Your browser is old and dusty. Try Google Chrome!

Details for 6803t07

ORF 6803t07
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -334 -348 2.75286 0.172
NP_440795.1_10 Forward -131 -112 13.0766 0.219
NP_441453.1_4 Forward -323 -315 7.19758 0.0757
NP_441453.1_4 Reverse -314 -322 6.70593 0.121
NP_441453.1_4 Reverse -184 -192 5.13263 0.179
NP_441453.1_7 Forward -124 -117 12.9205 0.23
NP_441623.1_1 Reverse -117 -135 -4.50408 0.274
NP_440226.1_1 Reverse -314 -333 10.2259 0.0646
NP_442173.1_1 Forward -322 -314 5.82095 0.2
NP_442173.1_1 Reverse -315 -323 5.72262 0.203
NP_442752.1_4 Reverse -314 -321 13.8055 0.0199
NP_442752.1_4 Forward -193 -186 10.8555 0.0846
NP_442752.1_4 Forward -29 -22 5.44732 0.202
NP_443027.1_4 Reverse -182 -192 5.97822 0.294
NP_442975.1_10 Forward -327 -313 7.66879 0.122
NP_440784.1_7 Forward -322 -315 6.23397 0.241
NP_440784.1_7 Reverse -315 -322 6.13563 0.241
NP_440061.1_9 Reverse -182 -196 12.8803 0.0903
NP_440061.1_9 Reverse -338 -352 5.70218 0.275
NP_440928.1_5 Forward -269 -251 9.75391 0.183
NP_440110.1_8 Forward -350 -331 -1.27885 0.238
NP_440878.1_9 Reverse -362 -381 -2.95047 0.281
NP_442062.1_8 Reverse -266 -276 3.51995 0.267
NP_442062.1_8 Forward -381 -371 2.83163 0.293
NP_441641.1_5 Forward -46 -27 15.5357 0.18
NP_442242.1_4 Reverse -315 -322 12.4288 0.0393
NP_441200.1_4 Forward -215 -196 9.73422 0.224
NP_441208.1_9 Reverse -311 -325 5.99778 0.254
NP_442276.1_2 Reverse -341 -360 10.9142 0.273
NP_441365.1_5 Forward -287 -268 -3.24547 0.11
NP_442110.1_7 Forward -363 -349 3.44117 0.21
NP_441083.1_5 Forward -323 -313 2.04498 0.195
NP_441083.1_5 Reverse -314 -324 1.65166 0.2
NP_441083.1_5 Reverse -184 -194 -0.708283 0.276
NP_441434.1_7 Reverse -4 -18 1.76955 0.295
NP_441738.1_2 Forward -321 -314 15.28 0.0102
NP_441738.1_2 Reverse -22 -29 10.2652 0.101
NP_440209.1_1 Reverse -314 -322 14.8674 0.012
NP_440209.1_1 Forward -323 -315 8.57422 0.0425
NP_441444.1_1 Forward -111 -92 7.37428 0.224
NP_442889.1_1 Reverse -249 -268 -13.7669 0.268
NP_442889.1_10 Forward -38 -19 12.1581 0.215
NP_441713.1_1 Reverse -308 -327 -7.4737 0.13
NP_440178.1_7 Forward -400 -381 -21.7317 0.237
NP_442570.1_3 Forward -389 -370 15.4374 0.0628
NP_442570.1_3 Forward -351 -332 -5.80207 0.25
NP_442570.1_3 Forward -390 -371 -6.68705 0.259
NP_442111.1_4 Reverse -183 -197 5.99778 0.142
NP_441624.1_7 Reverse -348 -362 8.06273 0.241
NP_440906.1_5 Forward -322 -315 12.0355 0.0724
NP_440906.1_5 Reverse -315 -322 12.0355 0.0724
NP_440747.1_10 Reverse -311 -323 5.44718 0.0137
NP_440747.1_10 Forward -326 -314 -4.28759 0.0903
NP_440747.1_10 Forward -268 -256 -12.1541 0.227
NP_440747.1_10 Forward -196 -184 -12.2524 0.254
NP_442330.1_4 Forward -212 -193 12.7015 0.286
NP_442634.1_4 Forward -325 -311 -1.8687 0.149
NP_442634.1_4 Forward -195 -181 -3.24533 0.161
NP_441014.1_5 Forward -269 -251 10.0489 0.269
NP_439978.1_1 Forward -37 -21 7.63002 0.297
NP_443018.1_3 Forward -322 -315 5.34899 0.212
NP_443018.1_3 Reverse -315 -322 5.34899 0.212
NP_441316.1_7 Forward -325 -310 2.24151 0.156
NP_440376.1_1 Forward -323 -314 9.73449 0.0365
NP_440376.1_1 Reverse -314 -323 9.73449 0.0365
NP_440376.1_1 Forward -363 -354 0.196389 0.283
NP_441588.1_4 Forward -321 -311 7.05986 0.178
NP_442687.1_7 Reverse -313 -323 7.45319 0.132
NP_442687.1_7 Forward -194 -184 5.48657 0.2
NP_442687.1_7 Reverse -389 -399 4.79825 0.234
NP_441846.1_10 Forward -234 -215 -22.5183 0.261
NP_441846.1_10 Forward -22 -3 -23.7966 0.298
NP_442958.1_9 Forward -272 -262 16.893 0.277
NP_441029.1_3 Forward -95 -76 5.89931 0.277
NP_440533.1_9 Forward -323 -304 10.6192 0.131
NP_442658.1_1 Forward -325 -315 9.71433 0.147
NP_442658.1_1 Reverse -370 -380 7.0594 0.214
NP_442658.1_1 Forward -277 -267 4.99446 0.288
NP_440141.1_8 Forward -351 -332 5.99764 0.271
NP_442782.1_2 Reverse -287 -301 2.2612 0.275
NP_442782.1_2 Reverse -261 -275 0.392915 0.29
NP_441414.1_9 Reverse -314 -333 -7.37537 0.217
NP_441256.1_8 Forward -225 -206 8.65258 0.228
NP_442937.1_5 Reverse -282 -301 5.89931 0.295
NP_441958.1_5 Reverse -313 -323 11.6814 0.00361
NP_441958.1_5 Forward -324 -314 11.4848 0.00522
NP_441958.1_5 Forward -194 -184 7.15819 0.0362
NP_442836.1_10 Reverse -88 -98 10.4031 0.269
NP_440203.1_5 Forward -320 -310 11.091 0.205
NP_440203.1_5 Reverse -149 -159 9.321 0.263
NP_440203.1_5 Reverse -22 -32 9.12434 0.271
NP_439905.1_1 Reverse -334 -347 7.59077 0.255
NP_443001.1_5 Forward -42 -23 11.5042 0.248
NP_440984.1_7 Forward -328 -314 9.34103 0.127
NP_441162.1_3 Reverse -341 -360 18.879 0.0626
NP_441580.1_6 Reverse -173 -192 -6.1954 0.235
NP_440827.1_3 Reverse -361 -380 12.5858 0.247
NP_440496.1_1 Forward -46 -27 0.58944 0.289
NP_441429.1_8 Forward -387 -368 16.9124 0.191
NP_443044.1_1 Reverse -100 -119 3.04771 0.295
NP_439975.1_2 Reverse -83 -101 5.23069 0.283
NP_442002.1_1 Forward -352 -334 -1.06249 0.192
NP_442002.1_1 Reverse -79 -97 -6.1757 0.249
NP_442002.1_1 Forward -89 -71 -8.24065 0.263
NP_442002.1_9 Forward -194 -187 14.1004 0.074
NP_442002.1_9 Reverse -389 -396 12.2322 0.185
NP_441654.1_6 Forward -113 -95 14.3258 0.278
NP_440106.1_2 Reverse -287 -305 9.0656 0.298
NP_442885.1_6 Forward -119 -101 16.9313 0.184
NP_441752.1_6 Reverse -331 -350 -0.590531 0.279
NP_440147.1_4 Reverse -312 -325 2.96921 0.199
NP_440147.1_4 Forward -325 -312 2.67422 0.203
NP_441550.1_8 Forward -195 -185 7.0594 0.178
NP_441550.1_8 Forward -325 -315 6.17443 0.214
NP_441550.1_8 Reverse -312 -322 5.97777 0.22
NP_441916.1_7 Forward -323 -313 9.41981 0.0357
NP_441916.1_7 Reverse -314 -324 9.12481 0.0396
NP_441041.1_4 Forward -323 -304 -10.522 0.233
NP_441041.1_4 Reverse -354 -373 -13.6686 0.293
NP_441041.1_7 Forward -196 -184 8.87526 0.128
NP_441547.1_2 Forward -386 -368 2.87075 0.294
NP_442004.1_6 Forward -323 -309 2.75286 0.257
NP_442004.1_6 Reverse -184 -198 2.5562 0.263
NP_440703.1_9 Reverse -384 -397 10.0485 0.208
NP_440202.1_8 Forward -274 -255 10.9735 0.284
NP_442941.1_3 Forward -322 -312 1.35667 0.15
NP_442941.1_3 Reverse -315 -325 1.25834 0.15
NP_442941.1_5 Reverse -132 -146 16.1483 0.238
NP_441678.1_9 Forward -276 -257 7.17762 0.17
NP_442281.1_1 Reverse -309 -323 5.99717 0.139
NP_442281.1_1 Reverse -179 -193 5.40719 0.159
NP_442281.1_1 Reverse -50 -64 2.16228 0.276
NP_442847.1_7 Forward -381 -362 12.9791 0.286
NP_001035871.2_7 Reverse -263 -273 13.943 0.219
NP_442012.1_1 Reverse -308 -327 -1.47551 0.289
NP_442012.1_5 Forward -211 -192 -0.4922 0.288
NP_440723.1_8 Forward -349 -335 10.7177 0.259
NP_440498.1_1 Reverse -305 -323 7.78729 0.0827
NP_443030.1_4 Reverse -365 -384 -7.57203 0.298
NP_442068.1_4 Reverse -216 -235 9.63507 0.184
NP_441644.1_6 Reverse -314 -324 14.7292 0.0105
NP_441644.1_6 Forward -323 -313 10.206 0.0628
NP_441644.1_6 Reverse -184 -194 3.32285 0.288
NP_442215.1_1 Forward -274 -255 3.34271 0.288
NP_442029.1_6 Forward -269 -250 11.3075 0.164
NP_442029.1_6 Forward -386 -367 7.96426 0.217
NP_442029.1_10 Reverse -73 -92 11.2092 0.192
NP_440253.1_2 Forward -351 -333 2.0841 0.144
NP_440929.1_8 Forward -323 -314 9.73449 0.0257
NP_440929.1_8 Reverse -314 -323 9.4395 0.0326
NP_442933.1_1 Reverse -133 -152 15.708 0.168
NP_442933.1_10 Reverse -314 -323 13.9627 0.0192
NP_442933.1_10 Forward -323 -314 8.1612 0.0885
NP_441310.1_10 Forward -45 -35 15.7909 0.131
NP_441751.2_8 Forward -322 -308 -4.4253 0.173
NP_441751.2_8 Reverse -185 -199 -5.40861 0.206
NP_442926.1_5 Forward -198 -179 11.8235 0.198
NP_440096.1_6 Forward -206 -187 17.994 0.141
NP_442554.1_8 Reverse -315 -325 6.8632 0.103
NP_442554.1_8 Forward -322 -312 6.66654 0.111
NP_442142.1_4 Forward -326 -313 3.26365 0.262
NP_442142.1_4 Reverse -311 -324 2.47701 0.29
NP_442292.1_1 Forward -322 -313 7.76787 0.0615
NP_442292.1_1 Reverse -315 -324 7.66954 0.0634
NP_442476.1_6 Reverse -185 -199 4.71948 0.142
NP_440895.1_6 Reverse -308 -321 10.8357 0.202
NP_443009.1_5 Forward -324 -313 12.8412 0.0416
NP_443009.1_5 Reverse -313 -324 5.95804 0.18
NP_443009.1_5 Forward -194 -183 4.58141 0.239
NP_443009.1_5 Forward -65 -54 4.48308 0.244
NP_440730.1_4 Reverse -80 -99 -3.83545 0.298
NP_441468.1_1 Forward -322 -315 6.13563 0.209
NP_441468.1_1 Reverse -315 -322 6.0373 0.223
NP_439939.1_3 Forward -77 -58 -3.83545 0.293
NP_441015.1_1 Forward -303 -285 8.57394 0.277
NP_441015.1_10 Forward -209 -190 -0.590531 0.169
NP_441673.1_1 Forward -323 -314 11.1111 0.0121
NP_441673.1_1 Reverse -314 -323 11.0128 0.018
NP_442253.1_5 Reverse -252 -269 -0.944468 0.234
NP_440265.1_8 Reverse -375 -393 17.8171 0.16
NP_441826.1_5 Forward -210 -191 1.57275 0.289
NP_441637.1_9 Reverse -138 -156 4.24738 0.245
NP_441764.1_8 Reverse -100 -110 13.7033 0.284
NP_442868.1_6 Forward -195 -185 5.87989 0.136
NP_442719.1_2 Reverse -225 -243 -9.91296 0.268
NP_442808.1_1 Forward -324 -314 7.45273 0.0783
NP_440145.1_3 Reverse -304 -323 0.58944 0.135
NP_440145.1_3 Reverse -45 -64 0.196116 0.137
NP_440145.1_3 Forward -275 -256 -6.09707 0.288
NP_442542.1_9 Reverse -347 -361 8.94708 0.144
NP_442542.1_9 Forward -90 -76 6.68548 0.227
NP_442050.1_1 Forward -90 -71 8.84924 0.25
NP_441114.1_3 Reverse -373 -382 17.1093 0.113
NP_441114.1_3 Reverse -56 -65 6.39124 0.277
NP_440558.1_2 Forward -268 -249 -6.68705 0.279
NP_441878.1_6 Forward -324 -314 0.766681 0.134
NP_441878.1_6 Reverse -313 -323 0.668351 0.139
NP_441036.1_3 Forward -218 -199 -5.40875 0.286
NP_441036.1_8 Forward -324 -314 14.1397 0.0298
NP_441036.1_8 Reverse -313 -323 6.8632 0.213
NP_441036.1_8 Reverse -183 -193 5.28991 0.295
NP_441557.1_5 Forward -323 -314 10.2261 0.0144
NP_441557.1_5 Reverse -314 -323 10.1278 0.0188
NP_441557.1_5 Forward -193 -184 -0.885252 0.26
NP_441433.1_8 Forward -385 -366 1.96607 0.232
NP_441739.1_2 Reverse -19 -35 5.36772 0.228
NP_440101.1_3 Forward -198 -179 1.96607 0.262
NP_442830.1_5 Reverse -371 -385 -1.86927 0.3
NP_442469.1_2 Forward -267 -249 16.3421 0.216
NP_440762.1_2 Reverse -33 -52 14.7491 0.0948
NP_442183.1_1 Reverse -314 -328 3.8345 0.295
NP_441574.1_1 Forward -375 -356 -2.65548 0.228
NP_441549.1_9 Reverse -180 -198 -9.81395 0.261
NP_442645.1_2 Forward -389 -370 -16.1268 0.224
NP_442965.1_2 Reverse -373 -392 -7.76869 0.274
NP_441037.1_4 Reverse -312 -322 13.9448 0.0515
NP_442594.1_8 Forward -30 -11 3.73603 0.279
NP_442047.1_2 Reverse -274 -288 11.7993 0.297
NP_440136.1_2 Forward -322 -315 6.23397 0.171
NP_440136.1_2 Reverse -315 -322 6.13563 0.193
NP_442998.1_5 Forward -80 -70 9.81313 0.233
NP_442998.1_5 Forward -41 -31 9.51814 0.238
NP_442998.1_5 Reverse -60 -70 7.15819 0.299
NP_442998.1_10 Forward -321 -314 15.5754 0.0102
NP_442998.1_10 Reverse -186 -193 6.0373 0.205
NP_442998.1_10 Reverse -316 -323 5.74231 0.255
NP_440899.1_1 Forward -276 -257 11.0424 0.174
NP_440299.1_1 Reverse -227 -240 7.09854 0.121
NP_441799.1_1 Reverse -310 -324 10.0287 0.0797
NP_441799.1_1 Forward -327 -313 8.3571 0.117
NP_442802.1_2 Reverse -341 -360 13.47 0.235
NP_441007.1_10 Reverse -309 -322 10.2457 0.0723
NP_441007.1_10 Forward -328 -315 0.510939 0.226
NP_442333.2_5 Reverse -373 -392 -8.16202 0.238
NP_442333.2_5 Reverse -343 -362 -9.24366 0.246
NP_440256.1_1 Reverse -311 -330 -5.11376 0.174
NP_440256.1_1 Forward -196 -177 -9.83364 0.289
NP_441559.1_8 Reverse -261 -275 1.96621 0.151
NP_441559.1_8 Reverse -250 -264 -5.21195 0.254
NP_441559.1_8 Reverse -367 -381 -5.40861 0.261
NP_441559.1_8 Reverse -262 -276 -5.40861 0.261
NP_440915.1_6 Forward -197 -183 6.58777 0.0825
NP_441866.1_6 Forward -66 -47 9.7334 0.235
NP_442069.1_4 Forward -172 -153 6.39097 0.245
NP_440748.1_5 Reverse -374 -393 -0.983855 0.264
NP_440695.1_5 Forward -335 -316 1.0811 0.284
NP_441199.1_6 Forward -308 -289 2.55606 0.198
NP_442993.1_1 Forward -193 -177 -2.10475 0.107
NP_442993.1_1 Reverse -218 -234 -11.7412 0.257
NP_442993.1_1 Forward -323 -307 -12.7245 0.278
NP_442386.1_9 Reverse -371 -380 9.14408 0.172
NP_442386.1_9 Forward -266 -257 6.88247 0.219
NP_441340.1_5 Reverse -315 -322 6.13563 0.175
NP_441340.1_5 Forward -322 -315 5.93897 0.198
NP_441340.1_9 Forward -42 -32 9.21929 0.236
NP_441340.1_9 Reverse -101 -111 7.966 0.256
NP_441947.1_10 Reverse -242 -260 -0.669169 0.276
NP_441297.1_8 Reverse -359 -377 11.0314 0.238
NP_440327.1_6 Reverse -77 -96 7.17762 0.228
NP_440161.1_3 Forward -298 -279 9.53756 0.242
NP_442714.1_7 Reverse -315 -334 7.07928 0.16
NP_442950.1_1 Reverse -97 -116 5.211 0.17
NP_440586.1_8 Reverse -315 -322 11.4451 0.0645
NP_442251.1_6 Forward -322 -315 12.0355 0.0627
NP_441262.1_3 Reverse -314 -321 14.7888 0.0223
NP_443051.1_1 Reverse -313 -322 9.93116 0.0146
NP_443051.1_1 Forward -324 -315 9.83282 0.0203
NP_443051.1_1 Forward -194 -185 5.3096 0.0964
NP_441232.1_10 Forward -392 -373 1.57275 0.279
NP_439937.1_8 Forward -212 -193 3.14605 0.207
NP_441657.1_5 Forward -353 -334 -0.0988766 0.237
NP_440408.1_7 Forward -276 -257 10.4225 0.247
NP_440408.1_7 Forward -363 -344 8.35759 0.281
NP_440439.1_1 Reverse -181 -194 0.0192843 0.203
NP_440439.1_1 Reverse -311 -324 -0.570702 0.226
NP_439943.1_1 Forward -70 -51 -5.50708 0.232
NP_439943.1_4 Forward -399 -380 7.07928 0.265
NP_440372.1_2 Reverse -315 -322 6.72562 0.0929
NP_440372.1_2 Forward -322 -315 6.62729 0.151
NP_441138.1_5 Reverse -140 -153 6.93719 0.261
NP_441181.1_6 Forward -218 -200 6.214 0.219
NP_440991.1_8 Forward -294 -275 14.9299 0.268
NP_441572.1_1 Reverse -284 -303 -4.32711 0.235
NP_441572.1_7 Reverse -178 -197 -6.49039 0.293
NP_442384.1_10 Forward -323 -310 10.1474 0.047
NP_442384.1_10 Reverse -184 -197 7.78743 0.0743
NP_442384.1_10 Reverse -314 -327 4.05085 0.17
NP_441877.1_5 Reverse -252 -271 -1.86883 0.291
NP_441018.1_7 Forward -33 -14 7.7676 0.265
NP_441689.1_5 Reverse -182 -192 15.6142 0.0403
NP_440344.1_10 Forward -103 -86 -12.2525 0.246
NP_440562.1_9 Reverse -289 -308 23.5006 0.035
NP_441965.1_10 Forward -326 -310 4.3851 0.242
NP_440350.1_1 Forward -398 -379 8.35759 0.12
NP_442280.1_10 Forward -391 -373 6.52583 0.274
NP_441896.1_5 Forward -387 -380 15.3787 0.268
NP_440700.1_8 Forward -276 -262 14.2576 0.232
NP_442553.1_4 Forward -277 -258 8.25926 0.273
NP_440999.1_2 Reverse -378 -397 8.84924 0.288
NP_442892.1_6 Forward -320 -301 3.6377 0.246
NP_440600.1_4 Forward -331 -313 -7.84733 0.294
NP_440575.1_1 Forward -111 -92 17.6982 0.0626
NP_441543.1_2 Reverse -315 -324 6.48957 0.145
NP_441543.1_2 Forward -322 -313 6.19458 0.153
NP_442845.1_2 Forward -276 -262 8.25939 0.195
NP_442845.1_2 Reverse -308 -322 6.29277 0.212
NP_442845.1_2 Forward -387 -373 5.70279 0.225
NP_442845.1_2 Reverse -161 -175 5.01447 0.247
NP_441469.1_8 Reverse -371 -380 11.5045 0.165
NP_443064.1_6 Forward -323 -313 9.75513 0.199
NP_443064.1_6 Reverse -184 -194 8.6886 0.276
NP_442578.1_7 Reverse -315 -322 5.93897 0.183
NP_440220.1_4 Reverse -259 -278 2.35861 0.23
NP_441462.1_2 Reverse -314 -324 10.7964 0.00567
NP_441462.1_2 Forward -323 -313 10.5014 0.00824
NP_441462.1_2 Forward -193 -183 7.64985 0.0543
NP_441621.1_7 Reverse -340 -354 -3.04867 0.188
NP_441929.1_3 Forward -114 -95 2.85105 0.266
NP_441929.1_3 Reverse -61 -80 1.0811 0.298
NP_443062.1_1 Reverse -314 -332 11.1786 0.103
NP_440519.1_3 Reverse -256 -275 9.93088 0.268
NP_440519.1_8 Forward -348 -332 4.87675 0.212
NP_442204.1_1 Reverse -310 -321 8.4168 0.0945
NP_440544.1_5 Forward -107 -100 13.8024 0.28
NP_440516.1_8 Reverse -314 -323 15.6344 0.00582
NP_440516.1_8 Forward -323 -314 7.47288 0.0581
NP_440516.1_8 Forward -193 -184 -0.393597 0.255
NP_442428.1_5 Forward -322 -315 6.13563 0.209
NP_442428.1_5 Reverse -315 -322 6.0373 0.212
NP_442859.1_2 Reverse -262 -281 3.44104 0.253
NP_442823.1_8 Forward -374 -355 10.1275 0.298
NP_440673.1_3 Forward -321 -314 12.4288 0.0426
NP_440673.1_3 Forward -62 -55 10.5605 0.123
NP_441052.1_2 Reverse -372 -382 6.07655 0.0943
NP_441052.1_2 Reverse -314 -324 0.766681 0.256
NP_441052.1_2 Forward -323 -313 0.668351 0.256
NP_440436.1_4 Forward -322 -313 5.9975 0.174
NP_440436.1_4 Reverse -315 -324 5.9975 0.174
NP_440314.1_9 Reverse -315 -334 11.6025 0.0289
NP_440314.1_9 Forward -322 -303 -8.752 0.253
NP_442414.1_3 Reverse -105 -124 10.8159 0.22
NP_441719.1_4 Reverse -315 -322 6.72562 0.093
NP_441719.1_4 Forward -322 -315 6.62729 0.151
NP_441363.1_4 Forward -156 -137 7.47261 0.277
NP_441004.1_1 Forward -210 -191 -13.0786 0.253
NP_441004.1_1 Forward -216 -197 -16.6185 0.286
NP_442813.1_5 Reverse -251 -270 7.37428 0.19
NP_441231.1_3 Reverse -148 -167 12.7816 0.259
NP_442366.1_5 Reverse -311 -321 14.0409 0.0497
NP_442206.1_10 Forward -193 -178 0.668214 0.25
NP_441851.1_10 Forward -266 -256 8.92815 0.114
NP_441851.1_10 Forward -194 -184 7.15819 0.147
NP_442208.1_5 Forward -350 -331 -10.6203 0.299
NP_440495.1_8 Forward -320 -301 5.211 0.212
NP_441668.1_4 Forward -372 -353 3.44104 0.187
NP_441668.1_4 Forward -207 -188 0.491109 0.237
NP_441349.1_10 Reverse -304 -323 -3.24547 0.136
NP_441409.1_6 Forward -329 -310 -15.3402 0.29
NP_442843.1_1 Reverse -373 -392 -10.522 0.278
NP_442843.1_1 Reverse -355 -374 -10.522 0.278
NP_439960.1_10 Reverse -344 -362 -1.55415 0.242
NP_440431.1_3 Forward -324 -305 -6.09707 0.188
NP_442168.1_5 Reverse -373 -392 11.3075 0.137
NP_441031.1_8 Forward -362 -343 -2.55715 0.248
NP_442006.1_2 Reverse -115 -132 -17.1691 0.27
NP_441078.1_4 Forward -323 -314 9.93116 0.0203
NP_441078.1_4 Reverse -314 -323 9.83282 0.0226
NP_441078.1_4 Reverse -267 -276 3.7363 0.131
NP_442443.1_1 Forward -358 -339 -4.91709 0.28
NP_440793.1_1 Forward -108 -94 9.6354 0.293
NP_441432.1_8 Reverse -313 -322 7.17789 0.102
NP_441432.1_8 Forward -324 -315 7.07956 0.105
NP_442344.1_7 Forward -322 -303 -8.94866 0.232
NP_441732.1_2 Reverse -310 -326 -17.641 0.281
NP_440760.1_1 Reverse -314 -333 -20.2567 0.222
NP_442353.1_4 Reverse -366 -385 6.1935 0.18
NP_441023.1_1 Reverse -340 -358 11.6222 0.238
NP_441072.1_2 Forward -204 -185 5.99764 0.295
NP_442489.1_7 Forward -323 -314 10.6195 0.00984
NP_442489.1_7 Reverse -314 -323 10.3245 0.0193
NP_442079.1_7 Reverse -315 -334 1.96607 0.24
NP_440559.1_1 Forward -322 -313 5.40793 0.14
NP_442763.1_10 Reverse -334 -353 -0.0988766 0.299
NP_441659.2_8 Reverse -314 -324 17.5813 0.0024
NP_441659.2_8 Forward -323 -313 11.3864 0.0184
NP_441659.2_8 Reverse -184 -194 4.20827 0.142
NP_442749.1_5 Reverse -21 -38 15.9362 0.159
NP_442008.1_2 Forward -352 -333 4.52268 0.237
NP_442346.1_5 Reverse -313 -323 14.9263 0.00941
NP_442346.1_5 Reverse -54 -64 9.22315 0.118
NP_442346.1_5 Forward -324 -314 6.56821 0.198
NP_440486.1_6 Forward -350 -331 10.1275 0.219
NP_440847.1_3 Reverse -70 -84 14.0603 0.206
NP_442828.1_7 Forward -352 -333 -0.39387 0.276
NP_441833.1_4 Forward -322 -315 14.1004 0.0258
NP_441833.1_4 Reverse -315 -322 6.13563 0.198
NP_441895.1_2 Forward -46 -27 -17.7001 0.234
NP_441895.1_10 Forward -45 -26 -27.8282 0.299
NP_442699.1_3 Reverse -198 -217 4.42435 0.186
NP_442162.1_9 Forward -322 -315 6.62729 0.142
NP_442162.1_9 Reverse -315 -322 6.52896 0.178
NP_442546.1_4 Reverse -89 -107 11.3272 0.227
NP_441915.1_4 Reverse -113 -132 5.11187 0.3
NP_442140.1_3 Reverse -315 -325 5.19158 0.221
NP_440875.1_9 Forward -321 -311 8.37203 0.233
NP_441813.1_5 Reverse -182 -192 2.24165 0.194
NP_440590.1_4 Reverse -88 -101 -0.570702 0.192
NP_440567.1_1 Forward -322 -308 5.89945 0.0945
NP_440567.1_1 Reverse -315 -329 1.57289 0.2
NP_440719.1_4 Reverse -86 -104 20.5703 0.245
NP_442497.1_10 Forward -322 -313 7.86621 0.0695
NP_442497.1_10 Reverse -315 -324 7.76787 0.0731
NP_442497.1_10 Reverse -185 -194 0.29472 0.199
NP_441239.1_9 Reverse -182 -194 8.9871 0.117
NP_441239.1_9 Forward -364 -352 7.4138 0.161
NP_441239.1_9 Reverse -352 -364 4.8572 0.239
NP_441951.1_3 Reverse -206 -225 18.0924 0.286
NP_440400.1_1 Reverse -344 -363 -2.65624 0.285
NP_441017.1_6 Reverse -51 -65 13.7653 0.174
NP_441874.1_1 Reverse -84 -98 11.2093 0.249
NP_442216.1_4 Reverse -148 -156 17.6202 0.23
NP_441936.1_3 Reverse -201 -220 12.4867 0.184
NP_442138.1_9 Reverse -377 -396 11.405 0.202
NP_442052.1_3 Forward -388 -369 9.53756 0.267
NP_440546.1_4 Reverse -314 -324 11.5004 0.0806
NP_440546.1_4 Reverse -184 -194 7.71902 0.224
NP_440546.1_4 Forward -193 -183 6.45857 0.296
NP_440546.1_6 Forward -379 -360 6.4893 0.3
NP_440462.1_1 Forward -270 -257 18.1578 0.3
NP_440462.1_6 Reverse -182 -192 11.4848 0.0396
NP_440868.1_4 Reverse -310 -322 5.54551 0.0954
NP_440868.1_4 Forward -327 -315 -1.14099 0.296
NP_442479.1_9 Forward -29 -10 -8.06369 0.266
NP_440341.1_1 Forward -351 -332 6.29264 0.23
NP_442402.1_4 Reverse -259 -278 -9.53937 0.291
NP_442402.1_4 Reverse -219 -238 -9.73604 0.292
NP_442402.1_6 Forward -159 -150 14.8477 0.241
NP_441848.1_7 Forward -114 -95 -4.1312 0.287
NP_441084.1_6 Reverse -381 -395 17.9733 0.0523
NP_441084.1_6 Reverse -53 -67 17.6824 0.0523
NP_442882.1_7 Reverse -2 -16 11.012 0.272
NP_442039.1_4 Forward -192 -185 8.10225 0.221
NP_442039.1_7 Forward -123 -113 10.9931 0.257
NP_442039.1_7 Forward -293 -283 7.05986 0.283
NP_442837.1_3 Forward -322 -315 6.13563 0.25
NP_442837.1_3 Reverse -315 -322 5.93897 0.265
NP_440160.1_2 Forward -276 -257 -7.86702 0.286
NP_442053.1_1 Forward -323 -314 9.34117 0.0666
NP_442053.1_1 Reverse -314 -323 8.55452 0.0784
NP_442053.1_1 Reverse -184 -193 3.83464 0.285
NP_440505.1_3 Forward -31 -21 10.3048 0.112
NP_440505.1_3 Reverse -312 -322 6.76487 0.169
NP_440505.1_3 Forward -195 -185 4.69992 0.272
NP_441102.1_1 Forward -392 -373 5.211 0.256
NP_441408.2_7 Reverse -53 -72 1.57275 0.215
NP_440914.1_1 Forward -323 -313 14.7634 0.00997
NP_440914.1_1 Reverse -372 -382 11.3477 0.097
NP_440914.1_1 Reverse -20 -30 9.68861 0.178
NP_440914.1_1 Reverse -314 -324 6.56569 0.273
NP_441011.1_8 Forward -192 -183 10.8161 0.094
NP_441011.1_8 Forward -322 -313 6.8829 0.18
NP_441011.1_8 Reverse -315 -324 6.8829 0.18
NP_442101.1_6 Forward -385 -366 12.8808 0.23
NP_442533.1_1 Reverse -289 -308 -15.9302 0.26
NP_442533.1_6 Forward -323 -314 7.66954 0.0897
NP_442533.1_6 Reverse -314 -323 7.37455 0.0898
NP_442533.1_6 Forward -193 -184 4.71961 0.177
NP_442533.1_6 Reverse -354 -363 2.06468 0.275
NP_442322.1_4 Reverse -207 -224 -2.22346 0.229
NP_442229.1_1 Forward -325 -311 6.19383 0.235
NP_441482.1_7 Forward -199 -185 -11.1118 0.237
NP_441482.1_7 Reverse -308 -322 -11.2101 0.245
NP_439944.1_9 Reverse -315 -325 7.15819 0.153
NP_442269.1_4 Forward -365 -346 12.9791 0.283
NP_441697.1_5 Forward -145 -126 -11.0297 0.29
NP_441028.1_6 Reverse -34 -44 4.7978 0.277
NP_441028.1_6 Forward -395 -385 3.8145 0.281
NP_440116.1_5 Reverse -311 -328 5.9387 0.172
NP_440116.1_8 Forward -192 -173 5.89931 0.0608
NP_441527.1_4 Reverse -89 -108 -12.2711 0.285
NP_440115.1_6 Forward -196 -186 14.7297 0.0588
NP_440115.1_6 Reverse -311 -321 7.35486 0.147
NP_440007.1_9 Forward -197 -183 6.88276 0.216
NP_440007.1_9 Reverse -263 -277 1.47456 0.285
NP_442728.1_7 Reverse -347 -361 11.6026 0.289
NP_443045.1_9 Reverse -208 -226 7.29487 0.279
NP_441602.1_3 Forward -368 -349 6.68596 0.128
NP_441170.1_4 Forward -390 -372 7.09898 0.194
NP_441972.1_5 Reverse -373 -392 4.03102 0.11
NP_441106.1_1 Forward -324 -315 15.1427 0.0138
NP_441106.1_1 Reverse -313 -322 8.65285 0.0522
NP_439903.1_6 Forward -326 -307 1.6703 0.241
NP_440444.1_5 Reverse -286 -305 17.3057 0.224
NP_442306.1_10 Reverse -349 -368 -12.7836 0.189
NP_441286.1_1 Reverse -313 -325 -6.05754 0.245
NP_440670.1_8 Forward -323 -314 16.5193 0.00214
NP_440670.1_8 Reverse -314 -323 9.4395 0.0559
NP_441930.1_2 Forward -381 -371 15.3197 0.19
NP_441930.1_2 Reverse -371 -381 12.1731 0.266
NP_440886.1_7 Reverse -341 -351 12.2709 0.0805
NP_440886.1_7 Reverse -313 -323 4.10949 0.253
NP_440886.1_7 Forward -97 -87 3.61784 0.272
NP_442072.1_9 Forward -400 -382 -13.5505 0.115
NP_442072.1_9 Forward -194 -176 -14.4355 0.145
NP_441753.1_10 Reverse -345 -364 3.24438 0.219
NP_440028.1_6 Forward -88 -70 10.2456 0.282
NP_440907.2_8 Forward -322 -312 6.56775 0.161
NP_440907.2_8 Reverse -315 -325 6.27276 0.175
NP_440907.2_8 Reverse -185 -195 5.19112 0.215
NP_441626.1_2 Forward -322 -315 6.0373 0.212
NP_441626.1_2 Reverse -315 -322 6.0373 0.212
NP_442794.1_1 Reverse -16 -28 4.16888 0.276
NP_442615.1_1 Reverse -305 -323 15.8504 0.00922
NP_442615.1_1 Forward -332 -314 -0.570838 0.118
NP_441962.1_9 Reverse -334 -353 14.1591 0.164
NP_440387.1_1 Forward -323 -307 3.69678 0.0533
NP_440387.1_1 Reverse -314 -330 -2.20308 0.147
NP_440855.1_2 Reverse -370 -389 15.9282 0.263
NP_441193.1_6 Reverse -56 -75 11.0125 0.105
NP_441993.1_1 Forward -70 -51 16.3704 0.0608
NP_441993.1_1 Forward -210 -191 3.01872 0.244
NP_440467.1_3 Reverse -303 -322 12.7212 0.221
NP_440114.1_10 Forward -323 -309 7.86607 0.223
NP_440114.1_10 Forward -193 -179 6.09611 0.285
NP_442324.1_7 Forward -282 -263 5.37664 0.275
NP_440293.1_3 Forward -272 -253 -1.7705 0.239
NP_440293.1_3 Reverse -81 -100 -6.58872 0.291
NP_440766.1_5 Forward -119 -107 10.807 0.268
NP_439988.1_3 Forward -347 -333 3.63784 0.298
NP_442867.1_8 Forward -95 -76 7.27595 0.244
NP_440457.1_1 Forward -197 -185 12.4287 0.092
NP_441801.1_4 Reverse -149 -159 12.0747 0.231
NP_440801.1_8 Reverse -54 -73 -0.787193 0.273
NP_442297.1_5 Reverse -330 -349 15.0441 0.0327
NP_441984.1_3 Forward -373 -355 10.2456 0.189
NP_442509.1_9 Forward -371 -361 9.51767 0.192
NP_442509.1_9 Forward -323 -313 7.94438 0.195
NP_442514.1_5 Reverse -248 -267 -9.83437 0.298
NP_441885.1_5 Forward -193 -183 5.5849 0.0681
NP_441885.1_5 Reverse -314 -324 1.84832 0.0957
NP_441885.1_5 Forward -323 -313 1.65166 0.106
NP_441885.1_5 Forward -349 -339 -1.78992 0.284
NP_442341.1_9 Forward -325 -311 8.16044 0.178
NP_442341.1_9 Forward -278 -264 5.1122 0.279
NP_441173.1_9 Reverse -229 -237 9.75379 0.284
NP_440191.1_4 Reverse -270 -280 13.2451 0.282
NP_443000.1_7 Forward -325 -315 0.963343 0.278
NP_443000.1_7 Reverse -312 -322 0.865012 0.285
NP_443000.1_8 Reverse -192 -211 12.5858 0.296
NP_440076.1_5 Reverse -371 -390 12.9783 0.252
NP_440275.1_3 Forward -325 -315 6.17489 0.122
NP_440275.1_3 Forward -195 -185 4.60159 0.182
NP_440679.1_5 Forward -320 -301 5.211 0.295
NP_439962.1_4 Reverse -346 -365 -5.9004 0.28
NP_439962.1_4 Forward -98 -79 -6.29373 0.283
NP_442495.1_4 Reverse -248 -258 14.6313 0.16
NP_442495.1_4 Forward -201 -191 11.4848 0.271
NP_441105.1_3 Forward -75 -56 -7.27704 0.25
NP_442373.1_2 Forward -213 -194 -10.817 0.291
NP_440216.1_1 Reverse -184 -198 -5.01529 0.118
NP_440216.1_1 Forward -323 -309 -11.8985 0.228
NP_440216.1_1 Reverse -314 -328 -12.5868 0.288
NP_440172.1_1 Forward -323 -313 8.04317 0.0692
NP_440172.1_1 Reverse -314 -324 7.74818 0.0738
NP_442015.1_10 Forward -269 -256 6.31247 0.119
NP_442015.1_10 Reverse -310 -323 -0.472371 0.268
NP_441226.1_7 Forward -192 -185 9.77352 0.131
NP_441111.1_7 Forward -322 -314 8.96754 0.0463
NP_441111.1_7 Reverse -315 -323 8.86921 0.0589
NP_441766.1_2 Forward -323 -314 7.86621 0.0703
NP_441766.1_2 Reverse -314 -323 7.66954 0.0723
NP_440416.1_9 Reverse -333 -352 -10.227 0.14
NP_440416.1_9 Reverse -249 -268 -19.4701 0.275
NP_443052.1_9 Reverse -343 -362 -0.787193 0.216
NP_443052.1_9 Forward -364 -345 -6.88371 0.289
NP_442116.1_6 Reverse -128 -145 5.39969 0.299
NP_442154.1_1 Reverse -79 -97 -17.4838 0.257
NP_442564.1_2 Reverse -356 -375 17.5024 0.12
NP_440261.1_5 Forward -322 -309 -10.7971 0.21
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGATGTTTGCCCCTGGTTTGGGCATTGCGGAAGATCCGGCCACTGGCTCCGGGGTAGCGGCATTGGGAGGTTATTTAGACGATCGCCTAGACACTCCAGGCTCACACCATTGGCAAATTGAACAGGGCAAAGCCTTGGGAAGGCCCAGCCAATTACAGTTAACTGTGGTAAAAGACGGTCAGGGGATTAGGGCAGTGAAAGTGGCCGGGCGATCCGTTTTAGTCTCGGAGGGCTTCATGAACCTGGGGAATTAGAAACAAATTGCAGAATTATCACCCCCTGGGGGCAGAAATTTTTCTTCTTCCCCGACCCCAAACTGCGGTGAAAATGGGATTTGACCATTGCTTGTGTACACAACGAGGAAAAATTGAGGGGATTGTGATAGGATGGTTGGTCGGAC

CDS

No sequence available

Protein

No sequence available