 18.6823 0.0894
NP_441477.1_10 Reverse -93 -111 0.412472 0.283
NP_441124.1_5 Reverse -6 -16 9.95241 0.299
NP_440431.1_3 Forward -399 -380 -9.44032 0.246
NP_440431.1_3 Forward -186 -167 -9.53865 0.25
NP_442450.1_5 Reverse -162 -172 17.3846 0.0267
NP_442168.1_5 Reverse -165 -184 -1.86883 0.264
NP_440588.1_2 Forward -182 -163 15.1424 0.0144
NP_440588.1_2 Reverse -155 -174 7.27595 0.0502
NP_442243.1_1 Forward -179 -161 3.75497 0.2
NP_441570.1_1 Reverse -164 -182 -7.84733 0.0968
NP_441570.1_1 Forward -173 -155 -16.8938 0.257
NP_440078.1_4 Reverse -378 -397 10.2259 0.268
NP_440078.1_8 Reverse -28 -47 2.0644 0.272
NP_441078.1_4 Forward -173 -164 19.6659 0.0007
NP_441078.1_4 Reverse -164 -173 19.6659 0.0007
NP_441078.1_4 Reverse -389 -398 7.96454 0.0404
NP_441078.1_4 Forward -398 -389 0.786375 0.157
NP_441078.1_4 Forward -47 -38 -1.86856 0.272
NP_442388.1_4 Forward -396 -377 13.6666 0.207
NP_440539.1_9 Forward -348 -329 -6.68705 0.287
NP_441663.1_8 Forward -179 -160 0.294447 0.22
NP_442348.1_2 Reverse -38 -47 13.2744 0.198
NP_442443.1_1 Forward -364 -345 0.0977854 0.219
NP_440793.1_1 Reverse -64 -78 11.602 0.279
NP_440526.1_3 Forward -172 -161 8.71129 0.116
NP_440526.1_3 Forward -397 -386 1.23817 0.267
NP_441432.1_8 Forward -174 -165 16.8143 0.00595
NP_441432.1_8 Reverse -163 -172 8.35786 0.0755
NP_441432.1_8 Forward -185 -176 5.21127 0.185
NP_441432.1_8 Reverse -388 -397 4.81794 0.196
NP_441432.1_9 Reverse -64 -77 15.3854 0.14
NP_442320.1_8 Reverse -383 -397 5.80112 0.0316
NP_441732.1_2 Reverse -160 -176 -7.41462 0.0849
NP_441732.1_2 Forward -177 -161 -16.2644 0.165
NP_440760.1_1 Forward -173 -154 -4.03212 0.0386
NP_442797.1_6 Reverse -343 -362 9.29156 0.246
NP_442797.1_7 Reverse -348 -366 0.904127 0.271
NP_441131.1_9 Reverse -339 -358 11.7008 0.164
NP_441072.1_2 Reverse -34 -53 7.37428 0.257
NP_440280.1_10 Reverse -342 -356 20.6484 0.165
NP_440713.1_4 Forward -183 -164 9.24257 0.152
NP_442489.1_7 Forward -173 -164 20.1576 0.000695
NP_442489.1_7 Reverse -164 -173 20.1576 0.000695
NP_442489.1_7 Reverse -389 -398 8.45619 0.0206
NP_442489.1_7 Forward -398 -389 0.786375 0.152
NP_442489.1_7 Reverse -175 -184 -1.57357 0.213
NP_442489.1_7 Reverse -38 -47 -1.96689 0.28
NP_440565.1_7 Reverse -330 -349 4.03102 0.246
NP_442079.1_7 Reverse -165 -184 3.34271 0.212
NP_440559.1_1 Forward -172 -163 17.306 0.00658
NP_440559.1_1 Reverse -165 -174 8.65285 0.0586
NP_441659.2_8 Reverse -164 -174 20.9245 0.000805
NP_441659.2_8 Forward -173 -163 19.3512 0.000966
NP_441659.2_8 Forward -398 -388 13.1564 0.0129
NP_440363.1_7 Reverse -314 -333 17.7112 0.252
NP_442913.1_10 Reverse -155 -174 -5.31042 0.262
NP_441040.1_2 Reverse -381 -400 -9.63698 0.238
NP_441040.1_5 Forward -178 -159 2.65439 0.28
NP_439956.1_7 Reverse -158 -177 1.96607 0.276
NP_442008.1_2 Reverse -161 -180 18.3873 0.062
NP_442776.1_1 Forward -184 -165 7.7676 0.203
NP_442776.1_1 Forward -397 -378 3.24438 0.29
NP_442346.1_5 Reverse -163 -173 17.9746 0.00128
NP_442346.1_5 Forward -174 -164 16.303 0.00248
NP_442346.1_5 Forward -399 -389 11.6814 0.0606
NP_442346.1_5 Reverse -388 -398 6.46988 0.201
NP_440545.1_3 Reverse -160 -177 20.7867 0.00658
NP_440545.1_3 Forward -177 -160 9.97027 0.0362
NP_440545.1_3 Forward -360 -343 -6.05768 0.268
NP_441856.1_8 Reverse -348 -367 11.1109 0.274
NP_440831.1_3 Forward -365 -346 4.93098 0.294
NP_440486.1_6 Forward -174 -155 9.43923 0.23
NP_441653.1_2 Forward -375 -356 12.3233 0.0959
NP_442137.1_1 Reverse -332 -351 5.40766 0.282
NP_442603.1_7 Forward -173 -159 7.3738 0.208
NP_441233.1_9 Forward -396 -377 13.6675 0.236
NP_442828.1_7 Reverse -276 -295 -0.787193 0.276
NP_441888.1_7 Reverse -159 -173 3.53951 0.225
NP_440449.1_6 Reverse -227 -245 6.31057 0.255
NP_441948.1_4 Reverse -157 -175 -2.43913 0.166
NP_441833.1_4 Forward -172 -165 15.9687 0.0124
NP_441833.1_4 Reverse -165 -172 15.9687 0.0124
NP_441895.1_2 Forward -380 -361 -17.5035 0.234
NP_441895.1_10 Forward -83 -64 -18.4868 0.282
NP_442162.1_9 Forward -172 -165 16.2637 0.0124
NP_442162.1_9 Reverse -165 -172 16.2637 0.0124
NP_440671.1_4 Reverse -158 -172 9.43936 0.184
NP_440671.1_4 Forward -179 -165 5.80112 0.271
NP_440224.1_1 Forward -184 -165 9.43923 0.0591
NP_440224.1_1 Forward -152 -133 -3.63879 0.267
NP_442199.1_5 Forward -181 -162 1.0811 0.165
NP_442140.1_3 Forward -172 -162 13.5497 0.0542
NP_442140.1_3 Reverse -165 -175 4.69992 0.238
NP_441671.1_6 Reverse -378 -397 9.73422 0.179
NP_440875.1_9 Reverse -166 -176 16.5483 0.0145
NP_441813.1_5 Forward -175 -165 18.1713 0.00743
NP_441813.1_5 Reverse -162 -172 8.82982 0.0367
NP_440590.1_4 Forward -397 -384 0.117615 0.169
NP_440590.1_4 Forward -172 -159 -4.50394 0.262
NP_440590.1_4 Reverse -165 -178 -5.38892 0.277
NP_440567.1_1 Reverse -165 -179 11.406 0.0286
NP_440567.1_1 Forward -172 -158 3.93283 0.134
NP_440567.1_1 Forward -299 -285 1.27789 0.211
NP_442497.1_10 Forward -172 -163 19.8626 0.00532
NP_442497.1_10 Reverse -165 -174 17.601 0.00813
NP_440821.1_4 Reverse -162 -172 10.9931 0.0146
NP_440821.1_4 Forward -175 -165 2.24165 0.131
NP_441239.1_9 Forward -175 -163 16.5586 0.0166
NP_441239.1_9 Reverse -162 -174 10.7571 0.0723
NP_441239.1_9 Forward -245 -233 4.5622 0.251
NP_440156.1_4 Reverse -60 -70 11.9759 0.176
NP_441892.1_1 Reverse -155 -172 1.61214 0.15
NP_442399.1_2 Reverse -48 -62 18.8785 0.181
NP_440604.1_6 Forward -173 -154 -5.11376 0.267
NP_442193.1_1 Reverse -377 -395 11.2289 0.228
NP_442105.1_9 Forward -337 -323 15.3225 0.285
NP_441017.1_8 Reverse -288 -303 8.33803 0.249
NP_440833.1_6 Reverse -58 -72 8.06211 0.277
NP_441526.1_6 Forward -367 -348 17.0107 0.219
NP_441567.1_4 Reverse -260 -279 2.45773 0.297
NP_442052.1_8 Reverse -162 -172 12.7631 0.253
NP_440546.1_4 Reverse -164 -174 13.5365 0.0459
NP_440546.1_4 Forward -173 -163 12.8578 0.0572
NP_440546.1_4 Reverse -291 -301 9.17338 0.151
NP_441230.1_5 Forward -190 -171 3.83436 0.191
NP_441230.1_5 Forward -178 -159 -1.18052 0.298
NP_440462.1_6 Forward -175 -165 18.7612 0.00454
NP_440462.1_6 Reverse -162 -172 1.455 0.294
NP_442611.1_1 Reverse -326 -345 -2.26216 0.287
NP_440868.1_4 Forward -177 -165 15.0836 0.0164
NP_440868.1_4 Reverse -160 -172 -0.551008 0.274
NP_442499.1_1 Reverse -117 -136 6.58763 0.203
NP_441474.1_1 Reverse -349 -368 -2.26292 0.273
NP_442402.1_10 Forward -382 -372 13.3526 0.204
NP_440036.1_1 Forward -346 -327 11.2092 0.238
NP_442039.1_4 Forward -172 -165 15.1821 0.0124
NP_442039.1_4 Reverse -165 -172 15.1821 0.0124
NP_441811.1_8 Forward -53 -39 6.3911 0.273
NP_440825.1_7 Forward -172 -162 11.8361 0.2
NP_442837.1_3 Forward -172 -165 15.7721 0.0124
NP_442837.1_3 Reverse -165 -172 15.7721 0.0124
NP_440160.1_2 Forward -191 -172 -8.26035 0.286
NP_442053.1_1 Forward -173 -164 18.3876 0.0007
NP_442053.1_1 Reverse -164 -173 18.3876 0.0007
NP_440505.1_3 Forward -175 -165 17.188 0.00332
NP_440505.1_3 Reverse -36 -46 10.7964 0.0968
NP_440505.1_3 Reverse -289 -299 4.60159 0.277
NP_440505.1_3 Reverse -387 -397 4.50326 0.284
NP_440505.1_3 Reverse -173 -183 4.3066 0.3
NP_441102.1_2 Forward -77 -58 5.70265 0.298
NP_441203.1_1 Forward -172 -153 -20.3551 0.297
NP_441408.2_7 Forward -175 -156 1.76941 0.215
NP_440914.1_1 Reverse -164 -174 16.3248 0.00196
NP_440914.1_1 Forward -173 -163 8.51751 0.186
NP_440914.1_1 Reverse -389 -399 6.95605 0.257
NP_441011.1_8 Reverse -165 -174 16.6177 0.00602
NP_441011.1_8 Forward -172 -163 14.356 0.0249
NP_442101.1_10 Forward -181 -162 -12.8819 0.279
NP_442533.1_1 Forward -371 -352 -13.4719 0.237
NP_442533.1_1 Forward -361 -342 -16.0285 0.262
NP_442533.1_6 Forward -173 -164 17.2076 0.00137
NP_442533.1_6 Reverse -164 -173 17.2076 0.00137
NP_442533.1_6 Reverse -389 -398 13.5694 0.021
NP_442533.1_6 Reverse -235 -244 8.25953 0.0776
NP_442533.1_6 Forward -398 -389 8.1612 0.0807
NP_442533.1_6 Forward -243 -234 1.57302 0.294
NP_442533.1_6 Reverse -355 -364 1.37636 0.3
NP_442232.1_3 Reverse -156 -175 -5.31042 0.165
NP_442229.1_1 Forward -175 -161 7.17714 0.198
NP_441482.1_7 Reverse -158 -172 17.9942 0.00499
NP_441482.1_7 Forward -179 -165 -2.85201 0.1
NP_439944.1_9 Reverse -165 -175 9.12481 0.1
NP_439944.1_9 Forward -172 -162 8.82982 0.101
NP_439944.1_9 Reverse -390 -400 7.35486 0.144
NP_439944.1_9 Forward -299 -289 4.99491 0.284
NP_441697.1_5 Reverse -59 -78 -9.2154 0.268
NP_441697.1_5 Forward -76 -57 -10.4568 0.279
NP_440816.1_2 Forward -81 -62 9.53296 0.218
NP_440116.1_5 Reverse -161 -178 5.74204 0.176
NP_440116.1_5 Forward -176 -159 3.57876 0.229
NP_440116.1_8 Reverse -165 -184 11.6025 0.0278
NP_441527.1_4 Forward -83 -64 -12.7486 0.293
NP_440115.1_6 Forward -176 -166 14.0414 0.0615
NP_440115.1_6 Reverse -161 -171 9.61647 0.115
NP_440007.1_9 Reverse -160 -174 3.93283 0.267
NP_439965.1_1 Forward -182 -163 -8.85033 0.278
NP_441347.1_5 Reverse -174 -188 16.8135 0.174
NP_441347.1_5 Forward -179 -165 12.487 0.243
NP_441059.1_2 Forward -375 -356 -5.70374 0.258
NP_441972.1_5 Reverse -165 -184 -0.4922 0.164
NP_441106.1_1 Forward -174 -165 18.486 0.0028
NP_441106.1_1 Reverse -163 -172 9.73449 0.0311
NP_439903.1_6 Forward -176 -157 17.5998 0.0621
NP_442588.1_6 Reverse -284 -303 -2.55715 0.294
NP_442306.1_10 Forward -178 -159 -21.6334 0.282
NP_441286.1_1 Forward -174 -162 6.03717 0.0258
NP_441286.1_1 Forward -399 -387 2.30059 0.0669
NP_441286.1_1 Reverse -388 -400 2.20226 0.0693
NP_441286.1_1 Reverse -163 -175 -3.50094 0.145
NP_440670.1_8 Forward -173 -164 18.3876 0.000699
NP_440670.1_8 Reverse -164 -173 18.3876 0.000699
NP_440670.1_8 Reverse -175 -184 5.40793 0.158
NP_441479.1_1 Reverse -161 -180 13.7658 0.127
NP_441930.1_1 Reverse -160 -179 14.2574 0.179
NP_440886.1_7 Forward -174 -164 8.04271 0.0805
NP_440886.1_7 Reverse -163 -173 8.04271 0.0805
NP_440886.1_7 Forward -399 -389 6.66608 0.115
NP_440886.1_7 Reverse -355 -365 3.32285 0.287
NP_442614.1_2 Forward -328 -314 11.996 0.172
NP_442614.1_2 Forward -364 -350 11.8976 0.176
NP_442614.1_2 Reverse -164 -178 8.25939 0.255
NP_440767.1_2 Forward -28 -9 -4.22878 0.285
NP_442072.1_9 Reverse -163 -181 -1.75081 0.0316
NP_441753.1_10 Forward -193 -174 5.211 0.186
NP_440907.2_8 Forward -172 -162 16.2041 0.0161
NP_440907.2_8 Reverse -165 -175 9.616 0.103
NP_440907.2_8 Forward -299 -289 3.8145 0.297
NP_442264.1_5 Forward -185 -171 11.6026 0.253
NP_441463.1_3 Forward -183 -164 5.70265 0.0709
NP_441463.1_6 Forward -400 -386 8.63851 0.25
NP_441626.1_2 Forward -172 -165 15.7721 0.0124
NP_441626.1_2 Reverse -165 -172 15.7721 0.0124
NP_441626.1_6 Reverse -160 -178 7.3932 0.263
NP_442794.1_1 Reverse -160 -172 12.527 0.0721
NP_442615.1_1 Forward -182 -164 9.16393 0.0264
NP_442615.1_1 Reverse -155 -173 7.68896 0.0306
NP_441742.1_7 Forward -339 -320 12.2908 0.294
NP_440387.1_1 Forward -173 -157 5.27008 0.0333
NP_440387.1_1 Reverse -175 -191 -3.77637 0.167
NP_440387.1_1 Reverse -38 -54 -5.84132 0.254
NP_440855.1_5 Forward -400 -381 4.52188 0.285
NP_441431.1_2 Forward -176 -162 17.0102 0.0303
NP_441431.1_2 Forward -353 -339 6.0955 0.28
NP_441431.1_2 Reverse -161 -175 6.0955 0.28
NP_440634.1_1 Forward -175 -156 13.7658 0.26
NP_441993.1_1 Reverse -158 -177 0.582284 0.297
NP_442805.1_1 Reverse -65 -82 6.62702 0.289
NP_440467.1_3 Forward -184 -165 19.6551 0.04
NP_440467.1_3 Reverse -165 -184 17.2135 0.0703
NP_440114.1_10 Reverse -164 -178 9.04604 0.186
NP_440114.1_10 Reverse -175 -189 5.60446 0.3
NP_442437.1_8 Forward -184 -165 6.39097 0.242
NP_442323.1_7 Reverse -170 -189 2.16195 0.271
NP_441510.2_9 Reverse -165 -184 5.30933 0.273
NP_440293.1_3 Reverse -168 -187 -4.42544 0.263
NP_440293.1_9 Reverse -384 -398 15.113 0.178
NP_441237.1_9 Forward -172 -162 17.188 0.00445
NP_442743.1_4 Forward -172 -153 -5.60541 0.265
NP_442930.1_1 Reverse -60 -70 13.3526 0.239
NP_442930.1_1 Reverse -59 -69 11.091 0.26
NP_441133.1_1 Reverse -27 -46 12.0942 0.273
NP_440457.1_1 Forward -177 -165 10.2654 0.092
NP_440457.1_1 Reverse -160 -172 9.38042 0.0927
NP_440457.1_1 Reverse -385 -397 0.530633 0.25
NP_440798.1_6 Reverse -165 -178 10.8357 0.0721
NP_440798.1_6 Forward -172 -159 2.67422 0.166
NP_442680.1_5 Forward -83 -64 23.2249 0.0362
NP_440942.1_8 Forward -106 -87 11.2092 0.148
NP_440142.1_7 Forward -364 -345 6.29264 0.26
NP_441436.1_8 Reverse -325 -344 9.53756 0.263
NP_440473.1_1 Reverse -119 -138 11.643 0.267
NP_442509.1_9 Forward -173 -163 17.3841 0.00128
NP_442509.1_9 Forward -47 -37 12.3692 0.0947
NP_442509.1_9 Reverse -164 -174 8.04271 0.192
NP_441253.1_8 Reverse -159 -173 17.7221 0.119
NP_440734.1_9 Reverse -346 -365 14.0608 0.203
NP_441159.1_7 Reverse -324 -343 -8.06369 0.264
NP_440554.1_4 Reverse -165 -175 17.9746 0.0131
NP_441761.1_10 Reverse -371 -390 18.0924 0.174
NP_441885.1_5 Forward -173 -163 11.3864 0.00668
NP_441885.1_5 Reverse -164 -174 11.3864 0.00668
NP_441885.1_5 Forward -300 -290 6.37155 0.0618
NP_441885.1_5 Forward -398 -388 2.14332 0.0827
NP_441885.1_5 Reverse -389 -399 1.74999 0.0991
NP_440898.1_5 Reverse -358 -377 9.14423 0.279
NP_442341.1_7 Forward -399 -385 9.83269 0.0697
NP_442341.1_7 Forward -174 -160 6.3911 0.127
NP_442341.1_9 Forward -175 -161 22.7134 0.00232
NP_442341.1_9 Forward -198 -184 5.99717 0.247
NP_441756.1_5 Reverse -160 -179 5.211 0.187
NP_442395.2_4 Reverse -163 -182 5.89851 0.152
NP_442395.2_4 Forward -376 -357 0.0970122 0.279
NP_440191.1_4 Reverse -206 -216 12.5664 0.291
NP_440750.1_5 Forward -17 -3 16.8142 0.0569
NP_443000.1_7 Forward -175 -165 20.3345 0.00223
NP_443000.1_7 Reverse -162 -172 2.04498 0.226
NP_440507.2_3 Reverse -380 -399 9.04509 0.236
NP_440507.2_8 Forward -75 -56 3.14605 0.292
NP_440275.1_3 Forward -175 -165 16.1063 0.0155
NP_440275.1_3 Reverse -162 -172 9.91146 0.046
NP_440091.1_1 Reverse -287 -299 0.530633 0.247
NP_440679.1_10 Forward -366 -347 -21.1417 0.292
NP_439962.1_4 Reverse -348 -367 -2.0655 0.224
NP_439962.1_4 Forward -353 -334 -8.26035 0.292
NP_442495.1_4 Reverse -232 -242 14.4347 0.16
NP_442495.1_5 Reverse -165 -184 9.24257 0.287
NP_440149.1_8 Reverse -377 -396 -2.85214 0.176
NP_441105.1_3 Reverse -378 -397 9.53756 0.0458
NP_441105.1_3 Reverse -153 -172 -4.42544 0.2
NP_441105.1_3 Reverse -170 -189 -8.45701 0.272
NP_440216.1_1 Reverse -164 -178 26.254 0.000481
NP_440216.1_1 Forward -173 -159 -2.16369 0.0482
NP_440216.1_1 Forward -184 -170 -3.147 0.0729
NP_440216.1_9 Reverse -212 -221 5.80125 0.289
NP_440172.1_1 Reverse -164 -174 17.5813 0.00421
NP_440172.1_1 Forward -173 -163 16.303 0.00854
NP_440172.1_1 Reverse -389 -399 2.83163 0.264
NP_442015.1_10 Reverse -160 -173 20.7671 0.00366
NP_442015.1_10 Forward -177 -164 3.75586 0.178
NP_442329.1_8 Reverse -187 -206 6.19431 0.239
NP_441226.1_7 Forward -172 -165 14.4934 0.0123
NP_441226.1_7 Reverse -165 -172 14.4934 0.0123
NP_441226.1_7 Forward -327 -320 6.52862 0.253
NP_441226.1_7 Reverse -356 -363 5.64364 0.286
NP_440198.1_3 Forward -182 -163 13.5683 0.28
NP_441111.1_7 Forward -172 -164 18.7023 0.00294
NP_441111.1_7 Reverse -165 -173 18.7023 0.00294
NP_441111.1_7 Reverse -390 -398 -0.472234 0.131
NP_441111.1_7 Forward -397 -389 -0.668896 0.274
NP_442379.1_10 Forward -180 -163 2.10379 0.223
NP_441766.1_2 Forward -173 -164 17.5026 0.00297
NP_441766.1_2 Reverse -164 -173 17.5026 0.00297
NP_441766.1_2 Reverse -389 -398 4.52295 0.179
NP_442417.1_5 Forward -173 -159 9.83269 0.126
NP_442417.1_5 Reverse -164 -178 4.52282 0.292
NP_440416.1_9 Forward -180 -161 0.884433 0.0499
NP_440416.1_9 Reverse -157 -176 -5.21209 0.0791
NP_440416.1_9 Reverse -348 -367 -10.227 0.14
NP_440416.1_9 Forward -54 -35 -20.3551 0.284
NP_440416.1_9 Reverse -319 -338 -21.24 0.293
NP_440416.1_9 Forward -393 -374 -22.0267 0.3
NP_442552.1_1 Reverse -321 -340 0.786102 0.246
NP_440591.1_9 Reverse -337 -355 6.70565 0.215
NP_442154.1_1 Forward -367 -349 -3.6191 0.125
NP_442154.1_1 Reverse -375 -393 -9.81395 0.192
NP_440261.1_5 Reverse -165 -178 6.60746 0.0318
NP_440261.1_5 Forward -172 -159 -0.669033 0.0655
NP_440988.1_10 Forward -400 -386 10.2235 0.187
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATGGCCACCGCCACAGCAATTCTCCACCAAAGAGCGGGGGACGGGGAGGCGGCCCAGGGTTCCCAGCAGGTGGCCCAACGGACTCAGACCTTAATCAACGAGCTATCCCTACCCGGCTTACCAGAAAAATTGACCGAGTTGGAACAGAGTTTAGACGGCCCCGGGCCCTACGAAGCCTTTTTGCAACGGTGGAACTATGACCAAGAGCAGCGGGAAGCCATTCGCCAGGCGATCGCCCAGGTTAAATAGTTACCCCAAAATGGATTGAGGCCGAGGGTTAGGACTACGGCAAGTTATCCGCTCCGGCCCATTTGTCTGATTGGAAAAAAAGGGAAAATTTTTCGTCAGGGGTTGACAATCCCCGGCACAACTGATGTAATGGTAAAAGTCTGAAAAACCT

CDS

No sequence available

Protein

No sequence available