Your browser is old and dusty. Try Google Chrome!

Details for 6803t12

ORF 6803t12
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -292 -306 -0.197071 0.223
NP_440795.1_7 Forward -316 -309 7.31561 0.259
NP_441418.1_6 Forward -273 -254 -29.4015 0.224
NP_441418.1_6 Reverse -173 -192 -29.4015 0.224
NP_440295.1_2 Forward -247 -228 8.25926 0.21
NP_440897.1_6 Forward -182 -163 -1.47628 0.19
NP_441453.1_1 Forward -189 -171 3.75497 0.263
NP_441453.1_4 Reverse -173 -181 6.70593 0.121
NP_440561.1_2 Forward -105 -86 12.5858 0.284
NP_441818.1_1 Reverse -265 -276 8.4163 0.295
NP_441818.1_9 Forward -354 -335 0.196116 0.191
NP_441818.1_9 Forward -264 -245 -1.7705 0.2
NP_441818.1_9 Forward -276 -257 -8.752 0.281
NP_440226.1_1 Reverse -173 -192 13.6675 0.0352
NP_442655.1_2 Reverse -49 -68 1.27776 0.288
NP_442173.1_1 Forward -181 -173 5.82095 0.2
NP_442752.1_4 Reverse -173 -180 13.8055 0.0199
NP_443027.1_4 Reverse -171 -181 9.41981 0.163
NP_443027.1_4 Forward -184 -174 7.45319 0.24
NP_442975.1_10 Forward -186 -172 1.86729 0.29
NP_440784.1_7 Forward -181 -174 6.23397 0.241
NP_440784.1_7 Reverse -174 -181 6.13563 0.241
NP_440061.1_9 Reverse -85 -99 10.9137 0.121
NP_440061.1_9 Reverse -63 -77 6.19383 0.255
NP_441054.1_2 Reverse -350 -369 19.3707 0.0953
NP_441054.1_2 Reverse -111 -130 17.0107 0.118
NP_441054.1_2 Reverse -39 -58 13.4708 0.199
NP_441859.1_3 Reverse -64 -83 3.53858 0.239
NP_442242.1_4 Reverse -174 -181 12.4288 0.0393
NP_440044.1_8 Reverse -78 -97 -2.55715 0.264
NP_440908.1_5 Reverse -40 -57 13.4119 0.161
NP_441035.1_3 Forward -400 -381 2.16274 0.227
NP_440011.1_3 Reverse -40 -58 11.2289 0.216
NP_439918.1_2 Reverse -116 -135 5.60432 0.154
NP_440370.1_10 Forward -191 -172 6.4893 0.291
NP_442110.1_7 Reverse -173 -187 1.17956 0.236
NP_441082.1_10 Reverse -54 -67 9.2624 0.252
NP_441925.1_4 Reverse -326 -345 -17.5041 0.296
NP_440856.1_4 Forward -251 -232 6.29264 0.0772
NP_440856.1_4 Reverse -166 -185 -0.590531 0.183
NP_441083.1_5 Reverse -264 -274 3.81494 0.164
NP_441738.1_2 Forward -180 -173 15.28 0.0102
NP_441738.1_2 Forward -365 -358 6.52862 0.261
NP_440209.1_1 Reverse -173 -181 14.8674 0.012
NP_442889.1_1 Reverse -138 -157 3.44104 0.145
NP_442889.1_1 Reverse -182 -201 -5.40875 0.179
NP_441713.1_1 Reverse -167 -186 -14.5535 0.259
NP_442570.1_3 Forward -190 -171 -4.72043 0.235
NP_442570.1_3 Reverse -379 -398 -9.63698 0.3
NP_442949.1_5 Reverse -342 -361 19.764 0.0876
NP_442111.1_4 Forward -183 -169 10.4227 0.0544
NP_442111.1_4 Reverse -172 -186 2.2612 0.283
NP_440906.1_5 Forward -181 -174 12.0355 0.0724
NP_440906.1_5 Reverse -174 -181 12.0355 0.0724
NP_442596.1_10 Reverse -111 -130 19.5673 0.114
NP_440747.1_10 Reverse -170 -182 -2.4193 0.0434
NP_442330.1_4 Reverse -220 -239 19.8257 0.112
NP_442634.1_4 Reverse -171 -185 6.3911 0.0507
NP_440403.1_4 Reverse -292 -311 2.0644 0.13
NP_440403.1_4 Reverse -226 -245 -4.81876 0.213
NP_441014.1_9 Forward -312 -293 8.25926 0.18
NP_443018.1_3 Forward -181 -174 5.34899 0.212
NP_443018.1_3 Reverse -174 -181 5.34899 0.212
NP_441634.1_8 Forward -296 -282 0.196253 0.237
NP_440376.1_1 Reverse -173 -182 -0.000272808 0.285
NP_440376.1_1 Forward -182 -173 -0.0986038 0.285
NP_441857.1_6 Reverse -121 -131 16.2046 0.199
NP_442687.1_7 Reverse -307 -317 6.96153 0.147
NP_442191.1_4 Forward -181 -167 14.8714 0.073
NP_441846.1_10 Reverse -350 -369 -14.1602 0.218
NP_441846.1_10 Reverse -348 -367 -22.9117 0.271
NP_442658.1_1 Forward -184 -174 7.84605 0.205
NP_442658.1_1 Reverse -327 -337 5.38779 0.269
NP_442782.1_2 Reverse -173 -187 2.75286 0.274
NP_442782.1_2 Reverse -106 -120 0.491246 0.289
NP_442782.1_2 Reverse -116 -130 0.294584 0.291
NP_442205.1_9 Forward -188 -172 -2.20308 0.268
NP_442544.1_2 Reverse -379 -393 -1.37704 0.287
NP_441256.1_4 Forward -295 -276 19.764 0.145
NP_441256.1_8 Reverse -352 -371 15.5357 0.0902
NP_442937.1_5 Forward -278 -259 12.2908 0.113
NP_441958.1_5 Reverse -172 -182 2.53664 0.0409
NP_441958.1_5 Forward -183 -173 1.65166 0.0872
NP_442486.1_6 Reverse -252 -271 3.24438 0.263
NP_442605.1_4 Forward -83 -64 8.16093 0.299
NP_440203.1_5 Reverse -147 -157 10.4026 0.225
NP_441097.1_2 Forward -265 -248 3.87375 0.291
NP_439990.1_5 Reverse -168 -181 8.57408 0.168
NP_442376.1_2 Forward -187 -168 -12.4886 0.286
NP_442536.1_8 Forward -306 -287 18.4857 0.0879
NP_440169.1_1 Forward -153 -134 13.1758 0.0914
NP_441294.1_7 Forward -186 -172 9.63458 0.236
NP_442438.1_10 Forward -187 -173 3.34284 0.163
NP_442431.1_10 Forward -279 -261 14.6705 0.0689
NP_442431.1_10 Forward -276 -258 10.0489 0.12
NP_442431.1_10 Forward -306 -288 6.31233 0.194
NP_441752.1_6 Reverse -95 -114 0.786102 0.26
NP_442870.1_4 Reverse -4 -18 14.2576 0.298
NP_440484.1_3 Reverse -171 -185 11.5043 0.242
NP_440147.1_4 Reverse -63 -76 3.65753 0.183
NP_441550.1_8 Reverse -171 -181 6.46942 0.206
NP_441916.1_7 Forward -182 -172 1.16001 0.293
NP_440206.1_4 Forward -124 -105 1.27698 0.289
NP_442004.1_3 Forward -294 -275 13.4708 0.296
NP_442004.1_6 Reverse -173 -187 7.47274 0.159
NP_441725.1_4 Reverse -168 -182 2.8506 0.279
NP_441725.1_5 Reverse -174 -184 0.0783647 0.215
NP_439966.1_7 Forward -369 -359 7.15773 0.154
NP_439966.1_7 Reverse -171 -181 4.50281 0.269
NP_440202.1_8 Reverse -89 -108 11.0707 0.282
NP_442941.1_3 Forward -181 -171 9.51814 0.0306
NP_442941.1_3 Reverse -174 -184 0.668351 0.19
NP_442281.1_1 Reverse -168 -182 4.91554 0.176
NP_441334.1_7 Forward -184 -165 -10.6203 0.12
NP_441334.1_7 Reverse -171 -190 -12.7836 0.171
NP_441079.1_7 Forward -36 -17 -5.31116 0.264
NP_440018.1_3 Reverse -234 -253 0.786102 0.3
NP_441644.1_6 Reverse -173 -183 12.2709 0.0356
NP_442177.1_5 Reverse -56 -70 9.2427 0.24
NP_442029.1_10 Forward -122 -103 12.6841 0.158
NP_440929.1_8 Forward -182 -173 7.86621 0.0522
NP_440929.1_8 Reverse -173 -182 7.57121 0.0706
NP_442933.1_10 Forward -86 -77 7.86621 0.103
NP_442933.1_10 Reverse -173 -182 5.40793 0.19
NP_442554.1_8 Forward -181 -171 7.55152 0.0893
NP_442554.1_8 Reverse -265 -275 4.60159 0.18
NP_442554.1_8 Reverse -174 -184 4.10993 0.198
NP_442142.1_4 Reverse -291 -304 6.70522 0.158
NP_442142.1_4 Reverse -261 -274 5.82024 0.182
NP_442142.1_4 Reverse -252 -265 2.47701 0.29
NP_442292.1_1 Forward -181 -172 7.76787 0.0615
NP_442292.1_1 Reverse -174 -183 7.07956 0.0825
NP_442292.1_1 Reverse -265 -274 3.7363 0.192
NP_443009.1_5 Reverse -172 -183 4.8764 0.226
NP_442301.1_2 Reverse -324 -343 10.52 0.19
NP_441715.1_4 Forward -181 -171 7.05986 0.118
NP_440620.1_4 Forward -55 -41 14.3354 0.272
NP_441198.1_4 Forward -273 -254 8.84924 0.276
NP_440970.1_6 Reverse -214 -233 18.7798 0.269
NP_440379.1_9 Reverse -253 -266 20.6681 0.101
NP_440464.1_10 Forward -241 -231 13.5811 0.169
NP_441468.1_1 Forward -181 -174 6.13563 0.209
NP_441468.1_1 Reverse -174 -181 6.0373 0.223
NP_441015.1_10 Forward -278 -259 -11.2103 0.292
NP_441673.1_1 Forward -182 -173 1.27803 0.155
NP_441673.1_1 Reverse -173 -182 1.27803 0.155
NP_441876.1_9 Forward -240 -230 12.8609 0.267
NP_441876.1_9 Reverse -149 -159 10.9926 0.28
NP_442868.1_6 Reverse -171 -181 0.57002 0.217
NP_442719.1_2 Forward -375 -357 -9.7163 0.267
NP_442719.1_2 Reverse -145 -163 -10.0113 0.268
NP_440051.1_10 Reverse -249 -261 18.7213 0.134
NP_441612.1_2 Reverse -233 -243 8.06522 0.236
NP_442559.1_3 Reverse -283 -302 8.25926 0.285
NP_442227.1_4 Forward -49 -30 11.8967 0.285
NP_442361.1_3 Reverse -167 -180 10.049 0.272
NP_441101.1_10 Reverse -169 -188 -8.06369 0.297
NP_442820.1_3 Reverse -297 -307 14.3359 0.277
NP_442718.1_2 Forward -162 -143 -0.0988766 0.212
NP_442542.1_2 Reverse -350 -363 4.54251 0.3
NP_442050.1_5 Forward -369 -359 8.63269 0.223
NP_442050.1_5 Forward -184 -174 8.14104 0.241
NP_441114.1_3 Reverse -146 -155 7.57121 0.231
NP_440558.1_2 Forward -298 -279 -7.4737 0.294
NP_441518.1_3 Forward -283 -264 -14.8485 0.283
NP_441036.1_8 Forward -183 -173 13.1564 0.0547
NP_441557.1_4 Reverse -230 -244 10.3243 0.291
NP_441557.1_5 Forward -182 -173 7.66954 0.0443
NP_441557.1_5 Reverse -173 -182 0.983037 0.0911
NP_442777.1_3 Reverse -151 -169 2.96833 0.274
NP_441308.1_8 Forward -184 -174 8.1415 0.278
NP_440101.1_3 Forward -187 -168 2.0644 0.259
NP_442469.1_8 Forward -305 -291 18.0925 0.167
NP_442183.1_1 Reverse -358 -372 8.65272 0.112
NP_442183.1_9 Forward -297 -287 10.0098 0.296
NP_440676.1_3 Reverse -108 -127 6.09597 0.292
NP_440058.1_6 Reverse -185 -204 14.8474 0.0946
NP_441549.1_5 Forward -273 -254 23.6972 0.00933
NP_442347.1_2 Forward -73 -64 8.1612 0.108
NP_442347.1_2 Reverse -374 -383 6.29291 0.175
NP_441037.1_4 Reverse -171 -181 6.14821 0.278
NP_442594.1_8 Forward -171 -152 10.9142 0.175
NP_442594.1_8 Forward -260 -241 2.65439 0.294
NP_442594.1_8 Forward -98 -79 2.45773 0.295
NP_442047.1_2 Forward -301 -287 17.5025 0.161
NP_440151.1_5 Reverse -110 -129 7.27595 0.222
NP_441633.1_3 Reverse -63 -76 -2.04567 0.171
NP_440136.1_2 Forward -181 -174 6.23397 0.171
NP_440136.1_2 Reverse -174 -181 6.13563 0.193
NP_442998.1_10 Forward -180 -173 15.5754 0.0102
NP_440299.1_1 Forward -186 -173 2.772 0.274
NP_440640.1_8 Reverse -336 -355 12.3892 0.26
NP_442333.2_5 Reverse -287 -306 -15.6352 0.299
NP_440256.1_1 Reverse -170 -189 8.06259 0.0239
NP_441559.1_8 Reverse -140 -154 4.52282 0.117
NP_441559.1_8 Forward -250 -236 1.27789 0.156
NP_441559.1_8 Reverse -183 -197 -7.08024 0.283
NP_440915.1_6 Reverse -354 -368 8.65272 0.0522
NP_440915.1_6 Reverse -169 -183 1.47456 0.138
NP_442069.1_4 Reverse -187 -206 3.93269 0.254
NP_440657.1_3 Forward -201 -184 3.97208 0.161
NP_441464.1_10 Reverse -119 -133 13.0776 0.199
NP_441939.1_3 Forward -181 -162 13.1758 0.0913
NP_442993.1_1 Forward -382 -366 -7.51295 0.146
NP_441750.1_1 Forward -168 -149 -5.01543 0.21
NP_441340.1_5 Reverse -174 -181 6.13563 0.175
NP_441340.1_5 Forward -181 -174 5.93897 0.198
NP_442791.1_5 Forward -94 -75 -10.227 0.279
NP_442950.1_7 Reverse -42 -61 15.3391 0.145
NP_440586.1_1 Forward -172 -153 -5.01543 0.28
NP_440586.1_8 Reverse -174 -181 11.4451 0.0645
NP_442251.1_6 Forward -181 -174 12.0355 0.0627
NP_442959.1_6 Reverse -103 -122 -0.4922 0.299
NP_441262.1_3 Reverse -173 -180 14.7888 0.0223
NP_441262.1_3 Forward -182 -175 5.15232 0.265
NP_443051.1_1 Reverse -172 -181 9.93116 0.0146
NP_443051.1_1 Forward -183 -174 7.76787 0.0541
NP_440439.1_1 Reverse -170 -183 0.117615 0.202
NP_440439.1_1 Reverse -107 -120 -0.0790467 0.207
NP_440439.1_1 Forward -185 -172 -1.06236 0.249
NP_440372.1_2 Reverse -174 -181 6.72562 0.0929
NP_440372.1_2 Forward -181 -174 6.62729 0.151
NP_440171.1_3 Forward -157 -138 1.37609 0.294
NP_441789.1_7 Reverse -254 -273 -3.83621 0.28
NP_441293.1_2 Reverse -99 -118 16.6174 0.217
NP_441803.1_2 Reverse -228 -247 0.786102 0.244
NP_440139.1_1 Reverse -233 -252 3.14526 0.214
NP_441572.1_7 Reverse -167 -186 5.11266 0.0892
NP_442384.1_10 Forward -182 -169 6.50913 0.0995
NP_442384.1_10 Forward -74 -61 4.05085 0.17
NP_442572.1_6 Forward -123 -104 9.14423 0.229
NP_442790.1_4 Reverse -349 -368 -14.3569 0.274
NP_442458.1_4 Forward -277 -258 22.3206 0.0252
NP_442910.1_3 Reverse -240 -256 17.2665 0.158
NP_442556.1_10 Forward -252 -233 7.8759 0.299
NP_440297.1_9 Reverse -174 -184 -0.314959 0.282
NP_441896.1_3 Forward -343 -324 -2.45882 0.284
NP_440937.1_5 Reverse -32 -51 9.3409 0.275
NP_440999.1_1 Forward -370 -351 1.47364 0.269
NP_440999.1_9 Forward -318 -304 -0.787057 0.217
NP_440999.1_9 Reverse -242 -256 -2.65535 0.273
NP_440888.1_2 Forward -307 -293 6.88214 0.217
NP_440888.1_4 Forward -89 -75 15.264 0.241
NP_440888.1_9 Forward -128 -109 21.6323 0.0872
NP_440491.1_1 Forward -197 -178 7.79413 0.258
NP_440052.1_5 Reverse -162 -181 -3.83545 0.246
NP_439969.1_1 Reverse -101 -120 -6.58872 0.288
NP_442277.1_2 Reverse -86 -100 10.9143 0.287
NP_442033.1_10 Forward -247 -228 -13.0786 0.281
NP_440575.1_8 Reverse -77 -96 0.0977854 0.185
NP_441543.1_2 Forward -181 -172 6.19458 0.153
NP_440208.1_1 Forward -122 -103 0.786102 0.119
NP_441319.1_6 Forward -184 -165 12.5858 0.277
NP_440982.1_1 Forward -367 -348 3.63691 0.296
NP_441469.1_8 Reverse -263 -272 9.04618 0.227
NP_442315.1_1 Forward -275 -257 15.6538 0.095
NP_443064.1_6 Reverse -65 -75 10.3369 0.16
NP_443064.1_6 Reverse -387 -397 9.17338 0.242
NP_441306.1_10 Forward -377 -363 16.4202 0.247
NP_442578.1_7 Reverse -174 -181 5.93897 0.183
NP_440710.1_1 Reverse -380 -398 -6.4707 0.225
NP_440071.1_1 Reverse -284 -301 8.98622 0.274
NP_441462.1_2 Reverse -173 -183 1.94665 0.0807
NP_441462.1_2 Forward -182 -172 0.668351 0.135
NP_441462.1_5 Forward -172 -153 0.294447 0.296
NP_443062.1_1 Forward -182 -164 8.64343 0.15
NP_442204.1_1 Reverse -169 -180 21.1015 0.0035
NP_442204.1_1 Forward -352 -341 1.33697 0.274
NP_440544.1_5 Reverse -4 -11 13.8024 0.28
NP_442487.1_5 Reverse -172 -191 6.78348 0.198
NP_440516.1_6 Reverse -144 -158 8.55376 0.246
NP_440516.1_8 Reverse -173 -182 8.25953 0.0391
NP_442428.1_5 Forward -181 -174 6.13563 0.209
NP_442428.1_5 Reverse -174 -181 6.0373 0.212
NP_440783.1_5 Reverse -100 -119 -5.11376 0.276
NP_441443.1_1 Forward -171 -152 -5.01543 0.297
NP_442859.1_2 Forward -313 -294 2.85105 0.262
NP_440673.1_3 Forward -180 -173 12.4288 0.0426
NP_441052.1_2 Reverse -264 -274 4.99491 0.135
NP_441052.1_2 Forward -242 -232 3.02829 0.185
NP_442219.1_8 Reverse -245 -264 6.91087 0.282
NP_442219.1_9 Forward -73 -64 1.76968 0.298
NP_440436.1_4 Forward -181 -172 5.9975 0.174
NP_441719.1_4 Reverse -174 -181 6.72562 0.093
NP_441719.1_4 Forward -181 -174 6.62729 0.151
NP_441004.1_1 Reverse -94 -113 -13.8652 0.262
NP_441004.1_2 Reverse -356 -375 0.687771 0.23
NP_440129.1_10 Reverse -166 -180 5.30946 0.185
NP_440328.1_4 Reverse -167 -186 0.294447 0.256
NP_442622.1_1 Forward -310 -291 -7.4737 0.257
NP_442622.1_8 Reverse -264 -282 -19.1554 0.296
NP_442856.1_7 Forward -156 -137 -5.60541 0.283
NP_441668.1_4 Forward -258 -239 -0.295539 0.251
NP_442515.1_1 Reverse -64 -78 2.85119 0.129
NP_440593.1_3 Reverse -156 -175 -6.78538 0.28
NP_440432.1_9 Forward -181 -166 -5.52664 0.253
NP_442843.1_1 Forward -279 -260 -5.80207 0.244
NP_442843.1_1 Reverse -350 -369 -9.24366 0.264
NP_440474.1_8 Reverse -174 -188 6.19383 0.23
NP_440474.1_8 Reverse -196 -210 5.30886 0.251
NP_442006.1_2 Forward -176 -159 -8.51595 0.197
NP_442006.1_2 Forward -303 -286 -13.4325 0.197
NP_441570.1_1 Reverse -173 -191 18.2104 0.00322
NP_441570.1_1 Reverse -77 -95 -17.1888 0.267
NP_441078.1_4 Reverse -173 -182 0.0980582 0.205
NP_441078.1_4 Forward -182 -173 0.0980582 0.205
NP_442348.1_2 Reverse -187 -196 10.1278 0.27
NP_442443.1_1 Forward -113 -94 8.75091 0.119
NP_440526.1_3 Reverse -265 -276 1.3365 0.267
NP_441432.1_8 Reverse -172 -181 7.17789 0.102
NP_441432.1_8 Reverse -64 -73 5.01461 0.191
NP_441732.1_2 Reverse -169 -185 -16.4611 0.167
NP_442003.1_4 Forward -395 -376 11.3075 0.277
NP_440759.1_3 Reverse -325 -344 3.24438 0.255
NP_442797.1_6 Reverse -275 -294 11.3277 0.238
NP_443011.1_4 Forward -265 -246 12.1925 0.212
NP_440713.1_4 Forward -192 -173 16.8141 0.0601
NP_442489.1_7 Forward -182 -173 0.786375 0.152
NP_442489.1_7 Reverse -173 -182 0.589713 0.17
NP_440559.1_1 Forward -181 -172 5.40793 0.14
NP_441659.2_8 Reverse -173 -183 14.238 0.00953
NP_441659.2_8 Forward -182 -172 1.84832 0.224
NP_442913.1_10 Reverse -164 -183 -5.60541 0.271
NP_442008.1_2 Forward -185 -166 2.45773 0.286
NP_441800.1_7 Reverse -326 -344 -1.35749 0.242
NP_440335.1_9 Forward -19 -1 9.45892 0.294
NP_442346.1_1 Forward -306 -287 11.2092 0.27
NP_442346.1_5 Reverse -172 -182 13.648 0.0222
NP_440545.1_3 Forward -186 -169 4.56207 0.0691
NP_440545.1_3 Reverse -169 -186 3.28376 0.0859
NP_440831.1_5 Reverse -354 -373 17.2356 0.299
NP_440010.1_3 Reverse -347 -366 -4.22878 0.25
NP_440010.1_4 Forward -192 -173 -2.95123 0.293
NP_440010.1_10 Forward -147 -128 4.22769 0.246
NP_440010.1_10 Forward -123 -104 2.85105 0.27
NP_440847.1_3 Reverse -160 -174 11.2087 0.271
NP_440847.1_8 Reverse -344 -363 12.9791 0.273
NP_442603.1_7 Reverse -252 -266 8.55376 0.171
NP_441050.1_5 Forward -157 -139 -1.65248 0.265
NP_441948.1_4 Reverse -90 -108 -3.02911 0.181
NP_441833.1_4 Forward -181 -174 14.1004 0.0258
NP_441833.1_4 Reverse -174 -181 6.13563 0.198
NP_441895.1_10 Forward -160 -141 -18.0934 0.281
NP_442162.1_9 Forward -181 -174 6.62729 0.142
NP_442162.1_9 Reverse -174 -181 6.52896 0.178
NP_440671.1_4 Forward -96 -82 4.91614 0.3
NP_442404.1_9 Reverse -255 -269 9.14375 0.279
NP_442045.1_5 Forward -391 -372 -3.04881 0.296
NP_442199.1_5 Forward -200 -181 -4.22878 0.221
NP_442140.1_7 Forward -254 -241 22.4387 0.0704
NP_441696.1_8 Reverse -387 -400 19.6855 0.257
NP_441671.1_10 Forward -173 -154 -0.590531 0.297
NP_440875.1_9 Forward -180 -170 16.5483 0.0145
NP_441813.1_5 Reverse -171 -181 8.33817 0.047
NP_441813.1_5 Forward -184 -174 5.5849 0.118
NP_440590.1_4 Forward -181 -168 1.59258 0.118
NP_440590.1_4 Reverse -100 -113 -2.53732 0.245
NP_440567.1_1 Reverse -174 -188 1.27789 0.211
NP_442497.1_10 Forward -181 -172 7.86621 0.0695
NP_442497.1_10 Reverse -174 -183 5.89959 0.109
NP_440821.1_4 Forward -184 -174 0.766681 0.151
NP_440542.1_2 Reverse -46 -63 14.1002 0.223
NP_440604.1_6 Forward -182 -163 -4.22878 0.244
NP_440354.1_5 Reverse -129 -148 5.99764 0.19
NP_441230.1_5 Reverse -76 -95 1.86774 0.232
NP_440675.1_1 Forward -343 -324 3.93269 0.246
NP_441656.1_6 Reverse -80 -99 13.2741 0.172
NP_440462.1_6 Reverse -171 -181 9.12481 0.0498
NP_440080.2_2 Reverse -35 -49 18.0822 0.165
NP_442611.1_1 Forward -182 -163 7.86593 0.14
NP_441879.1_1 Reverse -253 -272 6.98095 0.234
NP_442479.1_9 Reverse -47 -66 -1.18052 0.21
NP_442402.1_4 Forward -250 -231 -0.39464 0.189
NP_442402.1_10 Forward -241 -231 14.0409 0.182
NP_441811.1_8 Forward -80 -66 15.3392 0.162
NP_442679.1_1 Forward -169 -150 2.85105 0.158
NP_440825.1_8 Forward -135 -116 18.4848 0.147
NP_442837.1_3 Forward -181 -174 6.13563 0.25
NP_442837.1_3 Reverse -174 -181 5.93897 0.265
NP_440160.1_3 Reverse -288 -307 7.37347 0.291
NP_442053.1_1 Forward -244 -235 5.99792 0.153
NP_440505.1_3 Reverse -171 -181 15.9097 0.00857
NP_440505.1_3 Forward -189 -179 7.05986 0.165
NP_440505.1_5 Forward -298 -284 15.5359 0.268
NP_441701.1_3 Reverse -112 -129 6.72535 0.275
NP_440520.1_6 Forward -194 -175 8.35759 0.137
NP_441011.1_8 Forward -181 -172 6.8829 0.18
NP_442533.1_1 Forward -264 -245 -16.6185 0.273
NP_442533.1_6 Forward -307 -298 2.35967 0.259
NP_443016.1_1 Forward -54 -35 -7.67036 0.279
NP_441482.1_7 Reverse -167 -181 -2.95034 0.103
NP_439944.1_9 Reverse -174 -184 13.4514 0.0567
NP_441028.1_6 Reverse -374 -384 9.02601 0.216
NP_441028.1_6 Reverse -163 -173 7.64939 0.218
NP_440115.1_6 Reverse -170 -180 14.0414 0.0615
NP_440115.1_6 Forward -156 -146 4.89658 0.28
NP_440007.1_9 Reverse -169 -183 10.521 0.163
NP_439965.1_1 Reverse -282 -301 -8.16202 0.257
NP_441544.1_1 Forward -206 -194 15.3786 0.254
NP_441106.1_1 Reverse -172 -181 8.65285 0.0522
NP_441106.1_1 Forward -183 -174 5.99792 0.111
NP_441286.1_1 Reverse -172 -184 -6.74586 0.278
NP_440670.1_8 Forward -182 -173 13.2744 0.0157
NP_440670.1_8 Reverse -173 -182 7.37455 0.0774
NP_441479.1_1 Forward -276 -257 9.24257 0.218
NP_440886.1_7 Reverse -263 -273 7.15773 0.103
NP_442614.1_2 Forward -156 -142 8.65272 0.254
NP_442295.1_7 Forward -67 -49 12.4081 0.289
NP_441753.1_10 Forward -387 -368 3.53937 0.214
NP_441808.1_8 Forward -273 -254 14.9458 0.153
NP_440907.2_8 Forward -366 -356 4.30615 0.269
NP_440664.1_4 Forward -58 -39 22.3206 0.00331
NP_442264.1_2 Forward -344 -327 5.64371 0.274
NP_440193.1_7 Forward -155 -141 16.0666 0.285
NP_441463.1_3 Reverse -254 -273 6.88262 0.0575
NP_441463.1_3 Forward -192 -173 -4.72043 0.211
NP_441626.1_2 Forward -181 -174 6.0373 0.212
NP_441626.1_2 Reverse -174 -181 6.0373 0.212
NP_442365.1_7 Reverse -169 -188 3.24438 0.158
NP_442615.1_1 Reverse -56 -74 -4.01242 0.174
NP_442615.1_1 Forward -83 -65 -6.37237 0.244
NP_440387.1_1 Reverse -173 -189 -3.77637 0.167
NP_441488.1_8 Reverse -168 -182 9.43874 0.153
NP_441836.1_2 Forward -188 -169 -2.55715 0.23
NP_440634.1_10 Reverse -243 -262 8.75009 0.221
NP_441993.1_1 Forward -342 -323 3.40855 0.235
NP_441993.1_1 Forward -255 -236 2.92126 0.246
NP_440114.1_10 Reverse -358 -372 7.66941 0.229
NP_440114.1_10 Reverse -173 -187 7.57108 0.231
NP_440114.1_10 Forward -235 -221 7.07942 0.246
NP_442323.1_7 Reverse -168 -187 8.25844 0.163
NP_441311.1_2 Reverse -167 -181 13.1753 0.23
NP_442867.1_8 Forward -395 -376 8.65258 0.231
NP_440457.1_1 Reverse -169 -181 0.628964 0.25
NP_440457.1_1 Forward -186 -174 -1.04266 0.289
NP_442680.1_5 Forward -42 -23 4.56599 0.227
NP_440801.1_8 Forward -265 -246 0.294447 0.255
NP_441984.1_1 Forward -306 -288 10.9339 0.2
NP_441159.1_1 Forward -331 -312 -1.86883 0.226
NP_440554.1_4 Forward -181 -171 8.4365 0.0749
NP_440554.1_4 Reverse -174 -184 7.55152 0.103
NP_442341.1_7 Reverse -232 -246 4.32615 0.194
NP_442341.1_7 Reverse -386 -400 1.47456 0.288
NP_442341.1_7 Forward -245 -231 1.08123 0.299
NP_441173.1_9 Forward -240 -232 12.0154 0.214
NP_440423.1_6 Forward -281 -262 -21.4367 0.294
NP_440423.1_10 Forward -389 -370 11.3075 0.238
NP_443000.1_7 Reverse -171 -181 10.5014 0.0345
NP_440275.1_3 Reverse -171 -181 6.46988 0.105
NP_440275.1_3 Forward -184 -174 6.37155 0.111
NP_440275.1_3 Forward -316 -306 4.69992 0.178
NP_440091.1_1 Forward -186 -174 6.23383 0.098
NP_440679.1_10 Forward -280 -261 -12.7836 0.213
NP_441359.1_5 Forward -304 -285 2.26107 0.272
NP_442495.1_4 Forward -178 -168 16.303 0.0771
NP_442214.1_1 Reverse -338 -357 8.16093 0.298
NP_441105.1_3 Reverse -162 -181 -4.42544 0.2
NP_440216.1_1 Forward -182 -168 -2.16369 0.0482
NP_440216.1_1 Reverse -173 -187 -11.9968 0.236
NP_440216.1_9 Forward -95 -86 8.65285 0.286
NP_440172.1_1 Reverse -65 -75 2.7333 0.268
NP_442371.1_1 Reverse -354 -364 12.2709 0.258
NP_442662.1_5 Forward -78 -64 19.8624 0.175
NP_442015.1_10 Reverse -169 -182 0.904263 0.216
NP_441226.1_7 Forward -118 -111 6.52862 0.253
NP_441111.1_7 Forward -181 -173 8.96754 0.0463
NP_441766.1_2 Forward -182 -173 6.5879 0.0918
NP_441766.1_9 Forward -104 -85 -1.67217 0.272
NP_440416.1_9 Forward -189 -170 -14.4552 0.176
NP_440416.1_9 Reverse -166 -185 -14.4552 0.176
NP_440072.1_5 Forward -349 -331 -1.84914 0.264
NP_442154.1_1 Forward -302 -284 -6.07737 0.129
NP_442154.1_1 Forward -275 -257 -14.3372 0.218
NP_442154.1_1 Forward -272 -254 -17.7788 0.267
NP_442046.1_8 Forward -306 -287 11.5042 0.293
NP_440261.1_5 Forward -181 -168 -3.02898 0.108
NP_440261.1_5 Reverse -88 -101 -4.79893 0.17
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CGGGGCTAATTCCCAACTGGGGAGCAGTGTTGACCCAATCCCTCCAGTCCCAGATGTTGGAGTGGGTGCGCTGTGCTGAATTTAGCTGTGACCGGGCAGCCCTGTTGGCGGTGCAAGACCCGAAAGTGGTGATGTCGGTGCTGATGAAGTTGGCCGGTGGTTCTCCCCAATTGGCTCCTTTACTAAACTTGGATGCTTTCATTGACCAAGCCCGGGAATACGATCGCCTGGGGGAAGATGAAATGGGGGCAATGCTGAGGAATATGCAGACCCAAAACCTGACCCATCCGGTGCCGGTACTCCGGGCCAGGGAAATTGATCGTTGGAGTGATTCCCAAACCTATCAAAACTTGCTCAAGGGCCGCAAAAATGCGTATAATCTGAACACCGAAGAAAACAA

CDS

No sequence available

Protein

No sequence available