Your browser is old and dusty. Try Google Chrome!

Details for 6803t09

ORF 6803t09
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -80 -94 4.52282 0.147
NP_441061.1_2 Forward -87 -73 4.22782 0.153
NP_440557.1_1 Reverse -80 -99 2.45773 0.234
NP_440795.1_7 Forward -87 -80 14.6904 0.0123
NP_440795.1_7 Reverse -80 -87 14.6904 0.0123
NP_441418.1_6 Reverse -79 -98 -1.47551 0.0136
NP_441418.1_6 Forward -88 -69 -20.2567 0.108
NP_442291.1_5 Reverse -78 -94 9.30165 0.0521
NP_442291.1_5 Forward -89 -73 5.17175 0.0801
NP_440897.1_6 Forward -88 -69 6.78348 0.0893
NP_440897.1_6 Forward -304 -285 3.73524 0.142
NP_441453.1_4 Reverse -79 -87 16.539 0.00633
NP_441453.1_4 Forward -88 -80 16.539 0.00633
NP_441960.1_3 Reverse -313 -332 13.8918 0.243
NP_442151.1_1 Reverse -7 -26 4.03102 0.287
NP_442151.1_6 Reverse -79 -93 19.7641 0.0045
NP_442151.1_6 Forward -88 -74 17.5025 0.00997
NP_442151.1_6 Forward -107 -93 9.83269 0.139
NP_442151.1_6 Reverse -315 -329 8.55439 0.171
NP_441818.1_1 Reverse -80 -91 18.8393 0.00301
NP_441818.1_1 Forward -87 -76 18.446 0.0046
NP_441818.1_9 Forward -276 -257 -9.14533 0.287
NP_441818.1_9 Forward -282 -263 -9.24366 0.288
NP_440226.1_1 Reverse -79 -98 11.0125 0.0571
NP_441465.1_8 Reverse -68 -86 11.4255 0.188
NP_441465.1_8 Reverse -58 -76 9.55725 0.196
NP_442655.1_10 Forward -279 -260 -11.5053 0.249
NP_442173.1_1 Forward -87 -79 15.4574 0.00633
NP_442173.1_1 Reverse -80 -88 15.4574 0.00633
NP_442752.1_4 Forward -88 -81 13.8055 0.0199
NP_442752.1_4 Reverse -79 -86 13.8055 0.0199
NP_442752.1_4 Forward -174 -167 5.25066 0.256
NP_443027.1_4 Forward -90 -80 14.0414 0.0452
NP_443027.1_4 Reverse -77 -87 14.0414 0.0452
NP_443027.1_4 Forward -109 -99 6.37155 0.283
NP_442975.1_10 Forward -92 -78 13.4703 0.0459
NP_442975.1_10 Reverse -75 -89 12.782 0.0459
NP_442975.1_10 Forward -111 -97 7.96378 0.112
NP_440784.1_7 Forward -87 -80 15.9687 0.0123
NP_440784.1_7 Reverse -80 -87 15.9687 0.0123
NP_442909.1_7 Forward -87 -73 16.1252 0.0918
NP_442909.1_7 Forward -106 -92 7.76712 0.203
NP_442909.1_7 Reverse -80 -94 6.29216 0.252
NP_440061.1_9 Forward -90 -76 12.5853 0.0952
NP_441476.1_6 Forward -27 -8 11.2084 0.286
NP_440878.1_9 Forward -98 -79 -2.55715 0.268
NP_442062.1_8 Forward -88 -78 17.3846 0.00193
NP_442062.1_8 Reverse -79 -89 17.3846 0.00193
NP_442062.1_8 Forward -82 -72 3.81494 0.252
NP_441900.1_2 Forward -108 -90 -4.40646 0.288
NP_441859.1_3 Forward -95 -76 3.9319 0.23
NP_441859.1_5 Forward -384 -365 1.37609 0.298
NP_440304.1_4 Forward -90 -80 10.8948 0.051
NP_440304.1_4 Reverse -77 -87 10.8948 0.051
NP_440304.1_4 Forward -344 -334 7.84651 0.099
NP_440304.1_4 Forward -326 -316 3.22496 0.299
NP_442242.1_4 Forward -87 -80 14.3954 0.0124
NP_442242.1_4 Reverse -80 -87 14.3954 0.0124
NP_442242.1_4 Reverse -99 -106 10.9539 0.12
NP_440044.1_8 Reverse -80 -99 9.73422 0.0647
NP_440908.1_2 Forward -322 -309 16.5383 0.269
NP_442097.1_9 Reverse -314 -332 21.1603 0.0692
NP_439918.1_2 Reverse -80 -99 -4.32711 0.274
NP_439918.1_3 Forward -177 -158 4.52268 0.264
NP_441210.1_3 Reverse -64 -83 17.699 0.134
NP_440893.1_3 Reverse -62 -81 0.785326 0.273
NP_442742.1_9 Reverse -185 -204 -4.42544 0.221
NP_442110.1_7 Reverse -79 -93 18.9775 0.0138
NP_442110.1_7 Forward -88 -74 9.83269 0.0708
NP_442367.1_10 Forward -373 -359 8.25939 0.279
NP_441925.1_4 Reverse -257 -276 -13.2759 0.257
NP_441083.1_5 Forward -88 -78 20.3345 0.00053
NP_441083.1_5 Reverse -79 -89 20.3345 0.00053
NP_442827.1_8 Reverse -71 -90 13.6666 0.0402
NP_442827.1_8 Forward -96 -77 3.34192 0.148
NP_442827.1_8 Reverse -344 -363 -2.06626 0.267
NP_441738.1_2 Forward -86 -79 15.28 0.0102
NP_441738.1_2 Reverse -81 -88 15.28 0.0102
NP_441558.1_5 Reverse -77 -96 12.2908 0.069
NP_441558.1_5 Forward -90 -71 4.03102 0.293
NP_440209.1_1 Reverse -79 -87 18.1123 0.00295
NP_440209.1_1 Forward -88 -80 18.1123 0.00295
NP_442889.1_1 Reverse -7 -26 -14.4552 0.273
NP_442889.1_8 Forward -91 -77 11.5037 0.0733
NP_440178.1_7 Forward -89 -70 -4.52377 0.0569
NP_440178.1_7 Reverse -78 -97 -15.7335 0.163
NP_442570.1_3 Reverse -320 -339 -7.76869 0.276
NP_441716.1_1 Forward -88 -74 24.9757 0.000981
NP_441716.1_1 Reverse -79 -93 6.09611 0.207
NP_442111.1_4 Forward -89 -75 9.83269 0.0575
NP_442111.1_4 Reverse -78 -92 3.14618 0.253
NP_442111.1_4 Reverse -125 -139 1.86788 0.293
NP_441495.1_1 Reverse -71 -90 11.1109 0.194
NP_441495.1_1 Forward -96 -77 10.6192 0.194
NP_440906.1_5 Forward -87 -80 15.8704 0.0124
NP_440906.1_5 Reverse -80 -87 15.8704 0.0124
NP_440747.1_10 Forward -91 -79 7.51213 0.00286
NP_440747.1_10 Reverse -76 -88 7.51213 0.00286
NP_441130.1_10 Forward -90 -76 8.35772 0.138
NP_441130.1_10 Reverse -77 -91 7.76774 0.149
NP_441486.1_1 Forward -91 -77 20.9441 0.00262
NP_441486.1_1 Reverse -76 -90 20.8458 0.00269
NP_441486.1_1 Forward -110 -96 0.589577 0.132
NP_440403.1_4 Reverse -70 -89 -7.57203 0.247
NP_440842.1_6 Reverse -154 -173 12.29 0.25
NP_441014.1_5 Forward -27 -9 15.2604 0.2
NP_441014.1_5 Forward -93 -75 11.3272 0.258
NP_441014.1_10 Forward -89 -70 10.0284 0.123
NP_441014.1_10 Reverse -78 -97 1.76863 0.224
NP_441014.1_10 Reverse -62 -81 -0.492971 0.252
NP_442848.1_1 Reverse -73 -87 17.7975 0.0143
NP_442848.1_1 Forward -94 -80 16.5192 0.0143
NP_442848.1_5 Forward -331 -313 -1.84914 0.276
NP_443018.1_3 Forward -87 -80 14.8871 0.0123
NP_443018.1_3 Reverse -80 -87 14.8871 0.0123
NP_443018.1_3 Forward -81 -74 11.3472 0.0846
NP_443018.1_3 Reverse -70 -77 8.20058 0.153
NP_443018.1_3 Reverse -74 -81 4.16902 0.278
NP_441634.1_8 Forward -90 -76 2.85119 0.16
NP_441634.1_8 Reverse -77 -91 2.16287 0.17
NP_440376.1_1 Forward -88 -79 19.4693 0.000692
NP_440376.1_1 Reverse -79 -88 19.4693 0.000692
NP_440376.1_1 Reverse -13 -22 3.44131 0.203
NP_440376.1_1 Reverse -321 -330 0.589713 0.267
NP_440376.1_1 Forward -72 -63 -0.000272808 0.285
NP_441588.1_4 Reverse -81 -91 8.63316 0.14
NP_442687.1_7 Forward -89 -79 8.92815 0.0994
NP_442687.1_7 Reverse -78 -88 8.92815 0.0994
NP_441846.1_10 Reverse -229 -248 -23.1083 0.277
NP_441013.1_2 Reverse -68 -86 12.8022 0.119
NP_441422.1_7 Forward -240 -223 -8.12263 0.266
NP_440741.1_4 Forward -174 -155 28.8104 0.000248
NP_440741.1_5 Forward -147 -128 25.0756 0.00486
NP_440741.1_7 Forward -209 -190 20.6097 0.0387
NP_440533.1_9 Forward -82 -63 3.24438 0.253
NP_440667.1_2 Reverse -310 -329 -5.11376 0.252
NP_442658.1_1 Forward -350 -340 7.84605 0.205
NP_442658.1_1 Reverse -77 -87 6.76441 0.214
NP_442658.1_1 Forward -90 -80 6.76441 0.214
NP_442658.1_1 Reverse -71 -81 5.68278 0.258
NP_440141.1_8 Forward -324 -305 6.78429 0.252
NP_442782.1_2 Reverse -328 -342 8.45605 0.198
NP_442782.1_2 Forward -53 -39 2.2612 0.275
NP_441414.1_9 Forward -88 -69 -1.08219 0.0977
NP_441958.1_5 Forward -89 -79 12.2714 0.00183
NP_441958.1_5 Reverse -78 -88 12.2714 0.00183
NP_442486.1_2 Reverse -242 -261 5.40766 0.25
NP_442486.1_6 Forward -313 -294 -7.17871 0.298
NP_442836.1_5 Reverse -73 -92 8.06259 0.147
NP_440203.1_5 Forward -85 -75 14.8275 0.0886
NP_440203.1_5 Reverse -66 -76 9.81266 0.245
NP_440269.1_1 Reverse -304 -322 18.702 0.173
NP_443001.1_7 Reverse -80 -99 6.4893 0.27
NP_441097.1_2 Forward -80 -63 10.6586 0.2
NP_439990.1_5 Reverse -74 -87 12.3107 0.114
NP_439990.1_5 Forward -124 -111 10.344 0.128
NP_439990.1_5 Forward -93 -80 9.95071 0.128
NP_442911.1_2 Forward -98 -79 -3.73712 0.117
NP_442911.1_2 Reverse -69 -88 -3.93378 0.122
NP_441580.1_6 Forward -99 -80 7.96426 0.0988
NP_441580.1_6 Forward -320 -301 -7.86702 0.247
NP_440153.1_5 Forward -87 -73 9.34103 0.127
NP_440153.1_5 Reverse -80 -94 9.04604 0.127
NP_442064.1_4 Reverse -69 -88 4.52188 0.287
NP_443055.1_3 Reverse -70 -89 16.7566 0.0731
NP_441348.1_7 Reverse -328 -347 6.4893 0.289
NP_441099.1_5 Forward -248 -229 -9.14533 0.214
NP_441099.1_5 Forward -98 -79 -10.7186 0.261
NP_441099.1_5 Reverse -69 -88 -11.2103 0.273
NP_441294.1_7 Forward -92 -78 14.242 0.0448
NP_441294.1_7 Reverse -75 -89 14.146 0.0466
NP_441294.1_7 Forward -334 -320 9.15464 0.256
NP_440106.1_2 Reverse -70 -88 10.8356 0.297
NP_440106.1_2 Forward -81 -63 9.55725 0.298
NP_440411.1_8 Reverse -322 -341 13.5691 0.275
NP_441646.1_1 Reverse -123 -142 4.62101 0.191
NP_442438.1_10 Forward -93 -79 14.4542 0.0311
NP_442438.1_10 Reverse -74 -88 8.06273 0.0832
NP_442438.1_10 Forward -237 -223 -0.393733 0.259
NP_442431.1_10 Reverse -301 -319 -0.0791831 0.284
NP_440147.1_4 Forward -90 -77 2.08423 0.21
NP_440147.1_4 Reverse -77 -90 2.08423 0.21
NP_441550.1_8 Reverse -77 -87 12.3692 0.0336
NP_441550.1_8 Forward -90 -80 12.3692 0.0336
NP_441916.1_7 Forward -88 -78 10.3048 0.0261
NP_441916.1_7 Reverse -79 -89 10.3048 0.0261
NP_441916.1_10 Reverse -238 -257 4.12936 0.223
NP_441041.1_4 Forward -88 -69 3.93269 0.0612
NP_441041.1_4 Reverse -79 -98 -4.91709 0.145
NP_441041.1_4 Reverse -328 -347 -8.55534 0.204
NP_441041.1_4 Reverse -98 -117 -11.1119 0.241
NP_441041.1_4 Reverse -86 -105 -11.8986 0.254
NP_441041.1_4 Forward -94 -75 -12.2919 0.262
NP_442004.1_6 Forward -88 -74 11.5043 0.115
NP_442004.1_6 Reverse -73 -87 7.76774 0.156
NP_442004.1_6 Reverse -79 -93 1.86788 0.276
NP_441725.1_5 Forward -87 -77 11.2881 0.0247
NP_441725.1_5 Reverse -80 -90 11.2881 0.0247
NP_439966.1_7 Reverse -77 -87 15.8108 0.0124
NP_439966.1_7 Forward -90 -80 15.8108 0.0124
NP_439966.1_7 Reverse -163 -173 11.9759 0.0528
NP_439966.1_9 Forward -176 -167 7.27622 0.253
NP_442941.1_3 Forward -87 -77 19.9412 0.00262
NP_442941.1_3 Reverse -80 -90 19.9412 0.00262
NP_440289.1_2 Forward -91 -78 13.294 0.0132
NP_440289.1_2 Reverse -76 -89 3.85419 0.0735
NP_440260.1_8 Reverse -312 -330 4.9357 0.154
NP_441678.1_9 Reverse -8 -27 -2.36049 0.26
NP_442281.1_1 Forward -93 -79 16.8135 0.00698
NP_442281.1_1 Forward -99 -85 3.53891 0.228
NP_440437.1_1 Forward -94 -75 7.86593 0.0622
NP_442012.1_5 Reverse -327 -346 -1.08219 0.288
NP_440498.1_1 Forward -116 -98 3.65739 0.142
NP_443030.1_4 Forward -79 -60 -4.42544 0.251
NP_442068.1_4 Forward -240 -221 8.35677 0.224
NP_441644.1_6 Forward -88 -78 17.3841 0.00127
NP_441644.1_6 Reverse -79 -89 17.3841 0.00127
NP_441644.1_6 Reverse -315 -325 4.30615 0.242
NP_440652.1_10 Forward -171 -152 3.14605 0.283
NP_442215.1_2 Reverse -77 -93 15.2015 0.0184
NP_442215.1_2 Reverse -60 -76 6.74504 0.0702
NP_442215.1_2 Forward -90 -74 -3.57971 0.218
NP_442215.1_2 Forward -339 -323 -6.82463 0.28
NP_442215.1_2 Forward -103 -87 -7.41462 0.294
NP_442177.1_5 Reverse -319 -333 8.45605 0.276
NP_442029.1_1 Forward -90 -71 -20.1584 0.297
NP_442029.1_6 Reverse -323 -342 5.11266 0.255
NP_440253.1_2 Reverse -79 -97 8.08229 0.0625
NP_440929.1_8 Forward -88 -79 19.2726 0.000701
NP_440929.1_8 Reverse -79 -88 19.2726 0.000701
NP_440929.1_8 Forward -330 -321 2.16301 0.262
NP_442933.1_10 Forward -88 -79 17.601 0.00325
NP_442933.1_10 Reverse -79 -88 17.601 0.00325
NP_441751.2_8 Reverse -80 -94 -3.147 0.134
NP_441751.2_8 Forward -87 -73 -3.24533 0.137
NP_442554.1_8 Forward -87 -77 15.9097 0.00747
NP_442554.1_8 Reverse -80 -90 15.9097 0.00747
NP_441762.1_7 Forward -89 -77 -6.84419 0.284
NP_441762.1_7 Reverse -78 -90 -6.84419 0.284
NP_442142.1_4 Forward -91 -78 14.1783 0.0311
NP_442142.1_4 Reverse -76 -89 6.31189 0.169
NP_442142.1_4 Forward -340 -327 6.21356 0.17
NP_442142.1_4 Forward -85 -72 5.72191 0.186
NP_442142.1_4 Reverse -264 -277 3.16532 0.265
NP_442292.1_1 Forward -87 -78 18.486 0.00229
NP_442292.1_1 Reverse -80 -89 18.486 0.00229
NP_442292.1_1 Forward -106 -97 -0.786921 0.287
NP_439989.1_6 Forward -81 -62 4.22769 0.296
NP_440421.1_1 Reverse -319 -333 15.7325 0.19
NP_441711.1_4 Forward -97 -78 5.11266 0.182
NP_443009.1_5 Reverse -78 -89 8.90795 0.0965
NP_443009.1_5 Forward -89 -78 8.90795 0.0965
NP_441715.1_4 Forward -87 -77 14.828 0.0268
NP_441715.1_4 Reverse -80 -90 14.828 0.0268
NP_441715.1_4 Reverse -99 -109 5.87989 0.172
NP_440357.1_6 Forward -98 -79 6.09597 0.279
NP_440015.1_9 Forward -88 -70 2.37909 0.207
NP_440379.1_5 Reverse -312 -331 -9.53865 0.264
NP_441468.1_1 Forward -87 -80 15.8704 0.0124
NP_441468.1_1 Reverse -80 -87 15.8704 0.0124
NP_441468.1_1 Reverse -74 -81 3.97235 0.277
NP_441015.1_8 Forward -400 -381 -0.4922 0.293
NP_441015.1_10 Reverse -74 -93 -4.22878 0.201
NP_441015.1_10 Forward -278 -259 -4.52377 0.205
NP_441015.1_10 Reverse -80 -99 -10.9153 0.289
NP_441673.1_1 Forward -88 -79 20.8459 0.000698
NP_441673.1_1 Reverse -79 -88 20.8459 0.000698
NP_441731.1_1 Forward -272 -254 13.7528 0.281
NP_441876.1_9 Reverse -383 -393 13.7459 0.267
NP_441876.1_9 Forward -244 -234 11.5826 0.275
NP_441826.1_2 Forward -94 -80 23.2057 0.00229
NP_441826.1_2 Reverse -73 -87 11.8976 0.0334
NP_441826.1_2 Forward -343 -329 3.53951 0.109
NP_441826.1_2 Forward -88 -74 2.5562 0.125
NP_441826.1_2 Reverse -79 -93 -0.492064 0.213
NP_441826.1_2 Reverse -63 -77 -3.93365 0.29
NP_441826.1_5 Reverse -80 -99 6.4893 0.222
NP_441826.1_5 Reverse -234 -253 2.0644 0.276
NP_442745.1_1 Reverse -294 -313 15.0441 0.185
NP_442745.1_1 Reverse -100 -119 10.5209 0.283
NP_442868.1_6 Forward -90 -80 9.91146 0.038
NP_442868.1_6 Reverse -77 -87 9.91146 0.038
NP_442868.1_6 Reverse -227 -237 3.91327 0.19
NP_441056.1_1 Reverse -79 -98 0.294447 0.156
NP_441612.1_2 Reverse -79 -89 8.54929 0.21
NP_441612.1_2 Forward -88 -78 8.54929 0.21
NP_443058.1_1 Reverse -55 -74 11.2084 0.291
NP_442361.1_3 Forward -94 -81 15.9489 0.0811
NP_442427.1_8 Forward -97 -78 10.2259 0.166
NP_442808.1_1 Reverse -78 -88 8.63269 0.0481
NP_442808.1_1 Forward -89 -79 8.63269 0.0481
NP_442808.1_1 Reverse -43 -53 1.25791 0.289
NP_442775.1_6 Reverse -310 -329 11.0125 0.277
NP_442775.1_6 Reverse -74 -93 10.0292 0.283
NP_442050.1_5 Reverse -77 -87 16.4991 0.00812
NP_442050.1_5 Forward -90 -80 16.4991 0.00812
NP_442050.1_5 Reverse -163 -173 11.9759 0.0742
NP_441114.1_3 Reverse -64 -73 7.27622 0.247
NP_440558.1_2 Reverse -312 -331 -0.0988766 0.198
NP_440558.1_2 Reverse -150 -169 -3.24547 0.234
NP_440558.1_2 Forward -346 -327 -4.13045 0.243
NP_440558.1_2 Reverse -318 -337 -4.42544 0.245
NP_440558.1_2 Reverse -70 -89 -7.27704 0.291
NP_440558.1_2 Reverse -59 -78 -7.57203 0.296
NP_440558.1_5 Reverse -316 -330 14.2576 0.288
NP_440111.2_2 Reverse -68 -87 1.0811 0.201
NP_441878.1_6 Forward -89 -79 10.4031 0.0176
NP_441878.1_6 Reverse -78 -88 10.4031 0.0176
NP_441036.1_8 Forward -89 -79 8.33817 0.174
NP_441036.1_8 Reverse -78 -88 8.33817 0.174
NP_442650.1_2 Forward -88 -74 4.62115 0.165
NP_442503.1_9 Reverse -85 -104 4.71934 0.29
NP_441557.1_5 Forward -88 -79 19.9609 0.000699
NP_441557.1_5 Reverse -79 -88 19.9609 0.000699
NP_441557.1_8 Forward -182 -172 12.0743 0.236
NP_441557.1_8 Reverse -201 -211 10.8943 0.273
NP_441445.1_1 Reverse -70 -89 8.94757 0.112
NP_441445.1_1 Forward -97 -78 1.96607 0.245
NP_441433.1_8 Forward -303 -284 8.25926 0.161
NP_440101.1_5 Forward -114 -95 8.45592 0.183
NP_441458.1_10 Forward -97 -78 1.67108 0.285
NP_442830.1_5 Reverse -61 -75 2.35894 0.271
NP_442183.1_1 Reverse -79 -93 9.14437 0.101
NP_442183.1_1 Forward -88 -74 7.07942 0.149
NP_442183.1_1 Reverse -98 -112 5.80112 0.203
NP_442397.1_9 Reverse -79 -98 1.37609 0.283
NP_441574.1_1 Reverse -295 -314 -2.16383 0.224
NP_441574.1_1 Reverse -73 -92 -6.29373 0.276
NP_441549.1_9 Reverse -144 -162 4.9357 0.0925
NP_441549.1_9 Reverse -75 -93 -5.78238 0.198
NP_442347.1_2 Forward -87 -78 12.4878 0.056
NP_442347.1_2 Reverse -80 -89 12.4878 0.056
NP_442347.1_2 Forward -106 -97 8.25953 0.102
NP_442347.1_2 Reverse -383 -392 5.99792 0.201
NP_442645.1_2 Forward -345 -326 -1.08219 0.0487
NP_442645.1_2 Forward -90 -71 -20.2567 0.288
NP_442508.1_8 Forward -176 -159 11.1502 0.256
NP_441633.1_3 Forward -90 -77 -6.07724 0.236
NP_441633.1_3 Reverse -77 -90 -6.07724 0.236
NP_440136.1_2 Forward -87 -80 15.9687 0.0123
NP_440136.1_2 Reverse -80 -87 15.9687 0.0123
NP_440136.1_2 Forward -173 -166 3.97235 0.288
NP_442590.1_10 Reverse -79 -98 15.3391 0.113
NP_442590.1_10 Reverse -73 -92 13.4708 0.135
NP_442590.1_10 Reverse -310 -329 8.94757 0.203
NP_442590.1_10 Forward -94 -75 5.50599 0.258
NP_442998.1_5 Forward -369 -359 10.2065 0.222
NP_442998.1_10 Forward -86 -79 15.5754 0.0102
NP_442998.1_10 Reverse -81 -88 15.5754 0.0102
NP_440299.1_1 Reverse -75 -88 19.9798 0.00161
NP_440299.1_1 Forward -92 -79 14.08 0.0259
NP_440299.1_1 Forward -86 -73 5.72191 0.166
NP_441799.1_1 Reverse -94 -108 13.5686 0.0311
NP_441799.1_1 Reverse -75 -89 7.17714 0.149
NP_441799.1_1 Forward -92 -78 3.44058 0.298
NP_440640.1_6 Forward -387 -368 -0.4922 0.285
NP_441007.1_10 Forward -93 -80 0.707601 0.219
NP_442333.2_1 Reverse -60 -79 -0.197208 0.113
NP_442333.2_5 Forward -99 -80 -4.91709 0.214
NP_442333.2_5 Forward -341 -322 -6.78538 0.227
NP_440256.1_1 Reverse -76 -95 10.4225 0.0184
NP_440256.1_1 Forward -91 -72 9.43923 0.0204
NP_440256.1_1 Reverse -82 -101 -0.295539 0.0918
NP_440256.1_1 Forward -307 -288 -8.85033 0.268
NP_441559.1_8 Reverse -74 -88 2.75286 0.143
NP_441559.1_8 Reverse -58 -72 -4.81863 0.238
NP_441559.1_8 Forward -77 -63 -7.76856 0.299
NP_440915.1_6 Forward -92 -78 4.52282 0.0953
NP_441179.1_9 Reverse -42 -52 15.8108 0.246
NP_441704.1_8 Reverse -68 -87 25.8596 0.0012
NP_441704.1_8 Forward -99 -80 6.58682 0.258
NP_442866.1_1 Forward -179 -160 3.93269 0.151
NP_442866.1_1 Reverse -310 -329 -0.0988766 0.191
NP_440748.1_5 Forward -346 -327 -1.67217 0.267
NP_440306.1_8 Reverse -352 -371 5.60352 0.204
NP_441939.1_3 Forward -260 -241 5.50599 0.273
NP_442993.1_1 Reverse -98 -114 -7.90627 0.148
NP_442386.1_9 Reverse -78 -87 13.8639 0.0289
NP_442386.1_9 Forward -89 -80 13.8639 0.0289
NP_442386.1_9 Forward -95 -86 7.07914 0.219
NP_442386.1_9 Reverse -227 -236 6.58748 0.219
NP_442386.1_9 Forward -175 -166 6.39082 0.219
NP_442386.1_9 Reverse -72 -81 4.91586 0.276
NP_442386.1_9 Forward -83 -74 4.62087 0.294
NP_441340.1_5 Forward -87 -80 15.6737 0.0124
NP_441340.1_5 Reverse -80 -87 15.6737 0.0124
NP_441340.1_5 Forward -81 -74 4.07068 0.239
NP_442484.1_2 Forward -99 -80 15.8307 0.0365
NP_442484.1_2 Reverse -317 -336 0.491109 0.247
NP_440168.1_9 Reverse -62 -81 -3.93378 0.296
NP_440586.1_8 Forward -87 -80 13.2151 0.026
NP_440586.1_8 Reverse -80 -87 13.2151 0.026
NP_440586.1_8 Forward -81 -74 12.8218 0.0395
NP_440586.1_8 Reverse -70 -77 9.08521 0.178
NP_442251.1_6 Forward -87 -80 15.2804 0.0124
NP_442251.1_6 Reverse -80 -87 15.2804 0.0124
NP_442251.1_6 Reverse -99 -106 11.4455 0.0901
NP_440969.1_3 Reverse -259 -277 6.50823 0.294
NP_440684.1_9 Reverse -92 -106 13.2743 0.168
NP_441262.1_3 Reverse -79 -86 14.7888 0.0223
NP_441262.1_3 Forward -88 -81 14.7888 0.0223
NP_440027.1_3 Reverse -63 -81 8.96649 0.187
NP_440027.1_3 Forward -22 -4 4.34495 0.262
NP_440027.1_3 Forward -88 -70 2.18168 0.292
NP_443051.1_1 Reverse -78 -87 10.4228 0.00754
NP_443051.1_1 Forward -89 -80 10.4228 0.00754
NP_439996.1_6 Forward -283 -264 9.46814 0.233
NP_439937.1_8 Forward -212 -193 -3.93378 0.276
NP_439937.1_9 Forward -89 -72 -16.1864 0.287
NP_441740.2_10 Reverse -300 -319 15.2408 0.111
NP_440408.1_3 Forward -94 -75 -3.04881 0.257
NP_440439.1_1 Reverse -76 -89 2.37923 0.135
NP_442239.1_8 Reverse -306 -325 13.4708 0.231
NP_440372.1_2 Forward -87 -80 16.3621 0.0124
NP_440372.1_2 Reverse -80 -87 16.3621 0.0124
NP_440372.1_2 Forward -173 -166 4.07068 0.262
NP_440171.1_3 Reverse -236 -255 4.62101 0.284
NP_440574.1_3 Reverse -74 -93 2.0644 0.173
NP_442285.1_1 Reverse -93 -112 3.04771 0.287
NP_441803.1_2 Forward -93 -74 3.6377 0.191
NP_441803.1_2 Reverse -74 -93 -0.983855 0.293
NP_439977.1_5 Forward -94 -75 0.392778 0.21
NP_439977.1_5 Reverse -73 -92 -1.18052 0.244
NP_442368.1_10 Reverse -291 -310 14.1591 0.273
NP_441572.1_7 Forward -94 -75 -3.3438 0.209
NP_442384.1_10 Forward -88 -75 18.9972 0.00338
NP_442384.1_10 Reverse -79 -92 10.049 0.047
NP_442035.1_7 Reverse -84 -103 15.5947 0.285
NP_440364.1_6 Reverse -85 -98 13.2934 0.282
NP_441877.1_7 Reverse -68 -87 -0.29631 0.283
NP_441018.1_7 Reverse -75 -94 9.14423 0.233
NP_441018.1_7 Reverse -324 -343 8.65258 0.241
NP_442262.1_10 Forward -87 -80 14.1988 0.0123
NP_442262.1_10 Reverse -80 -87 14.1988 0.0123
NP_442262.1_10 Forward -81 -74 10.3639 0.153
NP_442262.1_10 Reverse -70 -77 9.38056 0.202
NP_441689.1_5 Forward -90 -80 15.3192 0.0403
NP_441689.1_5 Reverse -77 -87 15.3192 0.0403
NP_441689.1_5 Reverse -163 -173 5.97777 0.197
NP_442244.1_6 Reverse -7 -26 0.884433 0.291
NP_442244.1_6 Forward -391 -372 -0.4922 0.291
NP_440163.1_10 Forward -91 -81 11.3864 0.169
NP_440344.1_10 Forward -95 -78 2.49712 0.0282
NP_440344.1_10 Reverse -72 -89 1.31714 0.0311
NP_440344.1_10 Reverse -158 -175 -11.5642 0.219
NP_440531.1_6 Reverse -71 -90 5.80098 0.112
NP_440531.1_6 Forward -96 -77 -3.83545 0.272
NP_441965.1_10 Forward -85 -69 11.5633 0.107
NP_441965.1_10 Forward -91 -75 4.28677 0.247
NP_440297.1_9 Forward -87 -77 9.32148 0.0917
NP_440297.1_9 Reverse -80 -90 9.32148 0.0917
NP_440650.1_2 Forward -354 -335 11.9958 0.115
NP_440894.1_10 Reverse -74 -93 8.25926 0.179
NP_440894.1_10 Forward -253 -234 6.98095 0.209
NP_440937.1_5 Reverse -309 -328 9.53756 0.275
NP_440999.1_9 Forward -92 -78 4.32615 0.116
NP_440999.1_9 Reverse -75 -89 2.35953 0.151
NP_440999.1_9 Forward -111 -97 1.57289 0.162
NP_440888.1_2 Reverse -79 -93 20.7467 0.000502
NP_440888.1_2 Forward -88 -74 18.7801 0.00187
NP_440888.1_2 Forward -337 -323 5.50552 0.276
NP_440600.1_4 Reverse -71 -89 -0.7675 0.155
NP_440491.1_1 Reverse -76 -95 11.9848 0.158
NP_442948.1_2 Forward -175 -156 6.88262 0.229
NP_442033.1_10 Forward -90 -71 -3.83545 0.171
NP_442033.1_10 Forward -127 -108 -13.0786 0.281
NP_442818.1_3 Reverse -176 -193 -5.27103 0.27
NP_441543.1_2 Forward -87 -78 16.9127 0.00359
NP_441543.1_2 Reverse -80 -89 16.9127 0.00359
NP_441543.1_2 Forward -81 -72 11.3078 0.0567
NP_442845.1_2 Reverse -79 -93 7.9644 0.195
NP_442845.1_2 Forward -88 -74 7.86607 0.195
NP_442845.1_2 Forward -94 -80 6.3911 0.21
NP_442845.1_2 Reverse -73 -87 5.89945 0.22
NP_440380.1_1 Forward -324 -305 -10.1286 0.276
NP_441469.1_8 Forward -89 -80 6.48957 0.227
NP_441469.1_8 Reverse -78 -87 6.48957 0.227
NP_443064.1_6 Forward -88 -78 12.5669 0.0796
NP_443064.1_6 Reverse -79 -89 12.5669 0.0796
NP_442578.1_7 Forward -87 -80 14.5921 0.026
NP_442578.1_7 Reverse -80 -87 14.5921 0.026
NP_440710.1_1 Forward -26 -8 -8.83064 0.282
NP_441462.1_2 Forward -88 -78 11.5831 0.00406
NP_441462.1_2 Reverse -79 -89 11.5831 0.00406
NP_443062.1_1 Forward -78 -60 9.71601 0.129
NP_443062.1_1 Forward -82 -64 5.81572 0.218
NP_443062.1_6 Forward -96 -77 2.3594 0.256
NP_443062.1_6 Reverse -71 -90 1.27776 0.276
NP_442204.1_1 Forward -280 -269 8.81013 0.0852
NP_442204.1_1 Reverse -75 -86 7.92515 0.108
NP_442204.1_1 Forward -92 -81 0.353664 0.281
NP_442487.1_5 Reverse -62 -81 5.50519 0.224
NP_442487.1_5 Forward -89 -70 3.34192 0.288
NP_440516.1_8 Forward -88 -79 16.9127 0.00442
NP_440516.1_8 Reverse -79 -88 16.9127 0.00442
NP_440516.1_8 Forward -174 -165 -0.590259 0.283
NP_442428.1_5 Forward -87 -80 15.8704 0.0124
NP_442428.1_5 Reverse -80 -87 15.8704 0.0124
NP_442428.1_5 Reverse -74 -81 4.36568 0.271
NP_442823.1_8 Reverse -295 -314 18.584 0.173
NP_441867.1_2 Forward -385 -366 -12.6852 0.27
NP_440673.1_2 Forward -242 -223 8.63366 0.264
NP_440673.1_2 Reverse -69 -88 7.65814 0.296
NP_440673.1_3 Forward -86 -79 12.4288 0.0426
NP_440673.1_3 Reverse -81 -88 12.4288 0.0426
NP_440673.1_3 Reverse -317 -324 6.92228 0.277
NP_440673.1_3 Forward -335 -328 6.72562 0.277
NP_440673.1_7 Forward -99 -80 3.6377 0.198
NP_441052.1_2 Forward -88 -78 19.9412 0.00106
NP_441052.1_2 Reverse -79 -89 19.9412 0.00106
NP_441052.1_2 Forward -337 -327 5.5849 0.111
NP_441052.1_2 Forward -107 -97 -0.216628 0.269
NP_440992.1_2 Reverse -295 -314 18.4857 0.152
NP_442219.1_8 Reverse -75 -94 13.6752 0.152
NP_442219.1_9 Forward -87 -78 17.7976 0.00718
NP_442219.1_9 Reverse -80 -89 17.7976 0.00718
NP_442219.1_9 Forward -106 -97 4.91628 0.193
NP_440436.1_4 Forward -87 -78 17.2072 0.00233
NP_440436.1_4 Reverse -80 -89 17.2072 0.00233
NP_440436.1_4 Forward -81 -72 4.42421 0.265
NP_441884.1_9 Forward -91 -72 -12.5869 0.138
NP_441884.1_9 Reverse -76 -95 -22.715 0.284
NP_441321.1_5 Forward -291 -272 5.50599 0.265
NP_440577.1_8 Reverse -59 -78 16.1249 0.257
NP_440041.1_2 Reverse -331 -350 -6.98204 0.296
NP_442907.1_9 Forward -342 -323 -5.21209 0.282
NP_441719.1_4 Forward -87 -80 16.3621 0.0124
NP_441719.1_4 Reverse -80 -87 16.3621 0.0124
NP_441004.1_1 Reverse -322 -341 -2.95047 0.15
NP_441004.1_1 Reverse -234 -253 -9.63698 0.21
NP_441004.1_1 Forward -330 -311 -16.2252 0.283
NP_441004.1_1 Forward -394 -375 -16.3235 0.284
NP_442366.1_3 Forward -344 -326 -5.88071 0.298
NP_442873.1_9 Forward -98 -79 11.405 0.198
NP_442206.1_10 Reverse -165 -180 7.84638 0.178
NP_442206.1_10 Forward -174 -159 1.15987 0.236
NP_443054.1_2 Reverse -77 -91 3.04785 0.24
NP_442308.1_8 Forward -238 -219 9.83255 0.231
NP_441851.1_10 Forward -89 -79 15.8113 0.00552
NP_441851.1_10 Reverse -78 -88 15.8113 0.00552
NP_442001.1_4 Forward -103 -84 7.17681 0.29
NP_442622.1_8 Forward -88 -70 -18.4671 0.222
NP_442856.1_7 Forward -116 -97 -2.65548 0.236
NP_441668.1_4 Reverse -318 -337 2.85105 0.189
NP_442515.1_1 Forward -89 -75 8.84938 0.0698
NP_442515.1_1 Reverse -78 -92 1.76955 0.149
NP_441396.1_5 Reverse -143 -152 8.35786 0.224
NP_440593.1_3 Forward -93 -74 0.196116 0.196
NP_440593.1_3 Forward -335 -316 -2.85214 0.228
NP_441349.1_10 Reverse -69 -88 0.58944 0.0878
NP_441409.1_6 Reverse -73 -92 6.4893 0.0292
NP_441409.1_6 Reverse -261 -280 -15.1435 0.28
NP_440432.1_2 Forward -94 -75 -2.0655 0.249
NP_440432.1_9 Reverse -80 -95 -2.77337 0.175
NP_442843.1_1 Reverse -322 -341 -7.17871 0.245
NP_442843.1_1 Reverse -175 -194 -9.24366 0.264
NP_440474.1_8 Reverse -99 -113 7.47213 0.204
NP_440474.1_8 Forward -323 -309 4.22722 0.287
NP_441150.1_6 Forward -319 -300 14.4533 0.251
NP_441124.1_5 Reverse -277 -287 15.2045 0.198
NP_442450.1_5 Reverse -77 -87 9.32148 0.115
NP_442450.1_5 Forward -90 -80 9.32148 0.115
NP_440588.1_2 Reverse -156 -175 1.27776 0.138
NP_440588.1_2 Reverse -89 -108 -4.03212 0.203
NP_441031.1_5 Reverse -307 -326 6.09597 0.282
NP_440195.1_4 Forward -100 -81 17.404 0.0465
NP_442006.1_2 Reverse -231 -248 -18.2507 0.289
NP_442243.1_1 Reverse -73 -91 0.411736 0.231
NP_441570.1_1 Forward -88 -70 22.4386 0.00108
NP_441570.1_1 Reverse -79 -97 9.65558 0.0103
NP_441570.1_1 Reverse -174 -192 -10.6006 0.174
NP_440078.1_10 Forward -88 -69 2.45773 0.269
NP_441078.1_4 Forward -88 -79 19.6659 0.0007
NP_441078.1_4 Reverse -79 -88 19.6659 0.0007
NP_442729.1_5 Forward -379 -369 7.74818 0.271
NP_442729.1_8 Forward -92 -79 8.47575 0.125
NP_442729.1_8 Reverse -75 -88 8.47575 0.125
NP_442348.1_2 Forward -72 -63 10.6195 0.259
NP_440526.1_3 Reverse -80 -91 10.1862 0.0646
NP_440526.1_3 Forward -87 -76 0.844851 0.267
NP_441432.1_8 Reverse -78 -87 16.8143 0.00595
NP_441432.1_8 Forward -89 -80 16.8143 0.00595
NP_441432.1_8 Reverse -327 -336 11.9961 0.0519
NP_441432.1_8 Reverse -97 -106 4.0313 0.24
NP_442320.1_8 Forward -94 -80 12.291 0.0175
NP_442320.1_8 Reverse -73 -87 -3.44199 0.122
NP_442320.1_8 Forward -100 -86 -6.58858 0.296
NP_442344.1_7 Reverse -99 -118 -7.27704 0.18
NP_441732.1_2 Forward -92 -76 2.91013 0.0145
NP_441732.1_2 Reverse -75 -91 1.82849 0.026
NP_442003.1_4 Forward -87 -68 9.93088 0.296
NP_440760.1_1 Forward -88 -69 -14.0619 0.122
NP_442797.1_1 Forward -329 -310 -2.75381 0.261
NP_442797.1_7 Reverse -72 -90 5.42735 0.216
NP_442797.1_7 Forward -95 -77 2.96908 0.236
NP_442797.1_7 Forward -317 -299 -1.06249 0.293
NP_440199.1_10 Forward -91 -81 16.7946 0.0381
NP_440199.1_10 Reverse -76 -86 15.5163 0.0861
NP_440199.1_10 Forward -85 -75 7.25653 0.231
NP_441945.1_10 Reverse -321 -340 8.65258 0.273
NP_441057.1_4 Reverse -306 -324 -1.84914 0.272
NP_441057.1_4 Reverse -333 -351 -4.01242 0.299
NP_442353.1_4 Forward -94 -75 3.34192 0.219
NP_440913.1_1 Reverse -77 -95 10.6389 0.175
NP_440713.1_4 Reverse -69 -88 24.1889 0.00353
NP_440713.1_4 Forward -82 -63 7.7676 0.174
NP_440713.1_4 Reverse -3 -22 5.40766 0.21
NP_442489.1_2 Reverse -74 -93 2.55606 0.261
NP_442489.1_7 Forward -88 -79 20.1576 0.000695
NP_442489.1_7 Reverse -79 -88 20.1576 0.000695
NP_441452.1_9 Reverse -295 -314 15.1424 0.236
NP_442079.1_7 Forward -87 -68 3.14605 0.212
NP_440559.1_1 Forward -87 -78 17.4043 0.00658
NP_440559.1_1 Reverse -80 -89 17.4043 0.00658
NP_441659.2_8 Forward -88 -78 18.1713 0.00133
NP_441659.2_8 Reverse -79 -89 18.1713 0.00133
NP_442913.1_10 Forward -97 -78 -5.40875 0.264
NP_442913.1_10 Reverse -70 -89 -5.50708 0.268
NP_442849.1_1 Forward -371 -357 9.5377 0.241
NP_439956.1_7 Forward -179 -160 8.45592 0.257
NP_441800.1_10 Forward -72 -53 1.57275 0.255
NP_442776.1_6 Forward -306 -287 7.66927 0.277
NP_442346.1_5 Forward -89 -79 16.6963 0.00248
NP_442346.1_5 Reverse -78 -88 16.6963 0.00248
NP_440352.1_5 Reverse -228 -247 11.3903 0.261
NP_440545.1_3 Forward -92 -75 -2.51776 0.187
NP_440545.1_3 Reverse -75 -92 -2.61609 0.189
NP_441856.1_1 Forward -387 -368 9.53756 0.201
NP_441786.1_10 Reverse -70 -89 6.98095 0.268
NP_440555.1_4 Forward -144 -125 7.7676 0.214
NP_440743.1_5 Reverse -257 -276 22.713 0.00592
NP_440743.1_6 Reverse -195 -213 20.5703 0.0137
NP_440743.1_8 Reverse -289 -308 16.6165 0.215
NP_440486.1_5 Forward -209 -190 7.7676 0.255
NP_440486.1_6 Forward -220 -201 11.0125 0.216
NP_440459.1_2 Forward -80 -63 13.8052 0.124
NP_440459.1_2 Forward -97 -80 9.87194 0.215
NP_440459.1_2 Reverse -77 -94 9.38028 0.229
NP_440459.1_2 Forward -339 -322 9.18362 0.233
NP_440459.1_2 Forward -103 -86 8.59364 0.254
NP_440010.1_4 Reverse -69 -88 4.03023 0.22
NP_440010.1_4 Forward -325 -306 -2.16459 0.275
NP_442603.1_7 Forward -88 -74 21.5334 0.00436
NP_442603.1_7 Reverse -79 -93 13.6669 0.0819
NP_439970.1_4 Reverse -83 -102 -4.81876 0.293
NP_441047.1_2 Forward -87 -68 3.14605 0.231
NP_440170.1_2 Reverse -67 -86 4.62101 0.296
NP_441833.1_4 Forward -87 -80 15.9687 0.0124
NP_441833.1_4 Reverse -80 -87 15.9687 0.0124
NP_442498.1_5 Reverse -126 -145 10.9142 0.284
NP_442498.1_5 Forward -151 -132 8.75091 0.284
NP_441895.1_3 Forward -319 -300 -17.2085 0.298
NP_441895.1_10 Reverse -233 -252 -27.4349 0.282
NP_442699.1_8 Forward -200 -181 -12.5869 0.255
NP_442162.1_9 Forward -87 -80 16.2637 0.0124
NP_442162.1_9 Reverse -80 -87 16.2637 0.0124
NP_440671.1_4 Forward -94 -80 16.4209 0.0288
NP_440671.1_4 Reverse -73 -87 8.94771 0.188
NP_440671.1_6 Reverse -61 -80 12.7816 0.226
NP_440224.1_1 Forward -99 -80 1.17943 0.132
NP_442140.1_3 Reverse -166 -176 6.07655 0.184
NP_442140.1_3 Forward -87 -77 4.40493 0.243
NP_442140.1_3 Reverse -80 -90 4.40493 0.243
NP_441609.1_1 Forward -288 -269 2.3594 0.189
NP_441813.1_5 Reverse -77 -87 15.9097 0.01
NP_441813.1_5 Forward -90 -80 15.9097 0.01
NP_441813.1_5 Reverse -163 -173 2.92996 0.181
NP_441813.1_5 Reverse -71 -81 -0.708283 0.272
NP_441227.1_3 Reverse -305 -324 6.29264 0.266
NP_440590.1_4 Forward -87 -74 14.6706 0.0106
NP_440590.1_4 Reverse -80 -93 12.409 0.0141
NP_440590.1_4 Reverse -322 -335 1.39592 0.125
NP_440567.1_1 Reverse -80 -94 5.30946 0.104
NP_440567.1_1 Reverse -74 -88 2.75286 0.164
NP_442497.1_10 Forward -87 -78 10.4228 0.0087
NP_442497.1_10 Reverse -80 -89 10.4228 0.0087
NP_440821.1_4 Reverse -77 -87 18.2696 0.00448
NP_440821.1_4 Forward -90 -80 18.2696 0.00448
NP_441239.1_9 Reverse -77 -89 4.36554 0.253
NP_441239.1_9 Forward -90 -78 4.36554 0.253
NP_441951.1_4 Reverse -79 -98 5.11266 0.273
NP_441892.1_1 Reverse -70 -87 10.4619 0.0642
NP_441892.1_1 Forward -97 -80 4.3654 0.111
NP_441892.1_1 Forward -91 -74 0.137172 0.173
NP_440604.1_6 Reverse -295 -314 -1.47551 0.202
NP_442193.1_8 Reverse -76 -95 14.7483 0.211
NP_442270.1_6 Reverse -173 -191 15.5554 0.279
NP_442270.1_9 Reverse -87 -106 -4.6221 0.201
NP_442270.1_9 Reverse -317 -336 -5.60541 0.207
NP_442270.1_9 Forward -99 -80 -6.1954 0.207
NP_441017.1_6 Forward -92 -78 18.0918 0.0376
NP_441017.1_6 Reverse -75 -89 16.4202 0.0651
NP_441017.1_6 Forward -98 -84 13.372 0.195
NP_441017.1_6 Reverse -65 -79 11.012 0.285
NP_442083.1_9 Reverse -236 -255 12.6841 0.163
NP_440833.1_6 Forward -192 -178 15.9285 0.134
NP_440354.1_7 Reverse -79 -97 9.65558 0.224
NP_442284.1_2 Forward -332 -313 13.3725 0.274
NP_440546.1_4 Forward -88 -78 10.046 0.109
NP_440546.1_4 Reverse -79 -89 10.046 0.109
NP_440546.1_4 Forward -174 -164 9.65817 0.126
NP_441230.1_5 Reverse -310 -329 -0.885524 0.292
NP_440462.1_4 Forward -175 -161 12.0943 0.205
NP_440462.1_6 Reverse -77 -87 7.74818 0.0699
NP_440462.1_6 Forward -90 -80 7.74818 0.0699
NP_440462.1_6 Reverse -163 -173 3.12662 0.26
NP_440868.1_4 Reverse -75 -87 8.6921 0.0582
NP_440868.1_4 Forward -178 -166 6.72548 0.0859
NP_440868.1_4 Reverse -69 -81 0.333971 0.217
NP_440868.1_4 Forward -92 -80 -0.846001 0.282
NP_441497.1_2 Forward -182 -163 8.16093 0.233
NP_442402.1_4 Reverse -373 -392 -5.70449 0.248
NP_441848.1_4 Reverse -272 -288 7.74165 0.288
NP_439942.1_2 Reverse -267 -286 12.5992 0.269
NP_440696.1_3 Forward -88 -70 0.314141 0.233
NP_440696.1_3 Reverse -69 -87 -2.63579 0.278
NP_442039.1_4 Forward -87 -80 15.1821 0.0124
NP_442039.1_4 Reverse -80 -87 15.1821 0.0124
NP_442039.1_7 Forward -69 -59 12.4681 0.231
NP_441811.1_8 Reverse -73 -87 13.8643 0.175
NP_442837.1_3 Forward -87 -80 15.7721 0.0124
NP_442837.1_3 Reverse -80 -87 15.7721 0.0124
NP_440160.1_5 Forward -234 -224 16.7941 0.181
NP_440160.1_9 Forward -331 -312 8.65258 0.258
NP_442053.1_1 Forward -88 -79 18.3876 0.0007
NP_442053.1_1 Reverse -79 -88 18.3876 0.0007
NP_442053.1_1 Reverse -165 -174 3.93297 0.278
NP_440505.1_3 Reverse -77 -87 16.303 0.00696
NP_440505.1_3 Forward -90 -80 16.303 0.00696
NP_440505.1_3 Forward -74 -64 9.22315 0.122
NP_441701.1_3 Forward -346 -329 7.31533 0.263
NP_441102.1_1 Reverse -80 -99 12.5858 0.108
NP_441203.1_1 Reverse -80 -99 -20.3551 0.297
NP_440914.1_1 Forward -88 -78 17.5935 0.000537
NP_440914.1_1 Reverse -79 -89 17.5935 0.000537
NP_440914.1_1 Forward -94 -84 9.98138 0.164
NP_440914.1_1 Forward -330 -320 8.32233 0.197
NP_441011.1_8 Forward -87 -78 8.25953 0.144
NP_441011.1_8 Reverse -80 -89 8.25953 0.144
NP_442533.1_1 Reverse -76 -95 -15.7335 0.257
NP_442533.1_6 Forward -88 -79 17.2076 0.00137
NP_442533.1_6 Reverse -79 -88 17.2076 0.00137
NP_441482.1_7 Reverse -73 -87 0.786239 0.0554
NP_441482.1_7 Forward -94 -80 0.786239 0.0554
NP_441482.1_7 Reverse -159 -173 -5.50694 0.184
NP_439944.1_9 Forward -87 -77 19.0562 0.00329
NP_439944.1_9 Reverse -80 -90 19.0562 0.00329
NP_440116.1_5 Forward -177 -160 5.74204 0.176
NP_440116.1_8 Reverse -80 -99 9.63589 0.0329
NP_440115.1_6 Reverse -226 -236 8.73149 0.128
NP_440115.1_6 Reverse -76 -86 8.4365 0.13
NP_440007.1_9 Forward -92 -78 10.3243 0.163
NP_440007.1_9 Forward -280 -266 7.07942 0.213
NP_440007.1_9 Reverse -75 -89 1.57289 0.285
NP_440007.1_9 Reverse -161 -175 0.786239 0.29
NP_443045.1_5 Reverse -316 -329 14.0439 0.275
NP_441602.1_3 Reverse -80 -99 -3.83545 0.253
NP_441972.1_5 Reverse -80 -99 -0.197208 0.163
NP_441106.1_1 Forward -89 -80 9.63616 0.0311
NP_441106.1_1 Reverse -78 -87 9.63616 0.0311
NP_441106.1_1 Reverse -72 -81 4.52295 0.219
NP_440429.1_2 Reverse -74 -93 13.3725 0.177
NP_439903.1_6 Forward -91 -72 5.60352 0.178
NP_440797.1_2 Reverse -68 -87 12.9594 0.241
NP_441286.1_1 Forward -89 -77 21.3768 0.00196
NP_441286.1_1 Reverse -78 -90 21.3768 0.00196
NP_442674.1_3 Forward -96 -77 10.3234 0.174
NP_442674.1_3 Reverse -71 -90 3.73524 0.294
NP_442674.1_3 Reverse -84 -103 2.6536 0.3
NP_442674.1_10 Forward -273 -254 9.0459 0.292
NP_440670.1_8 Forward -88 -79 18.3876 0.000699
NP_440670.1_8 Reverse -79 -88 18.3876 0.000699
NP_442463.1_3 Reverse -7 -26 10.5209 0.275
NP_441930.1_2 Forward -72 -62 11.2881 0.298
NP_440886.1_7 Forward -89 -79 7.94438 0.0805
NP_440886.1_7 Reverse -78 -88 7.94438 0.0805
NP_440886.1_7 Reverse -387 -397 5.87944 0.158
NP_440197.1_8 Forward -326 -307 21.5339 0.0282
NP_442614.1_2 Forward -88 -74 7.27608 0.275
NP_442614.1_2 Reverse -79 -93 5.89945 0.296
NP_442382.1_7 Forward -101 -82 13.7658 0.111
NP_440767.1_8 Reverse -123 -142 11.0125 0.268
NP_442072.1_9 Reverse -78 -96 -4.20908 0.0413
NP_440907.2_8 Forward -360 -350 8.63269 0.117
NP_442264.1_2 Reverse -75 -92 11.5436 0.181
NP_442264.1_2 Forward -92 -75 9.87194 0.193
NP_441021.1_1 Reverse -80 -99 -12.0953 0.279
NP_441021.1_4 Reverse -192 -211 11.5042 0.241
NP_441463.1_3 Forward -117 -98 8.25926 0.0487
NP_441463.1_3 Reverse -75 -94 -6.09707 0.239
NP_441463.1_3 Reverse -69 -88 -10.3253 0.293
NP_441463.1_6 Forward -90 -76 14.6298 0.165
NP_441463.1_6 Reverse -77 -91 7.96207 0.25
NP_441626.1_2 Forward -87 -80 15.7721 0.0124
NP_441626.1_2 Reverse -80 -87 15.7721 0.0124
NP_442365.1_7 Reverse -75 -94 -1.96717 0.198
NP_442365.1_7 Forward -92 -73 -2.36049 0.2
NP_440107.1_5 Forward -89 -70 0.392778 0.178
NP_440107.1_5 Reverse -78 -97 0.294447 0.178
NP_440107.1_5 Reverse -194 -213 -0.000545616 0.178
NP_440107.1_5 Forward -331 -312 -7.27704 0.281
NP_442794.1_1 Forward -92 -80 10.1671 0.0721
NP_442794.1_1 Reverse -75 -87 10.1671 0.0721
NP_442794.1_1 Reverse -219 -231 3.48056 0.286
NP_442615.1_1 Reverse -319 -337 -5.09406 0.204
NP_441962.1_4 Reverse -74 -93 -11.7019 0.244
NP_441962.1_4 Forward -124 -105 -14.5535 0.29
NP_441962.1_5 Reverse -310 -329 5.40766 0.29
NP_440387.1_1 Forward -88 -72 4.0901 0.0471
NP_440387.1_1 Reverse -79 -95 -3.97304 0.171
NP_441993.1_1 Reverse -328 -347 7.20938 0.172
NP_441993.1_1 Reverse -79 -98 3.506 0.233
NP_441993.1_1 Forward -88 -69 1.26449 0.282
NP_440358.1_8 Forward -294 -275 5.211 0.195
NP_442323.1_7 Reverse -74 -93 4.71854 0.215
NP_442323.1_7 Forward -93 -74 4.62021 0.215
NP_441510.2_7 Forward -94 -80 11.2087 0.28
NP_440287.1_6 Forward -97 -78 3.83436 0.208
NP_441552.1_3 Reverse -72 -91 12.29 0.292
NP_440766.1_4 Forward -92 -78 8.25939 0.0871
NP_440766.1_4 Reverse -75 -89 7.9644 0.0871
NP_440766.1_4 Forward -86 -72 1.96621 0.205
NP_440766.1_4 Reverse -81 -95 1.67122 0.22
NP_439988.1_7 Forward -319 -305 14.4536 0.292
NP_441979.1_5 Forward -94 -75 -11.8003 0.228
NP_442103.1_1 Reverse -264 -278 11.7993 0.269
NP_439910.1_2 Forward -96 -79 -13.8258 0.163
NP_439910.1_2 Forward -115 -98 -21.9873 0.202
NP_440457.1_1 Reverse -75 -87 8.88877 0.101
NP_440457.1_1 Forward -92 -80 7.02048 0.105
NP_442040.1_4 Forward -333 -314 15.6341 0.0736
NP_442509.1_9 Forward -88 -78 8.14104 0.192
NP_442509.1_9 Reverse -79 -89 8.14104 0.192
NP_442509.1_9 Reverse -165 -175 7.55106 0.214
NP_441253.1_8 Forward -383 -369 12.3106 0.21
NP_440554.1_4 Forward -87 -77 7.05986 0.106
NP_440554.1_4 Reverse -80 -90 7.05986 0.106
NP_440554.1_4 Forward -81 -71 5.87989 0.129
NP_440554.1_4 Reverse -99 -109 2.92996 0.248
NP_440554.1_4 Reverse -70 -80 2.92996 0.248
NP_442862.1_3 Forward -287 -270 7.90532 0.252
NP_442737.1_5 Reverse -78 -97 15.4968 0.166
NP_441885.1_5 Forward -88 -78 20.9245 0.000538
NP_441885.1_5 Reverse -79 -89 20.9245 0.000538
NP_441885.1_5 Forward -22 -12 -1.59326 0.273
NP_442341.1_7 Reverse -78 -92 18.0925 0.0111
NP_442341.1_7 Forward -89 -75 17.6992 0.0111
NP_442341.1_9 Forward -176 -162 12.782 0.0982
NP_442341.1_9 Reverse -77 -91 7.07881 0.204
NP_442341.1_9 Forward -90 -76 5.80051 0.255
NP_442395.2_4 Forward -175 -156 3.44025 0.202
NP_443000.1_7 Forward -90 -80 17.0896 0.00865
NP_443000.1_7 Reverse -77 -87 17.0896 0.00865
NP_440507.2_3 Reverse -70 -89 8.4551 0.253
NP_442513.1_5 Forward -96 -77 10.2251 0.266
NP_440275.1_3 Forward -90 -80 8.1415 0.0602
NP_440275.1_3 Reverse -77 -87 8.1415 0.0602
NP_440091.1_1 Forward -92 -80 8.88877 0.0567
NP_440091.1_1 Reverse -75 -87 6.43049 0.095
NP_442354.1_2 Reverse -224 -243 2.85105 0.299
NP_440679.1_4 Forward -33 -14 9.93088 0.261
NP_440679.1_10 Reverse -300 -319 -9.44032 0.18
NP_443010.1_10 Forward -91 -74 2.77079 0.27
NP_442451.1_2 Forward -96 -77 -2.16383 0.179
NP_442451.1_2 Reverse -71 -90 -8.55534 0.251
NP_440175.1_7 Reverse -312 -330 10.6318 0.25
NP_440149.1_8 Reverse -79 -98 17.8957 0.0125
NP_440149.1_8 Forward -88 -69 13.6675 0.0273
NP_441105.1_3 Forward -93 -74 -1.37718 0.148
NP_441105.1_3 Reverse -323 -342 -8.94866 0.281
NP_441105.1_3 Forward -99 -80 -9.63698 0.292
NP_440216.1_1 Reverse -79 -93 0.0979218 0.0284
NP_440216.1_1 Forward -88 -74 -9.34185 0.145
NP_440216.1_9 Reverse -275 -284 6.5879 0.289
NP_440172.1_1 Forward -88 -78 15.0247 0.00945
NP_440172.1_1 Reverse -79 -89 15.0247 0.00945
NP_442015.1_10 Reverse -75 -88 19.2922 0.00444
NP_442015.1_10 Forward -92 -79 10.344 0.0391
NP_441226.1_7 Forward -87 -80 14.4934 0.0123
NP_441226.1_7 Reverse -80 -87 14.4934 0.0123
NP_441226.1_7 Reverse -166 -173 8.59356 0.197
NP_441111.1_7 Forward -87 -79 18.7023 0.00294
NP_441111.1_7 Reverse -80 -88 18.7023 0.00294
NP_440244.1_1 Reverse -237 -256 -9.63698 0.287
NP_441766.1_2 Forward -88 -79 17.5026 0.00297
NP_441766.1_2 Reverse -79 -88 17.5026 0.00297
NP_441766.1_2 Forward -107 -98 2.55633 0.257
NP_442417.1_5 Forward -131 -117 6.19444 0.231
NP_442417.1_5 Reverse -165 -179 5.01447 0.278
NP_440416.1_9 Forward -89 -70 -9.93197 0.135
NP_440416.1_9 Reverse -62 -81 -10.6203 0.143
NP_440416.1_9 Forward -95 -76 -16.4218 0.215
NP_443052.1_8 Forward -117 -98 -1.37718 0.0793
NP_443052.1_8 Forward -44 -25 -6.58872 0.143
NP_440591.1_9 Forward -89 -71 17.3254 0.0619
NP_442154.1_1 Reverse -296 -314 -18.0738 0.276
NP_441430.1_6 Forward -320 -301 10.2259 0.279
NP_442564.1_10 Reverse -230 -244 13.7659 0.244
NP_442046.1_8 Reverse -80 -99 10.3242 0.293
NP_440261.1_5 Forward -87 -74 -4.50394 0.151
NP_440261.1_5 Reverse -80 -93 -10.5021 0.201
NP_440988.1_10 Forward -90 -76 10.4172 0.187
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CATCAAGGTTGGGGTCAAGATTGTCGAAGGTGGGAAAGAACGGATCCAACCCTACGAAGGCACCGTCATTGCCAAACGCAACGGCGGCATCAGCGAAACCATTACCGTACGGAAAATTTTCCAAGGTGTTGGTGTGGAAAGGGTTTTCCTGCTCCATTCTCCCCGGGTTGCCAGCATCAAAGTGTTGCGCCGCGGTAAGGTTCGTCGGGCCAAACTTTACTATCTCCGGGATCGGGTTGGTAAAGCTACCCGCATCAAGCAGCGGTTTGACCGGGCTCTGTAGTCAGCGAAACTGTGATCTCCAACACCAATGGCGATCGCCATCGATGGGAATTGGCAGCAAATTAGGGTATGATGGTGCCAGAGTGCAGACTCCAGGGCTAACCTCAGCCCAGACTAT

CDS

No sequence available

Protein

No sequence available