Your browser is old and dusty. Try Google Chrome!

Details for 6803t10

ORF 6803t10
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -29 -15 8.06273 0.0937
NP_441061.1_2 Reverse -22 -36 -1.27871 0.255
NP_440557.1_1 Forward -29 -10 4.32602 0.183
NP_440795.1_7 Forward -29 -22 14.6904 0.0123
NP_440795.1_7 Reverse -22 -29 14.6904 0.0123
NP_441418.1_6 Forward -30 -11 -10.817 0.0397
NP_440897.1_6 Reverse -96 -115 -2.95123 0.227
NP_441453.1_4 Reverse -21 -29 16.539 0.00633
NP_441453.1_4 Forward -30 -22 16.539 0.00633
NP_441453.1_7 Forward -296 -289 12.9205 0.23
NP_441453.1_7 Forward -260 -253 12.9205 0.23
NP_442151.1_6 Reverse -21 -35 7.57108 0.194
NP_441818.1_1 Reverse -22 -33 11.4645 0.177
NP_441818.1_9 Forward -351 -332 -1.67217 0.2
NP_440226.1_1 Forward -30 -11 8.75091 0.0823
NP_441630.1_3 Forward -38 -19 1.37609 0.248
NP_440259.1_4 Forward -118 -104 11.1424 0.262
NP_442655.1_2 Forward -360 -341 0.294447 0.293
NP_442173.1_1 Forward -29 -21 15.4574 0.00633
NP_442173.1_1 Reverse -22 -30 15.4574 0.00633
NP_442752.1_4 Forward -30 -23 13.8055 0.0199
NP_442752.1_4 Reverse -21 -28 13.8055 0.0199
NP_442752.1_4 Forward -241 -234 8.20058 0.127
NP_443027.1_4 Reverse -19 -29 14.828 0.0437
NP_443027.1_4 Forward -32 -22 6.46988 0.275
NP_441812.1_3 Forward -31 -17 6.88276 0.287
NP_442975.1_10 Forward -61 -47 2.65393 0.269
NP_440784.1_7 Forward -29 -22 15.9687 0.0123
NP_440784.1_7 Reverse -22 -29 15.9687 0.0123
NP_442909.1_7 Reverse -22 -36 7.96378 0.194
NP_440061.1_9 Reverse -19 -33 17.8952 0.0117
NP_442062.1_8 Forward -30 -20 19.4496 0.000558
NP_442062.1_8 Reverse -21 -31 17.6796 0.00193
NP_441859.1_3 Reverse -20 -39 17.5998 0.0394
NP_441802.1_1 Reverse -372 -391 8.75091 0.22
NP_441802.1_1 Reverse -100 -119 6.68596 0.267
NP_440304.1_4 Forward -32 -22 17.9746 0.00654
NP_440304.1_4 Reverse -19 -29 10.8948 0.051
NP_442242.1_4 Forward -29 -22 14.3954 0.0124
NP_442242.1_4 Reverse -22 -29 14.3954 0.0124
NP_442097.1_2 Reverse -296 -315 5.30933 0.197
NP_440916.1_1 Forward -59 -45 10.7177 0.206
NP_441200.1_3 Forward -47 -28 9.0459 0.259
NP_441200.1_4 Forward -360 -341 5.211 0.297
NP_441935.1_7 Forward -320 -301 10.9142 0.18
NP_441208.1_9 Forward -33 -19 6.09611 0.253
NP_440132.1_1 Forward -32 -14 8.57394 0.269
NP_441925.1_4 Reverse -332 -351 -15.9309 0.275
NP_441083.1_5 Reverse -21 -31 19.3512 0.000718
NP_441083.1_5 Forward -30 -20 11.3864 0.0159
NP_441434.1_7 Reverse -23 -37 3.73617 0.227
NP_441738.1_2 Forward -28 -21 15.28 0.0102
NP_441738.1_2 Reverse -23 -30 15.28 0.0102
NP_440209.1_1 Reverse -21 -29 18.1123 0.00295
NP_440209.1_1 Forward -30 -22 18.1123 0.00295
NP_441444.1_1 Forward -391 -372 3.53937 0.295
NP_442889.1_8 Forward -33 -19 7.76712 0.141
NP_440447.1_5 Forward -379 -369 13.4514 0.289
NP_441909.1_5 Forward -112 -93 15.1416 0.262
NP_442111.1_4 Forward -31 -17 7.86607 0.0849
NP_442111.1_4 Reverse -20 -34 2.65453 0.268
NP_440906.1_5 Forward -29 -22 15.8704 0.0124
NP_440906.1_5 Reverse -22 -29 15.8704 0.0124
NP_440747.1_10 Reverse -18 -30 7.70879 0.00236
NP_440747.1_10 Forward -33 -21 -2.02597 0.0196
NP_440747.1_10 Forward -244 -232 -12.2524 0.254
NP_441130.1_10 Reverse -19 -33 12.0943 0.1
NP_441486.1_1 Reverse -18 -32 4.71948 0.0415
NP_441486.1_1 Forward -33 -19 -6.29359 0.288
NP_442634.1_4 Forward -32 -18 14.0609 0.0209
NP_441014.1_5 Forward -245 -227 14.5721 0.2
NP_442848.1_1 Forward -36 -22 -2.06536 0.263
NP_441012.1_4 Reverse -147 -160 5.72248 0.291
NP_443018.1_3 Forward -29 -22 14.8871 0.0123
NP_443018.1_3 Reverse -22 -29 14.8871 0.0123
NP_441316.1_7 Reverse -19 -34 6.17475 0.107
NP_441316.1_7 Forward -32 -17 5.09311 0.121
NP_441634.1_8 Reverse -329 -343 0.687908 0.219
NP_440376.1_1 Forward -30 -21 19.4693 0.000692
NP_440376.1_1 Reverse -21 -30 19.4693 0.000692
NP_442687.1_7 Forward -31 -21 18.5646 0.0028
NP_442687.1_7 Reverse -20 -30 15.8113 0.0125
NP_442530.1_2 Forward -65 -55 11.6814 0.282
NP_442483.1_6 Reverse -113 -132 13.5683 0.252
NP_441950.1_7 Forward -132 -113 -6.78538 0.273
NP_440887.1_1 Forward -148 -129 16.0676 0.266
NP_440360.1_10 Reverse -23 -37 5.01447 0.227
NP_442658.1_1 Forward -32 -22 17.6791 0.00565
NP_442658.1_1 Reverse -19 -29 15.9091 0.00966
NP_440446.1_6 Forward -318 -299 11.2092 0.298
NP_440141.1_8 Forward -370 -351 6.09597 0.271
NP_440141.1_8 Forward -39 -20 5.50599 0.273
NP_441414.1_9 Reverse -21 -40 14.3558 0.0127
NP_441414.1_9 Forward -30 -11 1.27776 0.0752
NP_441414.1_9 Reverse -96 -115 -1.7705 0.105
NP_440607.1_1 Forward -392 -373 9.14423 0.291
NP_442937.1_5 Forward -246 -227 6.4893 0.278
NP_441958.1_5 Forward -31 -21 20.5312 0.000966
NP_441958.1_5 Reverse -20 -30 12.2714 0.00183
NP_442836.1_5 Forward -36 -17 0.884433 0.294
NP_442836.1_10 Forward -351 -341 9.7148 0.269
NP_439905.1_1 Reverse -22 -35 8.18076 0.236
NP_440984.1_7 Forward -35 -21 11.996 0.122
NP_442911.1_2 Forward -40 -21 21.9273 0.00418
NP_442911.1_2 Reverse -11 -30 10.9142 0.0138
NP_440369.1_2 Reverse -322 -341 15.2399 0.253
NP_442064.1_4 Forward -122 -103 5.70185 0.267
NP_440993.1_2 Reverse -16 -32 1.43517 0.279
NP_440138.1_6 Reverse -22 -41 14.5516 0.109
NP_442995.1_5 Forward -168 -149 11.2092 0.211
NP_441099.1_5 Reverse -11 -30 -9.44032 0.223
NP_442002.1_9 Forward -31 -24 14.1004 0.074
NP_442002.1_9 Reverse -20 -27 10.7572 0.185
NP_442438.1_10 Reverse -16 -30 4.22782 0.15
NP_442431.1_10 Forward -354 -336 1.98577 0.244
NP_442885.1_5 Reverse -234 -253 17.5015 0.139
NP_442885.1_6 Forward -126 -108 12.703 0.219
NP_441000.1_5 Reverse -274 -293 4.12856 0.286
NP_441000.1_6 Forward -31 -17 -3.04867 0.221
NP_442771.1_1 Forward -32 -14 -4.99573 0.166
NP_441674.1_10 Reverse -243 -261 1.88744 0.259
NP_440147.1_4 Reverse -19 -32 13.0973 0.0326
NP_440147.1_4 Forward -32 -19 2.67422 0.203
NP_440147.1_4 Reverse -230 -243 -0.669033 0.294
NP_441550.1_8 Forward -32 -22 19.8424 0.00352
NP_441550.1_8 Reverse -19 -29 6.0761 0.214
NP_441916.1_7 Forward -30 -20 18.4663 0.00144
NP_441916.1_7 Reverse -21 -31 16.893 0.00407
NP_441916.1_10 Reverse -379 -398 8.84924 0.165
NP_440465.1_10 Forward -33 -14 0.687771 0.285
NP_441041.1_4 Forward -30 -11 -5.9004 0.16
NP_441041.1_7 Forward -33 -21 12.4708 0.0611
NP_441041.1_7 Reverse -18 -30 7.61196 0.162
NP_442396.1_5 Reverse -17 -30 6.80412 0.219
NP_443063.1_2 Reverse -296 -315 8.55425 0.283
NP_441725.1_5 Reverse -22 -32 18.7612 0.0119
NP_441725.1_5 Forward -29 -19 11.2881 0.0247
NP_439966.1_7 Reverse -19 -29 18.4657 0.00473
NP_439966.1_7 Forward -32 -22 8.14104 0.14
NP_439966.1_9 Forward -32 -23 0.983037 0.253
NP_439966.1_9 Reverse -19 -28 0.983037 0.253
NP_442941.1_3 Forward -29 -19 11.4848 0.0116
NP_442941.1_3 Reverse -22 -32 2.43831 0.14
NP_440289.1_2 Reverse -18 -31 14.6706 0.0107
NP_440289.1_2 Forward -33 -20 4.73917 0.0649
NP_441678.1_9 Forward -253 -234 -3.63879 0.288
NP_442281.1_1 Reverse -16 -30 19.8618 0.00247
NP_442281.1_1 Forward -35 -21 9.73373 0.0675
NP_442256.1_2 Forward -32 -14 -8.33898 0.221
NP_440437.1_1 Reverse -223 -242 -1.67217 0.205
NP_442500.1_2 Forward -32 -13 8.45592 0.283
NP_442012.1_1 Reverse -15 -34 7.7676 0.108
NP_440498.1_1 Reverse -12 -30 9.0656 0.0786
NP_441644.1_6 Reverse -21 -31 15.7125 0.0048
NP_441644.1_6 Forward -30 -20 10.1076 0.0628
NP_441071.1_2 Forward -62 -43 12.2703 0.291
NP_442215.1_2 Forward -369 -353 -6.52964 0.273
NP_440253.1_2 Forward -30 -12 4.14905 0.106
NP_440929.1_8 Forward -30 -21 19.2726 0.000701
NP_440929.1_8 Reverse -21 -30 19.2726 0.000701
NP_442933.1_10 Forward -30 -21 17.601 0.00325
NP_442933.1_10 Reverse -21 -30 17.601 0.00325
NP_441751.2_8 Forward -29 -15 6.98109 0.0344
NP_441751.2_8 Reverse -22 -36 3.44117 0.0661
NP_442554.1_8 Reverse -22 -32 16.9913 0.0065
NP_442554.1_8 Forward -29 -19 13.8447 0.0145
NP_441762.1_7 Reverse -20 -32 11.7404 0.0142
NP_441762.1_7 Forward -31 -19 11.4454 0.0142
NP_442142.1_4 Reverse -18 -31 10.4418 0.0724
NP_442142.1_4 Forward -33 -20 6.50855 0.163
NP_442142.1_4 Reverse -93 -106 4.54195 0.217
NP_442292.1_1 Forward -29 -20 9.63616 0.0183
NP_442292.1_1 Reverse -22 -31 9.53783 0.0183
NP_442476.1_6 Reverse -22 -36 16.8142 0.0367
NP_442476.1_6 Forward -29 -15 11.701 0.0552
NP_443009.1_5 Forward -31 -20 20.6093 0.001
NP_443009.1_5 Reverse -20 -31 9.10461 0.0965
NP_441715.1_4 Forward -29 -19 16.303 0.0117
NP_440279.1_2 Forward -41 -22 6.4893 0.25
NP_440183.1_1 Forward -308 -289 7.86593 0.259
NP_441198.1_8 Forward -32 -22 15.2245 0.0427
NP_441468.1_1 Forward -29 -22 15.8704 0.0124
NP_441468.1_1 Reverse -22 -29 15.8704 0.0124
NP_441020.2_6 Reverse -19 -36 18.6234 0.0112
NP_441020.2_6 Forward -32 -15 15.9685 0.034
NP_441673.1_1 Forward -30 -21 20.8459 0.000698
NP_441673.1_1 Reverse -21 -30 20.8459 0.000698
NP_441826.1_2 Forward -36 -22 1.47456 0.151
NP_441826.1_2 Reverse -15 -29 1.08123 0.164
NP_441393.1_2 Reverse -37 -56 11.9948 0.272
NP_442811.1_2 Forward -357 -338 -0.4922 0.252
NP_442490.1_9 Forward -42 -23 -8.06369 0.282
NP_442868.1_6 Forward -32 -22 16.7946 0.0131
NP_442868.1_6 Reverse -19 -29 0.963343 0.205
NP_442719.1_2 Reverse -273 -291 -9.51964 0.266
NP_441251.1_7 Forward -68 -55 11.6223 0.27
NP_442677.1_3 Forward -271 -252 -5.60541 0.287
NP_442427.1_8 Forward -39 -20 10.1275 0.168
NP_441911.1_7 Reverse -199 -218 -19.0774 0.275
NP_442808.1_1 Reverse -20 -30 18.4657 0.00201
NP_442808.1_1 Forward -31 -21 8.73102 0.0481
NP_442808.1_1 Reverse -306 -316 1.06124 0.296
NP_441101.1_1 Forward -32 -14 9.45892 0.286
NP_442542.1_2 Forward -32 -19 13.9823 0.114
NP_442050.1_5 Forward -32 -22 14.9258 0.0175
NP_442050.1_5 Reverse -19 -29 9.12434 0.193
NP_440342.1_1 Forward -349 -330 12.2908 0.263
NP_440601.1_8 Forward -115 -96 15.4507 0.184
NP_442789.1_4 Forward -372 -353 -4.81876 0.264
NP_440093.1_7 Reverse -284 -303 12.3892 0.196
NP_441878.1_6 Forward -31 -21 20.2362 0.0046
NP_441878.1_6 Reverse -20 -30 10.4031 0.0176
NP_441878.1_6 Reverse -231 -241 8.82982 0.0281
NP_441878.1_6 Forward -242 -232 -7.88644 0.278
NP_441036.1_6 Forward -343 -325 12.7038 0.292
NP_441036.1_8 Reverse -20 -30 17.7779 0.000554
NP_441036.1_8 Forward -31 -21 8.4365 0.174
NP_441557.1_5 Forward -30 -21 19.9609 0.000699
NP_441557.1_5 Reverse -21 -30 19.9609 0.000699
NP_441590.1_4 Reverse -335 -354 5.11187 0.279
NP_442066.2_9 Forward -34 -21 12.8023 0.154
NP_441308.1_8 Reverse -19 -29 10.1081 0.22
NP_442183.1_1 Reverse -21 -35 21.5341 0.00376
NP_442183.1_1 Forward -30 -16 20.6491 0.00378
NP_441549.1_9 Forward -34 -16 -6.66736 0.203
NP_442347.1_2 Forward -29 -20 11.1111 0.056
NP_442347.1_2 Reverse -22 -31 3.34298 0.284
NP_442888.1_6 Reverse -214 -233 2.85105 0.247
NP_441037.1_4 Forward -32 -22 18.9151 0.00351
NP_441037.1_4 Reverse -19 -29 7.02532 0.237
NP_442317.1_6 Reverse -16 -35 1.86774 0.296
NP_441633.1_3 Reverse -19 -32 15.4572 0.0103
NP_441633.1_3 Forward -32 -19 -5.88057 0.236
NP_442764.1_8 Reverse -251 -270 4.22769 0.262
NP_440136.1_2 Forward -29 -22 15.9687 0.0123
NP_440136.1_2 Reverse -22 -29 15.9687 0.0123
NP_442998.1_5 Reverse -49 -59 14.238 0.151
NP_442998.1_5 Reverse -293 -303 10.8948 0.201
NP_442998.1_5 Forward -65 -55 9.91146 0.232
NP_442998.1_10 Forward -28 -21 15.5754 0.0102
NP_442998.1_10 Reverse -23 -30 15.5754 0.0102
NP_440299.1_1 Reverse -17 -30 10.4418 0.0573
NP_440299.1_1 Forward -34 -21 9.26181 0.0749
NP_441799.1_1 Forward -34 -20 16.1252 0.0153
NP_441799.1_1 Reverse -17 -31 6.29216 0.176
NP_441007.1_10 Forward -35 -22 18.4072 0.0299
NP_441007.1_10 Reverse -16 -29 1.69091 0.203
NP_441559.1_8 Reverse -16 -30 -6.98191 0.281
NP_442860.1_9 Reverse -338 -351 13.6867 0.245
NP_440915.1_6 Forward -34 -20 5.30946 0.091
NP_440915.1_6 Reverse -17 -31 3.8345 0.1
NP_440915.1_6 Forward -245 -231 -0.885388 0.212
NP_442866.1_1 Forward -35 -16 -3.93378 0.222
NP_441464.1_8 Reverse -21 -35 15.4376 0.102
NP_441199.1_6 Reverse -17 -36 8.35759 0.106
NP_439985.1_7 Forward -352 -333 6.29264 0.192
NP_442993.1_1 Forward -30 -14 -9.38124 0.185
NP_442993.1_1 Forward -395 -379 -12.0362 0.265
NP_442386.1_9 Reverse -20 -29 15.7322 0.0144
NP_442386.1_9 Forward -31 -22 6.39082 0.219
NP_441340.1_5 Forward -29 -22 15.6737 0.0124
NP_441340.1_5 Reverse -22 -29 15.6737 0.0124
NP_442240.1_2 Forward -29 -10 -14.7502 0.188
NP_440161.1_3 Forward -32 -13 14.3558 0.121
NP_440161.1_3 Reverse -19 -38 9.83255 0.237
NP_440586.1_8 Forward -29 -22 13.2151 0.026
NP_440586.1_8 Reverse -22 -29 13.2151 0.026
NP_440586.1_8 Forward -104 -97 5.8403 0.283
NP_442251.1_6 Forward -29 -22 15.2804 0.0124
NP_442251.1_6 Reverse -22 -29 15.2804 0.0124
NP_440684.1_9 Reverse -15 -29 6.88276 0.288
NP_441262.1_3 Reverse -21 -28 14.7888 0.0223
NP_441262.1_3 Forward -30 -23 14.7888 0.0223
NP_443051.1_1 Forward -31 -22 18.0926 0.00402
NP_443051.1_1 Reverse -20 -29 10.4228 0.00754
NP_440451.1_10 Reverse -226 -245 9.7334 0.264
NP_439984.1_3 Forward -37 -23 13.6669 0.219
NP_439937.1_9 Reverse -20 -37 -6.74666 0.157
NP_439937.1_9 Forward -31 -14 -16.5797 0.287
NP_440439.1_1 Reverse -18 -31 17.5222 0.0105
NP_440439.1_1 Forward -33 -20 1.39592 0.156
NP_442239.1_8 Forward -166 -147 10.0292 0.249
NP_440372.1_2 Forward -29 -22 16.3621 0.0124
NP_440372.1_2 Reverse -22 -29 16.3621 0.0124
NP_441803.1_2 Reverse -16 -35 -1.27885 0.297
NP_439977.1_5 Reverse -15 -34 1.27776 0.195
NP_442384.1_10 Forward -30 -17 13.884 0.018
NP_442384.1_10 Reverse -21 -34 10.344 0.0461
NP_442121.1_4 Forward -262 -243 -0.983855 0.226
NP_442790.1_4 Forward -39 -20 -0.885524 0.0987
NP_442262.1_10 Forward -29 -22 14.1988 0.0123
NP_442262.1_10 Reverse -22 -29 14.1988 0.0123
NP_441689.1_5 Reverse -19 -29 8.53436 0.132
NP_440163.1_10 Reverse -18 -28 16.303 0.0762
NP_440344.1_10 Forward -37 -20 -3.50107 0.0833
NP_440344.1_10 Reverse -14 -31 -7.53264 0.118
NP_442123.1_3 Reverse -21 -40 19.469 0.0449
NP_441965.1_10 Forward -33 -17 19.3314 0.0186
NP_442750.1_1 Forward -68 -49 8.16011 0.261
NP_442693.1_6 Reverse -306 -325 -0.688862 0.295
NP_440297.1_9 Reverse -22 -32 9.51814 0.0917
NP_440297.1_9 Forward -29 -19 9.32148 0.0917
NP_440350.1_1 Forward -59 -40 0.58944 0.21
NP_440894.1_10 Reverse -240 -259 5.80098 0.227
NP_440937.1_5 Forward -160 -141 8.35759 0.287
NP_440999.1_9 Reverse -17 -31 7.86607 0.082
NP_440888.1_2 Forward -30 -16 11.307 0.0705
NP_440888.1_2 Reverse -21 -35 7.17714 0.205
NP_440888.1_2 Reverse -325 -339 6.48882 0.232
NP_440888.1_4 Forward -355 -341 15.5556 0.241
NP_440575.1_8 Forward -62 -43 1.17943 0.18
NP_440575.1_8 Reverse -86 -105 0.687771 0.185
NP_441543.1_2 Forward -29 -20 18.486 0.00236
NP_441543.1_2 Reverse -22 -31 9.34117 0.0818
NP_442845.1_2 Reverse -15 -29 5.1128 0.243
NP_441551.1_5 Reverse -17 -33 5.85938 0.293
NP_441469.1_8 Reverse -20 -29 16.126 0.00797
NP_441469.1_8 Forward -31 -22 13.3727 0.073
NP_443064.1_6 Reverse -21 -31 13.8273 0.0796
NP_442578.1_7 Forward -29 -22 14.5921 0.026
NP_442578.1_7 Reverse -22 -29 14.5921 0.026
NP_440071.1_4 Reverse -232 -251 15.4374 0.234
NP_441462.1_2 Reverse -21 -31 20.1379 0.000967
NP_441462.1_2 Forward -30 -20 11.5831 0.00406
NP_441621.1_7 Forward -32 -18 14.2576 0.0266
NP_441621.1_7 Reverse -19 -33 -3.24533 0.188
NP_443062.1_1 Forward -30 -12 9.03346 0.142
NP_443062.1_6 Reverse -13 -32 17.6007 0.0578
NP_443062.1_6 Forward -38 -19 3.73603 0.229
NP_440519.1_8 Forward -253 -237 1.92682 0.273
NP_442204.1_1 Forward -245 -234 0.451995 0.281
NP_442204.1_1 Forward -376 -365 0.0586712 0.284
NP_442204.1_1 Reverse -17 -28 -0.137991 0.286
NP_442204.1_5 Forward -40 -21 6.58763 0.142
NP_440516.1_6 Reverse -145 -159 7.27547 0.281
NP_440516.1_8 Forward -30 -21 16.9127 0.00442
NP_440516.1_8 Reverse -21 -30 16.9127 0.00442
NP_442428.1_5 Forward -29 -22 15.8704 0.0124
NP_442428.1_5 Reverse -22 -29 15.8704 0.0124
NP_442120.1_10 Forward -395 -376 -9.44032 0.242
NP_440673.1_3 Forward -28 -21 12.4288 0.0426
NP_440673.1_3 Reverse -23 -30 12.4288 0.0426
NP_440673.1_3 Forward -229 -222 6.3323 0.283
NP_440673.1_7 Forward -41 -22 2.45773 0.226
NP_441052.1_2 Forward -30 -20 10.5014 0.0285
NP_441052.1_2 Reverse -21 -31 10.4031 0.0285
NP_442219.1_9 Forward -29 -20 8.35786 0.0681
NP_442219.1_9 Reverse -22 -31 8.25953 0.0681
NP_440436.1_4 Forward -29 -20 18.1905 0.00233
NP_440436.1_4 Reverse -22 -31 15.9289 0.00508
NP_440436.1_4 Reverse -233 -242 8.35743 0.109
NP_441884.1_9 Reverse -229 -248 -24.485 0.288
NP_441884.1_9 Reverse -18 -37 -25.4683 0.29
NP_441884.1_9 Forward -33 -14 -26.4516 0.29
NP_442086.1_3 Forward -29 -10 10.9142 0.196
NP_441086.1_3 Reverse -268 -287 5.07931 0.29
NP_441719.1_4 Forward -29 -22 16.3621 0.0124
NP_441719.1_4 Reverse -22 -29 16.3621 0.0124
NP_441733.1_10 Forward -33 -20 16.6372 0.0423
NP_441733.1_10 Reverse -18 -31 6.01747 0.203
NP_441004.1_1 Forward -36 -17 -8.752 0.202
NP_441004.1_1 Forward -259 -240 -16.7168 0.287
NP_441004.1_5 Forward -34 -20 10.1277 0.248
NP_442813.1_2 Forward -314 -295 -0.000545616 0.273
NP_442366.1_3 Forward -31 -13 -3.71743 0.255
NP_442366.1_3 Forward -397 -379 -5.38906 0.287
NP_442206.1_10 Forward -30 -15 15.0245 0.0799
NP_443054.1_2 Reverse -19 -33 10.3243 0.0761
NP_443054.1_2 Forward -243 -229 4.71948 0.24
NP_441851.1_10 Forward -31 -21 17.4829 0.0027
NP_441851.1_10 Reverse -20 -30 16.008 0.00552
NP_441851.1_10 Reverse -373 -383 6.37155 0.172
NP_441668.1_4 Forward -40 -21 19.174 0.0435
NP_442515.1_1 Reverse -20 -34 16.7159 0.0227
NP_442515.1_1 Forward -31 -17 4.03116 0.109
NP_440593.1_3 Reverse -227 -246 -4.72043 0.251
NP_442709.1_3 Forward -37 -18 2.55606 0.294
NP_441349.1_10 Forward -40 -21 -6.78538 0.236
NP_441409.1_6 Reverse -15 -34 -14.1602 0.252
NP_440432.1_9 Reverse -22 -37 7.45305 0.0427
NP_442843.1_1 Forward -360 -341 8.55425 0.118
NP_440474.1_8 Forward -29 -15 4.42388 0.279
NP_441124.1_5 Reverse -278 -288 11.3848 0.257
NP_442450.1_5 Forward -32 -22 10.1081 0.115
NP_442450.1_5 Reverse -19 -29 9.32148 0.115
NP_440588.1_2 Reverse -12 -31 5.99764 0.06
NP_440588.1_2 Forward -39 -20 -0.39387 0.15
NP_440040.1_1 Reverse -14 -32 12.1139 0.21
NP_442006.1_2 Reverse -287 -304 -18.8407 0.296
NP_442243.1_1 Reverse -368 -386 -1.06322 0.266
NP_441078.1_4 Forward -30 -21 19.6659 0.0007
NP_441078.1_4 Reverse -21 -30 19.6659 0.0007
NP_441078.1_4 Forward -241 -232 -1.86856 0.272
NP_442729.1_5 Forward -106 -96 16.4013 0.176
NP_442729.1_8 Forward -34 -21 19.7838 0.0312
NP_442729.1_8 Reverse -17 -30 9.36073 0.125
NP_441663.1_8 Reverse -15 -34 0.786102 0.214
NP_442443.1_4 Reverse -99 -109 14.1392 0.229
NP_440526.1_3 Reverse -22 -33 11.4645 0.0646
NP_441432.1_8 Forward -31 -22 8.35786 0.0755
NP_441432.1_8 Reverse -20 -29 8.25953 0.0755
NP_441432.1_8 Forward -396 -387 2.65466 0.292
NP_442320.1_8 Reverse -15 -29 5.30946 0.0394
NP_442320.1_8 Forward -36 -22 -3.44199 0.122
NP_442320.1_9 Forward -349 -335 17.0108 0.211
NP_441732.1_2 Reverse -17 -33 -7.61128 0.0861
NP_440760.1_1 Reverse -21 -40 5.11266 0.0142
NP_442797.1_7 Forward -353 -335 1.10079 0.265
NP_441945.1_10 Forward -59 -40 12.5858 0.214
NP_442353.1_3 Reverse -236 -255 6.98015 0.299
NP_442400.1_10 Reverse -202 -215 13.0487 0.194
NP_440713.1_3 Reverse -364 -383 6.58763 0.212
NP_442489.1_7 Forward -30 -21 20.1576 0.000695
NP_442489.1_7 Reverse -21 -30 20.1576 0.000695
NP_442489.1_7 Forward -241 -232 -1.37691 0.195
NP_441706.1_2 Reverse -21 -40 19.2723 0.106
NP_442079.1_7 Reverse -22 -41 0.392778 0.286
NP_442079.1_7 Forward -29 -10 -0.197208 0.29
NP_440559.1_1 Reverse -22 -31 17.306 0.00658
NP_440559.1_1 Forward -29 -20 8.75118 0.0586
NP_441659.2_8 Reverse -21 -31 19.3512 0.000966
NP_441659.2_8 Forward -30 -20 11.9764 0.0147
NP_440860.1_8 Forward -32 -13 14.4541 0.296
NP_441022.1_1 Forward -62 -53 11.0666 0.284
NP_442913.1_10 Forward -39 -20 -2.85214 0.192
NP_442913.1_10 Reverse -223 -242 -5.40875 0.264
NP_440779.1_5 Reverse -21 -38 -5.86102 0.152
NP_442346.1_5 Forward -31 -21 17.9746 0.00128
NP_442346.1_5 Reverse -20 -30 9.02648 0.118
NP_442346.1_5 Forward -242 -232 5.19158 0.256
NP_442346.1_5 Forward -235 -225 4.3066 0.291
NP_440545.1_3 Forward -34 -17 6.03703 0.0578
NP_441856.1_3 Forward -33 -14 0.786102 0.213
NP_441629.1_3 Reverse -30 -49 3.04693 0.218
NP_442027.1_5 Forward -323 -304 10.9142 0.274
NP_440847.1_3 Forward -304 -290 12.0937 0.254
NP_442603.1_7 Reverse -21 -35 13.4703 0.0877
NP_442603.1_7 Forward -30 -16 5.50552 0.29
NP_441888.1_7 Reverse -16 -30 3.53951 0.225
NP_441047.1_2 Reverse -365 -384 -3.3438 0.294
NP_441833.1_4 Forward -29 -22 15.9687 0.0124
NP_441833.1_4 Reverse -22 -29 15.9687 0.0124
NP_442162.1_9 Forward -29 -22 16.2637 0.0124
NP_442162.1_9 Reverse -22 -29 16.2637 0.0124
NP_440671.1_4 Reverse -15 -29 11.406 0.133
NP_442140.1_3 Reverse -22 -32 14.828 0.0433
NP_442140.1_3 Forward -104 -94 9.02648 0.115
NP_442140.1_3 Forward -29 -19 8.33817 0.119
NP_440875.1_9 Forward -28 -18 9.05339 0.233
NP_441813.1_5 Reverse -19 -29 17.188 0.00979
NP_441813.1_5 Forward -32 -22 8.92815 0.0347
NP_440594.1_8 Reverse -22 -35 10.3434 0.168
NP_440590.1_4 Reverse -22 -35 -5.68391 0.286
NP_440567.1_1 Forward -29 -15 13.8643 0.0196
NP_440567.1_1 Reverse -22 -36 5.80112 0.0959
NP_442497.1_10 Reverse -22 -31 19.8626 0.00532
NP_442497.1_10 Forward -29 -20 10.4228 0.0087
NP_440821.1_4 Forward -32 -22 19.5479 0.00399
NP_440821.1_4 Reverse -19 -29 19.0562 0.00399
NP_440227.1_8 Forward -357 -340 13.4119 0.131
NP_441239.1_9 Forward -32 -20 17.0502 0.0153
NP_441239.1_9 Reverse -19 -31 16.8536 0.0155
NP_441727.1_3 Forward -37 -18 5.01433 0.257
NP_441727.1_8 Forward -252 -233 1.0811 0.238
NP_441892.1_1 Reverse -223 -240 -3.5994 0.244
NP_440604.1_6 Reverse -21 -40 6.19431 0.107
NP_440740.1_8 Reverse -95 -114 19.57 0.0563
NP_441017.1_2 Reverse -80 -99 17.0107 0.29
NP_441017.1_6 Forward -245 -231 13.2736 0.2
NP_441874.1_1 Forward -221 -207 12.1926 0.24
NP_441874.1_1 Forward -109 -95 9.63603 0.277
NP_440833.1_6 Reverse -199 -213 8.65209 0.272
NP_440876.1_5 Reverse -23 -42 9.3409 0.277
NP_440949.1_7 Reverse -13 -32 15.7316 0.162
NP_442138.1_1 Reverse -223 -242 -0.0996487 0.298
NP_440546.1_4 Reverse -21 -31 12.8578 0.0572
NP_440546.1_4 Forward -30 -20 11.8882 0.0679
NP_440546.1_7 Forward -52 -42 13.943 0.292
NP_440462.1_6 Reverse -19 -29 15.418 0.0142
NP_440462.1_6 Forward -32 -22 10.4031 0.0396
NP_442611.1_5 Forward -395 -381 18.2892 0.182
NP_440868.1_4 Reverse -17 -29 17.7386 0.0124
NP_440868.1_4 Forward -34 -22 2.69391 0.149
NP_440868.1_7 Reverse -338 -357 14.7483 0.254
NP_440868.1_8 Forward -34 -15 -1.96717 0.263
NP_441879.1_6 Forward -348 -329 11.9958 0.295
NP_442479.1_9 Forward -333 -314 -11.8003 0.275
NP_442402.1_4 Reverse -237 -256 -10.1294 0.297
NP_441848.1_4 Forward -71 -55 7.74165 0.288
NP_440696.1_3 Forward -241 -223 -4.11075 0.296
NP_442039.1_4 Forward -29 -22 15.1821 0.0124
NP_442039.1_4 Reverse -22 -29 15.1821 0.0124
NP_442039.1_7 Reverse -98 -108 13.5497 0.211
NP_442039.1_7 Forward -259 -249 10.8948 0.257
NP_441811.1_8 Forward -36 -22 8.25939 0.238
NP_442837.1_3 Forward -29 -22 15.7721 0.0124
NP_442837.1_3 Reverse -22 -29 15.7721 0.0124
NP_440160.1_2 Forward -254 -235 -2.55715 0.245
NP_440160.1_9 Reverse -363 -382 7.7676 0.277
NP_442053.1_1 Forward -30 -21 18.3876 0.0007
NP_442053.1_1 Reverse -21 -30 18.3876 0.0007
NP_440505.1_3 Reverse -19 -29 13.8447 0.0247
NP_440505.1_3 Forward -32 -22 7.84651 0.147
NP_441959.1_8 Reverse -194 -207 8.8057 0.286
NP_441959.1_10 Forward -266 -248 10.9461 0.277
NP_442532.1_7 Reverse -21 -35 5.01447 0.171
NP_440914.1_1 Forward -30 -20 8.6151 0.186
NP_440914.1_1 Reverse -21 -31 8.51751 0.186
NP_441011.1_8 Forward -29 -20 16.9127 0.00602
NP_441011.1_8 Reverse -22 -31 14.356 0.0249
NP_442533.1_6 Forward -30 -21 17.2076 0.00137
NP_442533.1_6 Reverse -21 -30 17.2076 0.00137
NP_442533.1_6 Forward -241 -232 3.7363 0.204
NP_442541.1_10 Reverse -341 -355 10.9137 0.186
NP_442232.1_3 Forward -38 -19 -3.93378 0.163
NP_441482.1_7 Forward -36 -22 6.3911 0.0298
NP_441482.1_7 Reverse -15 -29 -1.67204 0.0787
NP_439944.1_9 Reverse -22 -32 17.4829 0.00423
NP_439944.1_9 Forward -29 -19 10.3048 0.0887
NP_441028.1_6 Forward -300 -290 10.6976 0.197
NP_441028.1_6 Forward -55 -45 10.6976 0.197
NP_441028.1_6 Reverse -247 -257 7.74772 0.218
NP_440116.1_5 Reverse -18 -35 2.98877 0.249
NP_440115.1_6 Forward -33 -23 10.0098 0.115
NP_441961.1_4 Forward -255 -236 10.7175 0.23
NP_441972.1_5 Reverse -22 -41 -9.34199 0.283
NP_441106.1_1 Reverse -20 -29 18.191 0.0028
NP_441106.1_1 Forward -31 -22 9.73449 0.0311
NP_439903.1_6 Reverse -18 -37 2.45694 0.226
NP_442306.1_10 Reverse -16 -35 -20.945 0.237
NP_441286.1_1 Reverse -20 -32 14.6903 0.00418
NP_441286.1_1 Forward -31 -19 5.05386 0.0259
NP_441286.1_1 Forward -106 -94 -2.71429 0.145
NP_441286.1_1 Forward -242 -230 -6.2542 0.254
NP_440670.1_8 Forward -30 -21 18.3876 0.000699
NP_440670.1_8 Reverse -21 -30 18.3876 0.000699
NP_441930.1_1 Forward -34 -15 10.8159 0.194
NP_440886.1_7 Reverse -20 -30 17.7774 0.0011
NP_440886.1_7 Forward -31 -21 8.04271 0.0805
NP_442072.1_9 Forward -31 -13 -12.0756 0.0812
NP_442072.1_9 Forward -255 -237 -21.9087 0.215
NP_442072.1_9 Reverse -150 -168 -22.892 0.266
NP_442213.1_5 Forward -350 -331 -1.7705 0.293
NP_440907.2_8 Reverse -22 -32 19.449 0.00351
NP_440907.2_8 Forward -29 -19 7.84605 0.117
NP_441463.1_3 Reverse -11 -30 -8.06369 0.264
NP_441463.1_6 Reverse -19 -33 7.28563 0.262
NP_441463.1_6 Reverse -384 -398 5.93276 0.287
NP_441626.1_2 Forward -29 -22 15.7721 0.0124
NP_441626.1_2 Reverse -22 -29 15.7721 0.0124
NP_442365.1_7 Reverse -17 -36 -4.03212 0.232
NP_442615.1_1 Forward -39 -21 4.83737 0.0426
NP_442615.1_1 Reverse -12 -30 -3.6191 0.165
NP_441962.1_4 Forward -35 -16 -1.96717 0.127
NP_440387.1_1 Forward -30 -14 13.0382 0.00969
NP_440387.1_1 Reverse -21 -37 5.95839 0.0297
NP_441431.1_2 Reverse -18 -32 8.94708 0.2
NP_441431.1_2 Forward -264 -250 8.3571 0.218
NP_441193.1_1 Reverse -339 -358 8.75009 0.292
NP_440114.1_10 Reverse -21 -35 12.6843 0.0754
NP_440114.1_10 Forward -30 -16 6.09611 0.285
NP_441817.1_10 Forward -32 -13 15.9291 0.199
NP_441500.1_2 Forward -215 -196 12.3892 0.238
NP_440766.1_2 Forward -298 -282 15.2991 0.284
NP_440766.1_4 Reverse -17 -31 5.40779 0.112
NP_439988.1_3 Forward -355 -341 11.3077 0.219
NP_441237.1_9 Reverse -22 -32 17.2863 0.00348
NP_442930.1_1 Reverse -281 -291 11.9759 0.242
NP_439910.1_2 Reverse -13 -30 -2.91109 0.0305
NP_439910.1_2 Reverse -194 -211 -13.6292 0.162
NP_440457.1_1 Forward -34 -22 8.10212 0.101
NP_440457.1_1 Reverse -17 -29 1.21895 0.244
NP_442680.1_5 Reverse -374 -393 0.169919 0.268
NP_440473.1_9 Forward -41 -22 -7.4737 0.236
NP_442509.1_9 Reverse -21 -31 17.3841 0.00128
NP_442509.1_9 Forward -30 -20 16.2041 0.00739
NP_442439.1_8 Reverse -95 -114 11.6025 0.221
NP_442514.1_5 Forward -305 -286 -2.55791 0.221
NP_440554.1_4 Forward -29 -19 14.6313 0.02
NP_440554.1_4 Reverse -22 -32 6.27322 0.123
NP_441885.1_5 Forward -30 -20 11.4848 0.00668
NP_441885.1_5 Reverse -21 -31 11.3864 0.00668
NP_440628.1_1 Reverse -105 -115 13.1977 0.29
NP_441428.1_8 Reverse -13 -32 2.55606 0.268
NP_442310.1_5 Forward -257 -238 7.7676 0.271
NP_442341.1_7 Reverse -20 -34 14.6509 0.0277
NP_442341.1_7 Forward -31 -17 11.7993 0.051
NP_442395.2_4 Reverse -20 -39 6.98015 0.141
NP_440423.1_10 Forward -71 -52 9.3409 0.26
NP_443000.1_7 Reverse -19 -29 8.73149 0.0437
NP_443000.1_7 Forward -32 -22 2.14332 0.226
NP_441842.1_10 Forward -37 -23 6.88276 0.271
NP_440275.1_3 Forward -32 -22 19.5479 0.00756
NP_440275.1_3 Reverse -19 -29 8.4365 0.0602
NP_440091.1_1 Reverse -17 -29 1.41561 0.197
NP_441902.1_3 Forward -256 -246 15.4111 0.201
NP_440679.1_5 Reverse -132 -151 4.916 0.298
NP_440679.1_10 Reverse -14 -33 -16.6185 0.269
NP_443010.1_10 Reverse -18 -35 5.3799 0.205
NP_441207.1_7 Reverse -381 -395 12.3534 0.241
NP_439962.1_6 Forward -349 -331 9.85225 0.23
NP_440216.1_1 Forward -30 -16 -2.26202 0.0484
NP_440216.1_1 Reverse -21 -35 -2.55701 0.0521
NP_440216.1_9 Reverse -98 -107 16.9127 0.116
NP_440216.1_9 Forward -295 -286 11.9961 0.252
NP_440172.1_1 Reverse -21 -31 16.303 0.00854
NP_440172.1_1 Forward -30 -20 8.73149 0.0586
NP_440172.1_1 Forward -395 -385 2.43831 0.279
NP_442015.1_10 Reverse -17 -30 9.36073 0.0503
NP_442015.1_10 Forward -258 -245 3.5592 0.179
NP_441226.1_7 Forward -29 -22 14.4934 0.0123
NP_441226.1_7 Reverse -22 -29 14.4934 0.0123
NP_441111.1_7 Forward -29 -21 18.7023 0.00294
NP_441111.1_7 Reverse -22 -30 18.7023 0.00294
NP_442379.1_10 Reverse -14 -31 -1.0428 0.223
NP_441766.1_2 Forward -30 -21 17.5026 0.00297
NP_441766.1_2 Reverse -21 -30 17.5026 0.00297
NP_442417.1_5 Forward -30 -16 11.6026 0.0983
NP_440416.1_9 Reverse -14 -33 -22.0267 0.3
NP_443052.1_8 Reverse -11 -30 -12.4886 0.256
NP_442564.1_10 Reverse -95 -109 9.63603 0.296
NP_440261.1_5 Reverse -22 -35 8.77074 0.0244
NP_440261.1_5 Forward -29 -16 -1.06236 0.0655
NP_440261.1_7 Reverse -42 -61 -6.68705 0.283
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CCTGTGGCATTGTCTTTTTCCTTCCCCAGGCGTGGTTACTACAATGGGCTGGATTGGGGCCGGTACGGCAAACTGTACTAATGATGGGTTGGTCGTTCATTTTACCCCTGGGAAATTTTAGTAACCCAGATTTATTGGCACCCCTGGGGGAACAACTCTGGCGAGGGTCCATGGTTGCTTTTTTATTATGGGGAAGTTTGTTTAATTTACAGACCATTGGACTCTGGTTAGTAACCCTGAGACTGCGGCCCTTGAGCTACTTAGTGGTGTTAGTGGGCTTATCAGTCTTTCTTTTTGCCATGGTGACTAATTACTACTTAAGTTAGGCTCCATTATGGAAAAAATTTGTCCCCTGGTGGTGCTTAATTGGGGCGATCGCCGTGATATTATTACAGGTAAC

CDS

No sequence available

Protein

No sequence available