Your browser is old and dusty. Try Google Chrome!

Details for 6803t05

ORF 6803t05
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Forward -335 -321 10.226 0.293
NP_441061.1_2 Forward -212 -198 12.0943 0.0481
NP_441061.1_2 Reverse -91 -105 1.47456 0.188
NP_441061.1_2 Forward -164 -150 0.294584 0.213
NP_441061.1_3 Reverse -168 -187 19.6648 0.0623
NP_440557.1_1 Reverse -205 -224 0.786102 0.265
NP_440795.1_7 Forward -212 -205 14.6904 0.0123
NP_440795.1_7 Reverse -205 -212 14.6904 0.0123
NP_440795.1_7 Forward -146 -139 6.92228 0.26
NP_441418.1_6 Forward -159 -140 -20.3551 0.111
NP_441418.1_6 Reverse -204 -223 -21.0434 0.136
NP_441418.1_6 Forward -325 -306 -28.1232 0.203
NP_440815.1_5 Forward -213 -194 3.53937 0.286
NP_442291.1_5 Forward -214 -198 3.89344 0.103
NP_442291.1_5 Reverse -325 -341 -4.46469 0.276
NP_440897.1_6 Reverse -42 -61 8.55343 0.0706
NP_441453.1_4 Reverse -204 -212 16.539 0.00633
NP_441453.1_4 Forward -213 -205 16.539 0.00633
NP_441453.1_4 Reverse -326 -334 7.19758 0.0757
NP_441453.1_4 Forward -335 -327 6.80426 0.121
NP_441453.1_4 Forward -51 -43 6.80426 0.121
NP_441453.1_4 Reverse -156 -164 3.85433 0.284
NP_441453.1_8 Forward -350 -333 12.0352 0.205
NP_442151.1_6 Reverse -204 -218 17.8958 0.00866
NP_442151.1_6 Forward -213 -199 16.9125 0.013
NP_442151.1_6 Forward -165 -151 11.3077 0.104
NP_442151.1_6 Reverse -42 -56 10.3243 0.125
NP_442151.1_6 Reverse -48 -62 6.48943 0.233
NP_442151.1_6 Forward -57 -43 5.50613 0.274
NP_442151.1_6 Forward -159 -145 5.01447 0.298
NP_441818.1_1 Forward -212 -201 18.8393 0.00301
NP_441818.1_1 Reverse -43 -54 14.6111 0.0477
NP_441818.1_1 Reverse -327 -338 10.5796 0.232
NP_441818.1_1 Reverse -205 -216 9.59626 0.232
NP_441818.1_9 Reverse -225 -244 -4.13045 0.234
NP_440226.1_1 Reverse -204 -223 5.30933 0.161
NP_440226.1_1 Forward -213 -194 2.55606 0.259
NP_442169.1_1 Reverse -275 -294 8.55425 0.26
NP_441630.1_3 Reverse -196 -215 12.5858 0.0635
NP_441630.1_3 Reverse -241 -260 -0.39387 0.287
NP_442173.1_1 Forward -212 -204 15.4574 0.00633
NP_442173.1_1 Reverse -205 -213 15.4574 0.00633
NP_442173.1_1 Forward -334 -326 7.68924 0.142
NP_442173.1_1 Reverse -327 -335 5.72262 0.203
NP_442173.1_1 Reverse -43 -51 5.72262 0.203
NP_442173.1_1 Forward -50 -42 4.54265 0.27
NP_442752.1_4 Forward -335 -328 13.8055 0.0199
NP_442752.1_4 Forward -213 -206 13.8055 0.0199
NP_442752.1_4 Reverse -204 -211 13.8055 0.0199
NP_442752.1_4 Forward -51 -44 13.8055 0.0199
NP_443027.1_4 Forward -215 -205 16.2046 0.0437
NP_443027.1_4 Reverse -202 -212 14.0414 0.0452
NP_443027.1_4 Forward -53 -43 10.2065 0.138
NP_443027.1_4 Reverse -154 -164 9.32148 0.166
NP_441812.1_3 Reverse -155 -169 15.0442 0.106
NP_441812.1_3 Reverse -203 -217 12.0943 0.21
NP_441812.1_3 Forward -125 -111 11.2093 0.215
NP_442975.1_10 Forward -217 -203 21.6317 0.000774
NP_442975.1_10 Reverse -146 -160 8.55376 0.0932
NP_442975.1_10 Reverse -200 -214 4.62054 0.241
NP_442975.1_10 Reverse -114 -128 2.5556 0.273
NP_441225.1_4 Reverse -92 -111 -12.6852 0.291
NP_440784.1_7 Forward -212 -205 15.9687 0.0123
NP_440784.1_7 Reverse -205 -212 15.9687 0.0123
NP_440784.1_7 Reverse -157 -164 8.59391 0.129
NP_440784.1_7 Forward -334 -327 6.23397 0.241
NP_440784.1_7 Forward -50 -43 6.23397 0.241
NP_440784.1_7 Reverse -327 -334 6.13563 0.241
NP_440784.1_7 Reverse -43 -50 6.13563 0.241
NP_442909.1_7 Forward -286 -272 5.80051 0.269
NP_440061.1_9 Reverse -324 -338 8.84875 0.161
NP_440061.1_9 Reverse -93 -107 7.47213 0.205
NP_441054.1_4 Forward -223 -205 0.707465 0.173
NP_441476.1_5 Forward -110 -91 -3.63879 0.239
NP_442062.1_8 Forward -213 -203 17.3846 0.00193
NP_442062.1_8 Forward -335 -325 16.6963 0.00399
NP_442062.1_8 Forward -51 -41 14.533 0.0128
NP_442062.1_8 Reverse -204 -214 10.3048 0.0493
NP_442062.1_8 Reverse -326 -336 5.38824 0.172
NP_440761.1_4 Reverse -199 -218 -3.24547 0.132
NP_441859.1_3 Forward -52 -33 2.55527 0.258
NP_440304.1_4 Forward -215 -205 19.9412 0.00364
NP_440304.1_4 Reverse -202 -212 10.8948 0.051
NP_440304.1_4 Forward -337 -327 8.23984 0.0845
NP_442242.1_4 Forward -212 -205 14.3954 0.0124
NP_442242.1_4 Reverse -205 -212 14.3954 0.0124
NP_442242.1_4 Reverse -327 -334 10.8555 0.127
NP_442242.1_4 Reverse -43 -50 10.8555 0.127
NP_440044.1_8 Reverse -43 -62 2.45773 0.15
NP_440044.1_8 Reverse -205 -224 2.0644 0.158
NP_441210.1_3 Forward -66 -47 12.2908 0.276
NP_441619.1_8 Forward -196 -182 8.84875 0.237
NP_441208.1_9 Reverse -201 -215 4.81781 0.285
NP_440370.1_10 Forward -305 -286 11.5042 0.181
NP_440132.1_1 Reverse -217 -235 9.16393 0.25
NP_442110.1_7 Reverse -204 -218 20.7474 0.013
NP_442110.1_7 Forward -213 -199 9.2427 0.0755
NP_442110.1_7 Reverse -42 -56 1.17956 0.236
NP_440856.1_4 Reverse -319 -338 -4.91709 0.27
NP_440856.1_7 Forward -159 -140 -6.88371 0.246
NP_441083.1_5 Forward -213 -203 20.3345 0.00053
NP_441083.1_5 Reverse -204 -214 11.2881 0.0159
NP_441083.1_5 Reverse -42 -52 1.65166 0.2
NP_441083.1_5 Reverse -326 -336 0.766681 0.218
NP_441083.1_5 Forward -51 -41 0.0783647 0.245
NP_442827.1_8 Reverse -196 -215 6.1935 0.11
NP_442827.1_8 Reverse -34 -53 -2.8529 0.29
NP_441434.1_7 Reverse -328 -342 3.53951 0.236
NP_441738.1_2 Reverse -328 -335 15.28 0.0102
NP_441738.1_2 Forward -211 -204 15.28 0.0102
NP_441738.1_2 Reverse -206 -213 15.28 0.0102
NP_441738.1_2 Reverse -44 -51 15.28 0.0102
NP_441738.1_2 Reverse -318 -325 6.72528 0.236
NP_441558.1_5 Reverse -202 -221 12.3892 0.0679
NP_441558.1_5 Reverse -46 -65 11.8975 0.0751
NP_441558.1_5 Forward -333 -314 4.71934 0.271
NP_440209.1_1 Reverse -204 -212 18.1123 0.00295
NP_440209.1_1 Forward -213 -205 18.1123 0.00295
NP_440209.1_1 Forward -335 -327 8.57422 0.0425
NP_440209.1_1 Forward -51 -43 8.57422 0.0425
NP_440209.1_1 Reverse -326 -334 5.32929 0.139
NP_440209.1_1 Reverse -42 -50 5.23096 0.145
NP_442889.1_8 Forward -216 -202 17.4035 0.0176
NP_442889.1_8 Reverse -39 -53 6.19383 0.199
NP_440447.1_1 Forward -56 -38 7.00065 0.194
NP_440178.1_7 Forward -214 -195 -7.08038 0.0687
NP_440178.1_7 Reverse -203 -222 -14.7502 0.156
NP_442570.1_3 Reverse -208 -227 -1.47551 0.212
NP_442445.1_1 Forward -104 -85 15.6341 0.151
NP_441716.1_1 Forward -57 -43 2.94952 0.284
NP_441716.1_1 Reverse -42 -56 2.85119 0.289
NP_441327.1_1 Reverse -111 -130 5.17447 0.257
NP_442111.1_4 Reverse -203 -217 11.406 0.0509
NP_442111.1_4 Forward -336 -322 8.75105 0.0694
NP_442111.1_4 Forward -52 -38 6.58777 0.12
NP_440906.1_5 Forward -212 -205 15.8704 0.0124
NP_440906.1_5 Reverse -205 -212 15.8704 0.0124
NP_440906.1_5 Forward -334 -327 6.23397 0.234
NP_440906.1_5 Forward -50 -43 6.23397 0.234
NP_440906.1_5 Reverse -327 -334 6.13563 0.241
NP_440906.1_5 Reverse -43 -50 6.13563 0.241
NP_440747.1_10 Reverse -201 -213 7.51213 0.00286
NP_440747.1_10 Forward -216 -204 -1.92764 0.0192
NP_440747.1_10 Reverse -323 -335 -2.51763 0.0509
NP_440747.1_10 Forward -54 -42 -11.9574 0.178
NP_441130.1_10 Reverse -202 -216 6.78443 0.177
NP_441486.1_1 Reverse -201 -215 12.586 0.0112
NP_441486.1_1 Forward -216 -202 11.996 0.0136
NP_441486.1_1 Forward -54 -40 5.99778 0.0344
NP_441486.1_1 Reverse -45 -59 -5.90027 0.266
NP_442634.1_4 Reverse -202 -216 -1.96703 0.149
NP_442634.1_4 Forward -215 -201 -2.26202 0.149
NP_442634.1_4 Reverse -27 -41 -3.93365 0.176
NP_442634.1_4 Forward -337 -323 -4.03198 0.179
NP_440403.1_4 Forward -206 -187 -9.83364 0.287
NP_441014.1_10 Reverse -155 -174 -1.67294 0.263
NP_442848.1_1 Forward -57 -43 -1.47537 0.263
NP_442848.1_1 Reverse -198 -212 -2.36035 0.263
NP_442848.1_1 Forward -219 -205 -2.45868 0.263
NP_441012.1_4 Reverse -140 -153 5.52582 0.294
NP_443018.1_3 Forward -212 -205 14.8871 0.0123
NP_443018.1_3 Reverse -205 -212 14.8871 0.0123
NP_443018.1_3 Forward -334 -327 12.6255 0.0471
NP_443018.1_3 Forward -50 -43 12.6255 0.0471
NP_443018.1_3 Forward -56 -49 10.6589 0.0967
NP_443018.1_3 Reverse -323 -330 8.20058 0.153
NP_443018.1_3 Reverse -327 -334 5.25066 0.214
NP_443018.1_3 Reverse -43 -50 5.25066 0.214
NP_443018.1_3 Reverse -49 -56 4.16902 0.278
NP_441634.1_8 Reverse -94 -108 10.6193 0.0789
NP_441634.1_8 Forward -161 -147 2.35953 0.168
NP_441634.1_8 Reverse -202 -216 2.06454 0.173
NP_441634.1_9 Forward -257 -238 14.2566 0.169
NP_440376.1_1 Forward -213 -204 19.4693 0.000692
NP_440376.1_1 Reverse -204 -213 19.4693 0.000692
NP_440376.1_1 Forward -51 -42 0.0980582 0.285
NP_440376.1_1 Forward -335 -326 -0.000272808 0.285
NP_440376.1_1 Reverse -326 -335 -0.0986038 0.285
NP_440376.1_1 Reverse -42 -51 -0.196935 0.285
NP_441588.1_4 Forward -211 -201 8.63316 0.14
NP_441588.1_4 Reverse -206 -216 6.66654 0.185
NP_442730.1_8 Reverse -196 -215 3.73524 0.275
NP_442687.1_7 Forward -214 -204 9.02648 0.0994
NP_442687.1_7 Reverse -203 -213 8.92815 0.0994
NP_442687.1_7 Forward -336 -326 8.53483 0.106
NP_442191.1_4 Reverse -97 -111 13.417 0.15
NP_442485.1_3 Forward -110 -91 1.76941 0.217
NP_442485.1_3 Reverse -145 -164 -0.590531 0.253
NP_441846.1_10 Forward -324 -305 -14.6519 0.235
NP_442530.1_2 Forward -71 -61 12.3697 0.276
NP_440642.1_1 Reverse -137 -156 6.09597 0.284
NP_440642.1_10 Reverse -94 -108 1.5723 0.29
NP_440642.1_10 Reverse -80 -94 1.37564 0.293
NP_441763.1_10 Forward -224 -205 17.2065 0.0777
NP_440360.1_5 Reverse -109 -128 -6.09707 0.298
NP_442658.1_1 Forward -215 -205 13.0576 0.04
NP_442658.1_1 Forward -337 -327 7.94438 0.199
NP_442658.1_1 Reverse -202 -212 6.76441 0.214
NP_442658.1_1 Reverse -324 -334 6.56775 0.224
NP_440141.1_8 Reverse -141 -160 6.68596 0.254
NP_442782.1_2 Forward -335 -321 1.08123 0.282
NP_442782.1_2 Reverse -172 -186 0.786239 0.284
NP_442782.1_7 Forward -59 -40 2.55606 0.193
NP_442205.1_9 Reverse -198 -214 -2.69473 0.272
NP_440656.1_8 Forward -346 -327 -5.21209 0.214
NP_441414.1_9 Forward -213 -194 5.30933 0.048
NP_441414.1_9 Reverse -48 -67 2.75272 0.0631
NP_442937.1_5 Forward -318 -299 18.1907 0.0272
NP_442937.1_5 Reverse -193 -212 5.80098 0.3
NP_442321.1_1 Reverse -276 -295 -4.91709 0.216
NP_441958.1_5 Forward -214 -204 21.2195 0.000805
NP_441958.1_5 Reverse -203 -213 12.2714 0.00183
NP_441958.1_5 Forward -336 -326 9.81313 0.0174
NP_441958.1_5 Reverse -41 -51 0.865012 0.12
NP_441958.1_5 Forward -52 -42 -6.31315 0.28
NP_442836.1_5 Reverse -198 -217 5.211 0.192
NP_440203.1_5 Reverse -45 -55 14.8275 0.0886
NP_439905.1_1 Forward -295 -282 6.4108 0.288
NP_443001.1_7 Reverse -205 -224 0.884433 0.292
NP_440995.1_8 Reverse -32 -51 -0.885524 0.288
NP_440984.1_7 Reverse -199 -213 11.0127 0.122
NP_439990.1_5 Forward -218 -205 6.80412 0.221
NP_439990.1_5 Reverse -199 -212 6.60746 0.227
NP_442911.1_2 Forward -223 -204 -3.63879 0.115
NP_442911.1_2 Reverse -194 -213 -4.42544 0.134
NP_441580.1_6 Forward -224 -205 -1.37718 0.189
NP_441580.1_6 Reverse -139 -158 -5.9004 0.235
NP_440153.1_5 Reverse -205 -219 2.94952 0.219
NP_440153.1_5 Forward -212 -198 0.786239 0.289
NP_440153.1_5 Reverse -43 -57 0.392915 0.299
NP_440153.1_8 Forward -287 -274 -1.94734 0.23
NP_442064.1_1 Reverse -37 -56 -2.95047 0.146
NP_442064.1_1 Reverse -85 -104 -9.14533 0.259
NP_442064.1_1 Reverse -199 -218 -10.817 0.259
NP_442064.1_4 Reverse -86 -105 8.55343 0.232
NP_443055.1_3 Forward -174 -155 11.2181 0.266
NP_443055.1_6 Reverse -326 -344 4.44329 0.182
NP_440993.1_2 Forward -218 -202 9.10498 0.124
NP_440993.1_4 Reverse -90 -107 4.16874 0.277
NP_440993.1_4 Forward -225 -208 3.77542 0.281
NP_440827.1_3 Forward -110 -91 11.1109 0.275
NP_441099.1_5 Reverse -316 -335 -7.86702 0.181
NP_441099.1_5 Reverse -194 -213 -11.9969 0.294
NP_441099.1_5 Reverse -312 -331 -12.0953 0.294
NP_442002.1_9 Forward -336 -329 14.1004 0.074
NP_440809.1_9 Forward -222 -204 -7.749 0.225
NP_441294.1_7 Forward -217 -203 14.242 0.0448
NP_441646.1_1 Reverse -89 -108 3.04771 0.21
NP_442438.1_10 Reverse -199 -213 7.76774 0.088
NP_442438.1_10 Forward -218 -204 7.17775 0.0987
NP_441000.1_6 Forward -336 -322 -3.24533 0.221
NP_440147.1_4 Reverse -324 -337 7.78743 0.0619
NP_440147.1_4 Forward -215 -202 3.65753 0.183
NP_440147.1_4 Reverse -202 -215 1.49425 0.226
NP_441550.1_8 Forward -215 -205 13.0576 0.0273
NP_441550.1_8 Reverse -202 -212 12.3692 0.0336
NP_441550.1_8 Forward -337 -327 10.5993 0.066
NP_441550.1_8 Reverse -40 -50 5.19112 0.26
NP_441916.1_7 Reverse -204 -214 18.9579 0.00144
NP_441916.1_7 Reverse -326 -336 14.3364 0.0144
NP_441916.1_7 Forward -213 -203 10.3048 0.0261
NP_441916.1_7 Forward -335 -325 6.66654 0.0875
NP_441916.1_10 Forward -107 -88 14.6508 0.105
NP_441916.1_10 Forward -221 -202 3.83436 0.225
NP_440206.1_4 Forward -301 -282 3.24359 0.282
NP_441041.1_4 Reverse -204 -223 8.35759 0.0331
NP_441041.1_4 Forward -331 -312 -8.55534 0.204
NP_441041.1_4 Forward -335 -316 -10.0303 0.227
NP_441041.1_4 Forward -111 -92 -12.0953 0.258
NP_441041.1_4 Forward -213 -194 -13.5702 0.291
NP_441041.1_4 Forward -105 -86 -13.8652 0.297
NP_441041.1_7 Forward -216 -204 9.65268 0.108
NP_441041.1_7 Forward -338 -326 8.97244 0.125
NP_440016.1_9 Reverse -320 -339 9.43923 0.278
NP_442396.1_5 Reverse -200 -213 9.16406 0.13
NP_440569.1_7 Forward -213 -194 13.3725 0.219
NP_441547.1_2 Forward -62 -44 9.45892 0.197
NP_442004.1_6 Reverse -42 -56 1.57289 0.285
NP_440703.1_9 Forward -99 -86 6.11523 0.288
NP_441725.1_4 Reverse -321 -335 4.52221 0.278
NP_441725.1_4 Forward -229 -215 2.8506 0.279
NP_441725.1_5 Forward -212 -202 11.2881 0.0247
NP_441725.1_5 Reverse -205 -215 11.1898 0.0247
NP_441725.1_5 Reverse -327 -337 8.92815 0.0553
NP_441725.1_5 Reverse -43 -53 1.455 0.135
NP_441725.1_5 Forward -50 -40 0.766681 0.149
NP_439966.1_7 Reverse -202 -212 15.8108 0.0124
NP_439966.1_7 Forward -215 -205 14.8275 0.0177
NP_439966.1_7 Reverse -324 -334 7.45273 0.15
NP_439966.1_7 Forward -53 -43 6.0761 0.195
NP_439966.1_9 Forward -337 -328 0.983037 0.253
NP_442941.1_3 Forward -212 -202 19.9412 0.00262
NP_442941.1_3 Reverse -205 -215 19.9412 0.00262
NP_442941.1_3 Reverse -43 -53 10.1081 0.024
NP_442941.1_3 Forward -164 -154 0.668351 0.19
NP_440289.1_2 Forward -216 -203 13.3923 0.0132
NP_440289.1_2 Reverse -201 -214 6.50913 0.0591
NP_440289.1_2 Forward -338 -325 -4.79893 0.294
NP_440289.1_2 Reverse -323 -336 -4.79893 0.294
NP_442281.1_1 Forward -218 -204 16.8135 0.00698
NP_442281.1_1 Reverse -199 -213 16.2235 0.0087
NP_442281.1_1 Forward -301 -287 11.9953 0.0418
NP_442281.1_1 Forward -340 -326 11.307 0.0487
NP_442281.1_1 Forward -292 -278 5.60385 0.152
NP_442281.1_1 Reverse -321 -335 2.45727 0.266
NP_442281.1_1 Forward -56 -42 2.16228 0.276
NP_442847.1_3 Reverse -91 -110 10.3234 0.217
NP_442575.1_8 Forward -111 -92 9.53756 0.124
NP_442256.1_2 Reverse -40 -58 -8.33898 0.221
NP_442256.1_2 Reverse -202 -220 -8.43732 0.224
NP_440437.1_1 Forward -219 -200 12.7825 0.0348
NP_440437.1_1 Reverse -320 -339 11.0125 0.0427
NP_440437.1_1 Reverse -144 -163 -5.21209 0.276
NP_442500.1_2 Forward -337 -318 7.47261 0.283
NP_442012.1_1 Reverse -90 -109 -0.295539 0.255
NP_442982.1_5 Forward -268 -249 5.80098 0.156
NP_442982.1_5 Forward -223 -204 -2.95047 0.289
NP_441196.1_8 Reverse -91 -110 6.4893 0.23
NP_441644.1_6 Reverse -204 -214 19.0557 0.000803
NP_441644.1_6 Forward -213 -203 17.3841 0.00127
NP_441644.1_6 Reverse -156 -166 11.5826 0.0463
NP_441644.1_6 Reverse -326 -336 4.40448 0.239
NP_441644.1_6 Forward -51 -41 3.61784 0.272
NP_443049.1_6 Forward -52 -42 13.8856 0.139
NP_443049.1_6 Forward -336 -326 12.4217 0.24
NP_441071.1_2 Reverse -57 -76 14.6576 0.279
NP_441071.1_2 Forward -69 -50 14.4666 0.279
NP_441071.1_2 Forward -67 -48 12.7478 0.291
NP_442215.1_2 Reverse -202 -218 7.92501 0.0666
NP_442215.1_2 Forward -215 -199 3.50012 0.0955
NP_442215.1_2 Reverse -88 -104 -3.67804 0.22
NP_442215.1_2 Reverse -331 -347 -3.97304 0.225
NP_442215.1_2 Reverse -40 -56 -6.13632 0.264
NP_442029.1_6 Reverse -91 -110 10.8159 0.17
NP_440253.1_2 Reverse -204 -222 -0.177514 0.204
NP_440929.1_8 Forward -213 -204 19.2726 0.000701
NP_440929.1_8 Reverse -204 -213 19.2726 0.000701
NP_440929.1_8 Reverse -42 -51 7.76787 0.0533
NP_440929.1_8 Forward -51 -42 7.66954 0.0624
NP_442933.1_1 Reverse -64 -83 8.35512 0.253
NP_442933.1_10 Forward -213 -204 17.601 0.00325
NP_442933.1_10 Reverse -204 -213 17.601 0.00325
NP_442933.1_10 Reverse -326 -335 15.1427 0.00958
NP_442933.1_10 Forward -335 -326 7.96454 0.0937
NP_442933.1_10 Reverse -42 -51 6.48957 0.119
NP_442648.1_1 Reverse -50 -69 8.75091 0.248
NP_440430.1_5 Reverse -222 -241 11.6025 0.248
NP_441751.2_8 Forward -212 -198 13.8643 0.0134
NP_441751.2_8 Reverse -327 -341 10.9143 0.0264
NP_441751.2_8 Reverse -205 -219 -3.04867 0.134
NP_441751.2_8 Reverse -91 -105 -3.44199 0.145
NP_441751.2_8 Forward -164 -150 -5.50694 0.214
NP_440096.1_5 Reverse -217 -236 10.4225 0.259
NP_442554.1_8 Reverse -205 -215 16.9913 0.0065
NP_442554.1_8 Forward -212 -202 15.9097 0.00747
NP_442554.1_8 Reverse -49 -59 8.53483 0.074
NP_442554.1_8 Reverse -327 -337 7.15819 0.0975
NP_442554.1_8 Reverse -43 -53 6.07655 0.126
NP_442554.1_8 Forward -164 -154 5.28991 0.153
NP_442554.1_8 Reverse -97 -107 4.0116 0.2
NP_442554.1_8 Reverse -157 -167 2.83163 0.253
NP_441762.1_7 Reverse -325 -337 3.67722 0.0676
NP_441762.1_7 Forward -336 -324 -5.66422 0.228
NP_441762.1_7 Forward -214 -202 -6.74586 0.284
NP_441762.1_7 Reverse -203 -215 -6.94252 0.284
NP_442313.1_4 Reverse -91 -110 5.70265 0.288
NP_442313.1_5 Reverse -172 -191 3.83436 0.284
NP_442142.1_4 Reverse -201 -214 14.7683 0.0302
NP_442142.1_4 Forward -216 -203 13.5883 0.0348
NP_442142.1_4 Forward -338 -325 8.86849 0.106
NP_442142.1_4 Forward -184 -171 5.52525 0.188
NP_442292.1_1 Forward -212 -203 18.486 0.00229
NP_442292.1_1 Reverse -205 -214 17.5026 0.00435
NP_442292.1_1 Reverse -43 -52 8.65285 0.0335
NP_442292.1_1 Reverse -49 -58 5.21127 0.152
NP_442292.1_1 Reverse -157 -166 4.22796 0.181
NP_442292.1_1 Reverse -327 -336 -0.295266 0.24
NP_442292.1_1 Forward -164 -155 -0.68859 0.268
NP_442292.1_1 Forward -50 -41 -0.786921 0.287
NP_442292.1_5 Reverse -200 -219 -0.197208 0.257
NP_442143.1_8 Reverse -142 -161 10.52 0.235
NP_442476.1_4 Forward -154 -135 18.879 0.207
NP_441711.1_4 Forward -222 -203 6.68596 0.147
NP_443009.1_5 Reverse -203 -214 14.5128 0.02
NP_443009.1_5 Forward -214 -203 10.1862 0.0792
NP_443009.1_5 Forward -336 -325 9.79292 0.0884
NP_443009.1_5 Forward -52 -41 4.97473 0.222
NP_442741.1_7 Forward -159 -140 13.8641 0.196
NP_441715.1_4 Forward -212 -202 14.828 0.0268
NP_441715.1_4 Reverse -205 -215 14.238 0.0295
NP_441715.1_4 Forward -334 -324 7.84651 0.107
NP_441715.1_4 Reverse -43 -53 4.99491 0.24
NP_440015.1_9 Forward -213 -195 -0.374176 0.26
NP_440730.1_3 Forward -254 -235 7.96426 0.23
NP_441198.1_8 Forward -215 -205 13.2713 0.108
NP_441468.1_1 Forward -212 -205 15.8704 0.0124
NP_441468.1_1 Reverse -205 -212 15.8704 0.0124
NP_441468.1_1 Reverse -279 -286 6.72562 0.126
NP_441468.1_1 Forward -334 -327 6.13563 0.209
NP_441468.1_1 Forward -50 -43 6.13563 0.209
NP_441468.1_1 Reverse -327 -334 6.0373 0.223
NP_441468.1_1 Reverse -43 -50 6.0373 0.223
NP_441468.1_1 Forward -164 -157 4.26735 0.246
NP_441468.1_1 Forward -56 -49 3.97235 0.277
NP_441020.2_6 Reverse -276 -293 10.3636 0.146
NP_441020.2_6 Forward -327 -310 6.82368 0.251
NP_441015.1_10 Forward -318 -299 -3.14714 0.185
NP_441015.1_10 Reverse -91 -110 -4.81876 0.212
NP_441015.1_10 Forward -164 -145 -9.73531 0.282
NP_441015.1_10 Forward -324 -305 -10.3253 0.284
NP_441673.1_1 Forward -213 -204 20.8459 0.000698
NP_441673.1_1 Reverse -204 -213 20.8459 0.000698
NP_441673.1_1 Forward -51 -42 1.37636 0.114
NP_441673.1_1 Forward -335 -326 1.27803 0.155
NP_441673.1_1 Reverse -326 -335 1.27803 0.155
NP_441673.1_1 Reverse -42 -51 1.1797 0.163
NP_441096.1_5 Reverse -321 -339 15.653 0.297
NP_442253.1_5 Forward -108 -91 8.88863 0.128
NP_440265.1_4 Reverse -248 -267 16.078 0.297
NP_441826.1_2 Reverse -198 -212 15.6342 0.0196
NP_441826.1_2 Forward -219 -205 6.88276 0.0899
NP_441826.1_2 Forward -57 -43 4.22782 0.104
NP_441826.1_2 Forward -341 -327 2.2612 0.132
NP_441826.1_2 Forward -111 -97 0.982901 0.167
NP_442868.1_6 Reverse -202 -212 9.91146 0.038
NP_442868.1_6 Forward -337 -327 7.05986 0.0898
NP_442868.1_6 Forward -215 -205 1.06167 0.205
NP_442868.1_6 Forward -53 -43 0.176696 0.247
NP_442719.1_2 Reverse -115 -133 -9.81463 0.267
NP_441056.1_1 Reverse -90 -109 -5.31042 0.257
NP_441056.1_1 Forward -165 -146 -6.39206 0.27
NP_441056.1_1 Reverse -287 -306 -7.96535 0.282
NP_441056.1_1 Forward -213 -194 -8.85033 0.285
NP_441612.1_2 Forward -213 -203 8.54929 0.21
NP_442227.1_2 Reverse -328 -347 -2.65548 0.278
NP_442361.1_3 Forward -219 -206 9.85238 0.272
NP_442427.1_8 Forward -222 -203 8.75091 0.194
NP_442808.1_1 Forward -214 -204 8.73102 0.0481
NP_442808.1_1 Reverse -325 -335 8.63269 0.0481
NP_442808.1_1 Reverse -203 -213 8.63269 0.0481
NP_440145.1_3 Reverse -316 -335 3.93269 0.0945
NP_442542.1_2 Reverse -148 -161 7.6891 0.173
NP_442542.1_9 Reverse -280 -294 5.40719 0.264
NP_442542.1_10 Forward -295 -281 17.9942 0.219
NP_442050.1_5 Forward -215 -205 18.0724 0.00365
NP_442050.1_5 Reverse -202 -212 16.4991 0.00812
NP_442050.1_5 Forward -53 -43 6.76441 0.282
NP_440630.1_1 Reverse -208 -227 5.01433 0.263
NP_440558.1_2 Forward -108 -89 3.93269 0.153
NP_440558.1_2 Forward -190 -171 -3.3438 0.234
NP_440558.1_2 Reverse -87 -106 -3.93378 0.239
NP_440558.1_2 Forward -306 -287 -5.40875 0.258
NP_441498.1_3 Forward -67 -49 10.8348 0.214
NP_442789.1_4 Forward -176 -157 -5.31042 0.269
NP_440923.1_10 Forward -290 -271 11.7008 0.298
NP_441878.1_6 Forward -214 -204 10.5014 0.0176
NP_441878.1_6 Reverse -203 -213 10.4031 0.0176
NP_441878.1_6 Forward -336 -326 0.668351 0.139
NP_441878.1_6 Reverse -41 -51 0.57002 0.14
NP_441878.1_6 Reverse -149 -159 -7.68978 0.255
NP_441036.1_8 Forward -214 -204 15.713 0.00724
NP_441036.1_8 Reverse -203 -213 8.33817 0.174
NP_441036.1_8 Reverse -325 -335 8.1415 0.176
NP_442650.1_2 Forward -105 -91 6.29277 0.134
NP_441557.1_5 Forward -213 -204 19.9609 0.000699
NP_441557.1_5 Reverse -204 -213 19.9609 0.000699
NP_441557.1_5 Forward -335 -326 8.94785 0.0289
NP_441557.1_5 Reverse -42 -51 7.57121 0.049
NP_441557.1_5 Forward -51 -42 1.08137 0.0794
NP_441557.1_5 Reverse -326 -335 0.688044 0.128
NP_441557.1_8 Forward -286 -276 10.501 0.286
NP_441445.1_1 Forward -322 -303 3.44104 0.213
NP_441445.1_1 Reverse -295 -314 -0.197208 0.286
NP_442066.2_4 Reverse -204 -223 -8.06369 0.293
NP_442066.2_4 Forward -335 -316 -8.94866 0.296
NP_442066.2_9 Reverse -200 -213 9.06573 0.181
NP_441308.1_8 Forward -215 -205 13.353 0.218
NP_441308.1_8 Forward -167 -157 10.3048 0.22
NP_440101.1_3 Reverse -282 -301 8.45592 0.161
NP_441458.1_10 Reverse -87 -106 6.19431 0.202
NP_441564.1_2 Forward -336 -317 9.43923 0.0814
NP_442183.1_1 Reverse -204 -218 11.111 0.0757
NP_442183.1_1 Forward -213 -199 10.6193 0.0821
NP_442183.1_1 Reverse -326 -340 6.3911 0.176
NP_442166.1_7 Forward -334 -320 9.04604 0.208
NP_440595.1_8 Forward -213 -194 8.75091 0.282
NP_441549.1_9 Reverse -200 -218 2.77242 0.0941
NP_442170.1_5 Reverse -204 -223 -0.197208 0.233
NP_442347.1_2 Forward -212 -203 12.4878 0.056
NP_442347.1_2 Reverse -43 -52 12.2911 0.056
NP_442347.1_2 Forward -164 -155 5.01461 0.244
NP_442347.1_2 Reverse -205 -214 3.34298 0.284
NP_442347.1_2 Reverse -327 -336 3.14632 0.286
NP_441037.1_4 Forward -337 -327 9.85159 0.21
NP_441037.1_4 Forward -215 -205 7.31769 0.237
NP_441037.1_4 Reverse -40 -50 6.53804 0.255
NP_442594.1_8 Forward -343 -324 2.45773 0.295
NP_442317.1_6 Reverse -321 -340 11.5042 0.184
NP_441633.1_3 Reverse -324 -337 7.6891 0.0441
NP_441633.1_3 Reverse -202 -215 -6.17557 0.238
NP_440136.1_2 Forward -212 -205 15.9687 0.0123
NP_440136.1_2 Reverse -205 -212 15.9687 0.0123
NP_440136.1_2 Forward -334 -327 6.23397 0.171
NP_440136.1_2 Forward -50 -43 6.23397 0.171
NP_440136.1_2 Reverse -327 -334 6.13563 0.193
NP_440136.1_2 Reverse -43 -50 6.13563 0.193
NP_442590.1_10 Reverse -198 -217 11.0125 0.172
NP_441728.2_5 Reverse -82 -101 16.5191 0.143
NP_442998.1_5 Forward -253 -243 8.63316 0.261
NP_442998.1_5 Forward -71 -61 7.64985 0.287
NP_442998.1_10 Reverse -328 -335 15.5754 0.0102
NP_442998.1_10 Forward -211 -204 15.5754 0.0102
NP_442998.1_10 Reverse -206 -213 15.5754 0.0102
NP_442998.1_10 Reverse -44 -51 15.5754 0.0102
NP_442998.1_10 Reverse -306 -313 3.97235 0.297
NP_440299.1_1 Forward -55 -42 7.59019 0.109
NP_440299.1_1 Reverse -322 -335 5.0336 0.191
NP_440299.1_1 Forward -217 -204 4.93527 0.193
NP_440299.1_1 Reverse -200 -213 4.34528 0.209
NP_441799.1_1 Reverse -200 -214 13.2736 0.0337
NP_441799.1_1 Reverse -152 -166 7.27547 0.147
NP_441799.1_1 Forward -163 -149 4.91554 0.232
NP_441799.1_1 Forward -217 -203 4.62054 0.242
NP_441007.1_10 Reverse -199 -212 10.2457 0.0723
NP_441007.1_10 Forward -218 -205 2.67422 0.183
NP_441007.1_10 Forward -340 -327 1.10092 0.209
NP_441007.1_10 Forward -170 -157 0.215946 0.241
NP_442334.1_2 Forward -345 -328 5.74204 0.128
NP_440256.1_1 Reverse -201 -220 14.6508 0.00807
NP_440256.1_1 Forward -216 -197 -0.983855 0.0988
NP_441559.1_8 Reverse -321 -335 2.16287 0.147
NP_441559.1_8 Forward -218 -204 -7.57189 0.295
NP_440915.1_6 Reverse -322 -336 8.55439 0.0533
NP_440915.1_6 Forward -217 -203 4.52282 0.0953
NP_440915.1_6 Reverse -200 -214 3.93283 0.1
NP_440915.1_6 Forward -347 -333 -3.04867 0.29
NP_440717.1_1 Forward -212 -193 7.37428 0.265
NP_441704.1_8 Forward -62 -43 16.6165 0.0783
NP_440134.1_2 Forward -53 -34 -0.39387 0.298
NP_440749.1_1 Reverse -204 -223 2.65439 0.252
NP_442452.1_3 Forward -143 -124 11.0125 0.163
NP_442452.1_8 Forward -57 -43 15.3386 0.273
NP_442866.1_1 Reverse -282 -301 2.75272 0.155
NP_442866.1_1 Reverse -199 -218 -6.68705 0.259
NP_441464.1_8 Forward -51 -37 5.1128 0.26
NP_441464.1_8 Forward -286 -272 5.01447 0.26
NP_442993.1_1 Forward -213 -197 0.648521 0.0625
NP_442993.1_1 Reverse -204 -220 -9.18458 0.179
NP_442993.1_1 Forward -124 -108 -13.4128 0.291
NP_442386.1_9 Reverse -203 -212 13.8639 0.0289
NP_442386.1_9 Forward -106 -97 10.619 0.121
NP_442386.1_9 Reverse -325 -334 6.9808 0.219
NP_442386.1_9 Forward -58 -49 6.68581 0.219
NP_442386.1_9 Forward -308 -299 6.39082 0.219
NP_442386.1_9 Forward -214 -205 6.39082 0.219
NP_442386.1_9 Reverse -95 -104 6.29249 0.226
NP_442386.1_9 Forward -100 -91 5.9975 0.23
NP_442386.1_9 Reverse -47 -56 4.62087 0.294
NP_441340.1_5 Forward -212 -205 15.6737 0.0124
NP_441340.1_5 Reverse -205 -212 15.6737 0.0124
NP_441340.1_5 Reverse -49 -56 11.3472 0.0526
NP_441340.1_5 Forward -334 -327 6.23397 0.132
NP_441340.1_5 Forward -50 -43 6.23397 0.132
NP_441340.1_5 Reverse -327 -334 5.84064 0.208
NP_441340.1_5 Reverse -43 -50 5.84064 0.208
NP_441340.1_9 Forward -72 -62 8.25522 0.256
NP_442484.1_2 Reverse -145 -164 3.04771 0.214
NP_440194.1_3 Forward -175 -156 2.75272 0.271
NP_442240.1_2 Forward -334 -315 -10.6203 0.137
NP_442714.1_5 Forward -98 -79 6.39097 0.238
NP_440211.1_1 Forward -297 -278 15.9282 0.155
NP_440211.1_7 Reverse -293 -311 8.27895 0.239
NP_440586.1_1 Forward -329 -310 -3.63879 0.272
NP_440586.1_8 Forward -334 -327 14.69 0.026
NP_440586.1_8 Forward -50 -43 14.69 0.026
NP_440586.1_8 Forward -212 -205 13.2151 0.026
NP_440586.1_8 Reverse -205 -212 13.2151 0.026
NP_440586.1_8 Reverse -157 -164 9.28187 0.164
NP_440586.1_8 Reverse -323 -330 9.08521 0.178
NP_440586.1_8 Forward -56 -49 5.74197 0.283
NP_442251.1_6 Forward -212 -205 15.2804 0.0124
NP_442251.1_6 Reverse -205 -212 15.2804 0.0124
NP_442251.1_6 Reverse -327 -334 12.0355 0.0627
NP_442251.1_6 Reverse -43 -50 12.0355 0.0627
NP_440684.1_9 Reverse -150 -164 11.6026 0.173
NP_440684.1_9 Reverse -198 -212 10.1277 0.209
NP_441262.1_3 Reverse -204 -211 14.7888 0.0223
NP_441262.1_3 Forward -335 -328 14.7888 0.0223
NP_441262.1_3 Forward -213 -206 14.7888 0.0223
NP_441262.1_3 Forward -51 -44 14.7888 0.0223
NP_440027.1_3 Forward -297 -279 1.78836 0.295
NP_440027.1_8 Reverse -201 -220 11.405 0.227
NP_443051.1_1 Forward -214 -205 19.5676 0.00335
NP_443051.1_1 Reverse -203 -212 10.4228 0.00754
NP_443051.1_1 Forward -336 -327 8.55452 0.031
NP_443051.1_1 Reverse -41 -50 6.19458 0.0849
NP_443051.1_1 Forward -52 -43 0.884706 0.125
NP_439937.1_9 Reverse -41 -58 -15.4981 0.287
NP_440398.1_6 Reverse -315 -334 3.14605 0.294
NP_441740.2_10 Reverse -90 -109 15.1424 0.111
NP_440408.1_7 Forward -213 -194 13.2741 0.19
NP_440408.1_7 Forward -105 -86 8.94757 0.265
NP_440439.1_1 Forward -216 -203 1.88757 0.139
NP_440439.1_1 Reverse -323 -336 0.117615 0.202
NP_440439.1_1 Reverse -201 -214 -0.177378 0.209
NP_439943.1_1 Reverse -334 -353 -6.78538 0.237
NP_439943.1_4 Reverse -165 -184 8.25926 0.256
NP_440372.1_2 Forward -212 -205 16.3621 0.0124
NP_440372.1_2 Reverse -205 -212 16.3621 0.0124
NP_440372.1_2 Forward -334 -327 6.82395 0.0854
NP_440372.1_2 Forward -50 -43 6.82395 0.0854
NP_440372.1_2 Reverse -327 -334 6.52896 0.188
NP_440372.1_2 Reverse -43 -50 6.52896 0.188
NP_440574.1_3 Reverse -199 -218 2.0644 0.173
NP_441789.1_7 Reverse -317 -336 -3.04956 0.268
NP_440819.1_5 Reverse -54 -62 7.68924 0.266
NP_441803.1_2 Forward -164 -145 14.5524 0.0425
NP_441803.1_2 Reverse -199 -218 0.196116 0.258
NP_439977.1_5 Reverse -320 -339 3.73603 0.158
NP_439977.1_5 Reverse -90 -109 -2.85214 0.29
NP_440139.1_1 Forward -337 -318 2.6536 0.225
NP_440139.1_1 Forward -219 -200 2.16195 0.237
NP_441572.1_7 Forward -219 -200 2.26107 0.135
NP_441572.1_7 Reverse -144 -163 -4.72043 0.243
NP_441572.1_7 Reverse -198 -217 -6.58872 0.296
NP_440267.1_2 Forward -218 -204 8.75042 0.162
NP_442384.1_10 Forward -213 -200 8.18076 0.0685
NP_442384.1_10 Reverse -204 -217 8.08242 0.0692
NP_442384.1_10 Reverse -150 -163 5.42749 0.13
NP_442384.1_10 Forward -165 -152 5.03416 0.139
NP_442384.1_10 Reverse -42 -55 0.510939 0.289
NP_442114.1_8 Forward -379 -365 4.12889 0.271
NP_441018.1_7 Reverse -86 -105 16.1257 0.0925
NP_441018.1_7 Reverse -168 -187 15.4374 0.108
NP_441018.1_7 Reverse -283 -302 6.39097 0.289
NP_442790.1_4 Reverse -195 -214 -11.0136 0.22
NP_442262.1_10 Forward -212 -205 14.1988 0.0123
NP_442262.1_10 Reverse -205 -212 14.1988 0.0123
NP_442262.1_10 Forward -334 -327 12.9205 0.0422
NP_442262.1_10 Forward -50 -43 12.9205 0.0422
NP_442262.1_10 Forward -56 -49 12.0355 0.062
NP_442262.1_10 Reverse -323 -330 9.38056 0.202
NP_441689.1_5 Forward -215 -205 17.8758 0.0158
NP_441689.1_5 Reverse -202 -212 15.3192 0.0403
NP_441689.1_5 Forward -53 -43 5.78111 0.197
NP_440163.1_10 Reverse -201 -211 11.3864 0.169
NP_440344.1_10 Forward -220 -203 4.3654 0.0249
NP_440344.1_10 Reverse -143 -160 -11.0726 0.2
NP_440282.1_10 Reverse -194 -213 -5.40875 0.25
NP_440282.1_10 Reverse -105 -124 -7.67036 0.253
NP_440531.1_6 Reverse -196 -215 -0.4922 0.214
NP_440562.1_3 Reverse -327 -344 6.72535 0.15
NP_441965.1_10 Reverse -275 -291 14.6115 0.0774
NP_441965.1_10 Forward -216 -200 7.92501 0.137
NP_441965.1_10 Forward -338 -322 3.50012 0.263
NP_441965.1_10 Reverse -147 -163 2.8118 0.282
NP_441640.1_8 Forward -56 -37 7.96426 0.103
NP_442065.1_2 Forward -291 -278 18.7015 0.188
NP_440297.1_9 Forward -212 -202 9.32148 0.0917
NP_440297.1_9 Reverse -205 -215 9.22315 0.0917
NP_440297.1_9 Forward -50 -40 0.176696 0.282
NP_440297.1_9 Reverse -157 -167 0.0783647 0.282
NP_440297.1_9 Reverse -327 -337 -0.314959 0.282
NP_440297.1_9 Reverse -43 -53 -0.511621 0.289
NP_440297.1_9 Forward -164 -154 -0.806614 0.297
NP_442280.1_10 Reverse -86 -104 15.3893 0.113
NP_440894.1_10 Reverse -199 -218 5.11266 0.238
NP_440894.1_10 Reverse -37 -56 3.53937 0.271
NP_440999.1_9 Reverse -322 -336 8.16106 0.0788
NP_440999.1_9 Reverse -146 -160 6.09611 0.102
NP_440999.1_9 Forward -217 -203 4.42448 0.116
NP_440999.1_9 Reverse -200 -214 -1.27871 0.232
NP_440999.1_9 Reverse -105 -119 -2.55701 0.27
NP_440888.1_2 Reverse -204 -218 18.8785 0.00178
NP_440888.1_2 Forward -213 -199 17.1085 0.00462
NP_440888.1_2 Forward -287 -273 8.45543 0.16
NP_440888.1_2 Reverse -334 -348 8.25877 0.167
NP_440600.1_4 Reverse -196 -214 -3.02911 0.216
NP_440491.1_1 Reverse -201 -220 10.6204 0.184
NP_439969.1_3 Reverse -321 -340 1.67108 0.256
NP_441748.1_9 Reverse -80 -99 9.04509 0.185
NP_442033.1_10 Forward -337 -318 -10.227 0.23
NP_440575.1_8 Forward -67 -48 2.45773 0.166
NP_441543.1_2 Forward -212 -203 16.9127 0.00359
NP_441543.1_2 Reverse -205 -214 15.9293 0.00518
NP_441543.1_2 Forward -334 -325 13.5694 0.0248
NP_441543.1_2 Forward -158 -149 10.1278 0.0788
NP_441543.1_2 Reverse -43 -52 7.07956 0.131
NP_442845.1_2 Reverse -198 -212 17.2075 0.0608
NP_442845.1_2 Forward -219 -205 12.3893 0.112
NP_442845.1_2 Reverse -42 -56 11.3077 0.131
NP_442845.1_2 Reverse -150 -164 9.34103 0.177
NP_442845.1_2 Forward -57 -43 6.3911 0.21
NP_442845.1_2 Forward -313 -299 5.80112 0.224
NP_441551.1_5 Reverse -200 -216 5.85938 0.293
NP_441178.1_5 Reverse -192 -211 11.2092 0.231
NP_441469.1_3 Reverse -282 -301 24.8222 0.0142
NP_441469.1_8 Forward -214 -205 6.5879 0.227
NP_441469.1_8 Reverse -203 -212 6.48957 0.227
NP_441548.1_2 Reverse -342 -361 17.109 0.192
NP_442315.1_1 Reverse -276 -294 7.59063 0.244
NP_442637.1_3 Reverse -21 -40 5.11266 0.202
NP_443064.1_6 Forward -213 -203 12.5669 0.0796
NP_443064.1_6 Reverse -204 -214 10.8217 0.13
NP_443064.1_6 Reverse -326 -336 10.143 0.173
NP_442578.1_7 Forward -334 -327 14.6904 0.026
NP_442578.1_7 Forward -50 -43 14.6904 0.026
NP_442578.1_7 Forward -212 -205 14.5921 0.026
NP_442578.1_7 Reverse -205 -212 14.5921 0.026
NP_442286.1_1 Reverse -66 -85 7.17762 0.285
NP_441462.1_2 Reverse -204 -214 20.2362 0.000805
NP_441462.1_2 Forward -213 -203 11.5831 0.00406
NP_441462.1_2 Forward -51 -41 1.94665 0.0807
NP_441462.1_2 Forward -335 -325 1.25834 0.0964
NP_441462.1_2 Reverse -326 -336 0.57002 0.144
NP_441621.1_7 Forward -337 -323 -3.24533 0.188
NP_441621.1_7 Reverse -136 -150 -4.13031 0.208
NP_443062.1_1 Forward -213 -195 16.834 0.0287
NP_443062.1_1 Reverse -204 -222 9.42349 0.134
NP_442204.1_1 Forward -217 -206 9.89177 0.0736
NP_442204.1_1 Forward -55 -44 7.92515 0.108
NP_442204.1_1 Reverse -322 -333 -0.236322 0.289
NP_442204.1_5 Reverse -194 -213 2.3594 0.213
NP_442204.1_5 Forward -115 -96 2.3594 0.213
NP_442204.1_5 Forward -61 -42 0.196116 0.27
NP_440516.1_2 Reverse -36 -54 -0.0791831 0.243
NP_440516.1_8 Forward -213 -204 16.9127 0.00442
NP_440516.1_8 Reverse -204 -213 16.9127 0.00442
NP_440516.1_8 Forward -51 -42 1.08137 0.129
NP_440516.1_8 Forward -335 -326 0.983037 0.13
NP_440516.1_8 Forward -313 -304 -0.196935 0.185
NP_442428.1_5 Forward -212 -205 15.8704 0.0124
NP_442428.1_5 Reverse -205 -212 15.8704 0.0124
NP_442428.1_5 Forward -164 -157 11.4455 0.062
NP_442428.1_5 Forward -334 -327 6.13563 0.209
NP_442428.1_5 Forward -50 -43 6.13563 0.209
NP_442428.1_5 Reverse -327 -334 6.0373 0.212
NP_442428.1_5 Reverse -43 -50 6.0373 0.212
NP_442428.1_5 Forward -56 -49 4.36568 0.271
NP_442120.1_10 Reverse -340 -359 -16.3235 0.3
NP_441835.1_3 Forward -335 -321 20.3541 0.031
NP_441867.1_2 Forward -87 -68 -14.0619 0.277
NP_440603.1_9 Reverse -91 -110 12.9791 0.197
NP_440673.1_3 Forward -211 -204 12.4288 0.0426
NP_440673.1_3 Reverse -328 -335 12.4288 0.0426
NP_440673.1_3 Reverse -206 -213 12.4288 0.0426
NP_440673.1_3 Reverse -44 -51 12.4288 0.0426
NP_440673.1_7 Reverse -193 -212 11.6025 0.111
NP_440865.1_9 Forward -341 -322 12.7825 0.0497
NP_441052.1_2 Forward -213 -203 19.9412 0.00106
NP_441052.1_2 Reverse -150 -160 11.2881 0.0285
NP_441052.1_2 Reverse -204 -214 10.4031 0.0285
NP_441052.1_2 Forward -165 -155 5.97822 0.0968
NP_441052.1_2 Reverse -42 -52 1.55333 0.238
NP_440992.1_8 Forward -255 -236 21.9273 0.0256
NP_442219.1_9 Forward -212 -203 17.7976 0.00718
NP_442219.1_9 Reverse -205 -214 8.25953 0.0681
NP_442219.1_9 Reverse -43 -52 7.96454 0.0696
NP_442219.1_9 Forward -164 -155 4.81794 0.196
NP_440436.1_4 Forward -212 -203 17.2072 0.00233
NP_440436.1_4 Reverse -205 -214 9.24241 0.0871
NP_440436.1_4 Reverse -43 -52 7.57079 0.124
NP_440436.1_4 Forward -334 -325 7.37413 0.132
NP_440436.1_4 Reverse -327 -336 6.29249 0.164
NP_441884.1_8 Forward -336 -317 -12.8819 0.274
NP_441884.1_9 Forward -216 -197 -24.19 0.284
NP_442864.1_2 Forward -186 -167 11.1109 0.255
NP_440314.1_9 Reverse -327 -346 -0.0988766 0.104
NP_440648.1_1 Reverse -204 -223 3.34271 0.252
NP_442907.1_9 Forward -313 -294 -0.590531 0.225
NP_441719.1_2 Reverse -87 -101 14.0211 0.278
NP_441719.1_4 Forward -212 -205 16.3621 0.0124
NP_441719.1_4 Reverse -205 -212 16.3621 0.0124
NP_441719.1_4 Forward -334 -327 13.5105 0.026
NP_441719.1_4 Forward -50 -43 13.5105 0.026
NP_441719.1_4 Reverse -327 -334 6.52896 0.188
NP_441719.1_4 Reverse -43 -50 6.52896 0.188
NP_441733.1_10 Forward -338 -325 17.8172 0.034
NP_441004.1_1 Forward -341 -322 -17.3068 0.29
NP_442813.1_4 Reverse -208 -227 -8.752 0.299
NP_442813.1_4 Reverse -338 -357 -8.85033 0.299
NP_442366.1_3 Reverse -41 -59 -1.25915 0.208
NP_442366.1_3 Forward -214 -196 -3.91409 0.26
NP_442366.1_3 Reverse -203 -221 -5.19239 0.284
NP_442139.1_7 Forward -116 -97 13.9625 0.167
NP_440296.1_10 Forward -150 -131 -11.8986 0.269
NP_441115.1_4 Forward -214 -196 15.948 0.0333
NP_441115.1_4 Reverse -203 -221 9.75313 0.202
NP_442694.1_4 Reverse -345 -354 14.1594 0.2
NP_442206.1_10 Reverse -278 -293 0.864876 0.243
NP_442206.1_10 Forward -335 -320 0.176559 0.269
NP_443054.1_2 Forward -215 -201 3.04785 0.24
NP_443054.1_2 Reverse -202 -216 2.94952 0.24
NP_443054.1_2 Forward -161 -147 2.75286 0.241
NP_442430.1_2 Forward -169 -150 1.96607 0.268
NP_441851.1_10 Reverse -203 -213 15.8113 0.00552
NP_441851.1_10 Forward -336 -326 14.7297 0.0126
NP_441851.1_10 Forward -52 -42 11.6814 0.0659
NP_441851.1_10 Forward -214 -204 8.53483 0.114
NP_441851.1_10 Forward -326 -316 6.17489 0.182
NP_441851.1_10 Reverse -41 -51 6.07655 0.187
NP_441851.1_10 Reverse -277 -287 4.69992 0.254
NP_442856.1_7 Reverse -141 -160 -3.14714 0.241
NP_441668.1_4 Forward -67 -48 -2.65548 0.293
NP_442515.1_1 Forward -52 -38 4.91614 0.107
NP_442515.1_1 Forward -214 -200 2.06454 0.143
NP_442515.1_1 Reverse -203 -217 -5.01529 0.298
NP_441396.1_5 Forward -330 -321 7.47288 0.252
NP_440593.1_3 Forward -110 -91 5.60432 0.123
NP_440463.1_8 Reverse -140 -159 5.37001 0.284
NP_441046.1_2 Forward -324 -305 1.96607 0.249
NP_441349.1_10 Reverse -194 -213 10.2259 0.0234
NP_441349.1_10 Forward -61 -42 -0.688862 0.0958
NP_441349.1_10 Reverse -294 -313 -5.9004 0.215
NP_441409.1_6 Forward -219 -200 -0.000545616 0.067
NP_441409.1_6 Reverse -198 -217 -8.06369 0.162
NP_441409.1_6 Reverse -320 -339 -14.9469 0.27
NP_440389.1_2 Forward -258 -239 13.4708 0.262
NP_440432.1_9 Reverse -205 -220 3.81481 0.0824
NP_440432.1_9 Reverse -327 -342 0.27489 0.159
NP_442843.1_1 Forward -164 -145 -6.1954 0.244
NP_440474.1_8 Reverse -327 -341 7.47213 0.204
NP_440474.1_8 Forward -212 -198 7.47213 0.204
NP_440474.1_8 Reverse -205 -219 4.03056 0.294
NP_442450.1_5 Forward -215 -205 9.41981 0.115
NP_442450.1_5 Reverse -202 -212 9.32148 0.115
NP_442450.1_5 Forward -337 -327 6.8632 0.151
NP_442450.1_5 Reverse -40 -50 6.66654 0.16
NP_442450.1_5 Forward -53 -43 6.07655 0.204
NP_440588.1_2 Forward -60 -41 3.53937 0.0988
NP_440588.1_2 Reverse -195 -214 -2.26216 0.163
NP_440195.1_4 Forward -225 -206 7.17762 0.26
NP_440195.1_5 Forward -319 -300 1.17943 0.295
NP_442006.1_2 Forward -99 -82 -9.59759 0.197
NP_442006.1_2 Forward -133 -116 -16.2841 0.247
NP_442006.1_2 Reverse -278 -295 -16.6774 0.261
NP_442006.1_2 Forward -344 -327 -17.6607 0.279
NP_441003.1_9 Reverse -141 -160 9.93088 0.213
NP_443047.1_7 Reverse -327 -346 7.07928 0.225
NP_440483.1_1 Forward -157 -138 3.83436 0.154
NP_442243.1_1 Forward -57 -39 7.58986 0.178
NP_442243.1_1 Forward -219 -201 0.411736 0.231
NP_441570.1_1 Forward -213 -195 2.28076 0.0252
NP_441570.1_1 Reverse -156 -174 0.412472 0.0394
NP_441570.1_1 Reverse -204 -222 -9.22396 0.132
NP_441078.1_4 Forward -213 -204 19.6659 0.0007
NP_441078.1_4 Reverse -204 -213 19.6659 0.0007
NP_441078.1_4 Reverse -150 -159 5.99792 0.0932
NP_441078.1_4 Forward -51 -42 0.196389 0.205
NP_441078.1_4 Reverse -326 -335 0.0980582 0.205
NP_441078.1_4 Forward -335 -326 0.0980582 0.205
NP_441078.1_4 Reverse -42 -51 -0.000272808 0.205
NP_441078.1_4 Forward -159 -150 -1.77023 0.266
NP_442729.1_8 Reverse -200 -213 9.75405 0.125
NP_442729.1_8 Forward -147 -134 6.50913 0.193
NP_442729.1_8 Reverse -152 -165 6.01747 0.217
NP_442443.1_1 Reverse -170 -189 -3.54046 0.267
NP_442443.1_4 Forward -96 -86 18.1707 0.14
NP_440793.1_1 Reverse -64 -78 9.43874 0.293
NP_440526.1_3 Reverse -327 -338 11.0712 0.0646
NP_440526.1_3 Forward -212 -201 10.1862 0.0646
NP_440526.1_3 Reverse -205 -216 1.82816 0.267
NP_440526.1_3 Forward -286 -275 0.844851 0.267
NP_441432.1_8 Reverse -203 -212 16.8143 0.00595
NP_441432.1_8 Forward -214 -205 16.8143 0.00595
NP_441432.1_8 Forward -52 -43 7.27622 0.101
NP_441432.1_8 Reverse -155 -164 5.89959 0.13
NP_441432.1_8 Forward -100 -91 5.60459 0.147
NP_442320.1_8 Forward -219 -205 13.8643 0.0144
NP_442320.1_8 Forward -57 -43 3.53951 0.0594
NP_442320.1_8 Reverse -198 -212 3.44117 0.0617
NP_442320.1_8 Forward -319 -305 -4.22864 0.151
NP_442320.1_8 Forward -341 -327 -4.62196 0.177
NP_441732.1_2 Forward -217 -201 2.61514 0.0213
NP_440759.1_9 Forward -382 -363 12.8808 0.136
NP_442815.1_2 Forward -110 -92 2.37909 0.296
NP_440760.1_1 Forward -51 -32 -16.1268 0.166
NP_440760.1_1 Forward -165 -146 -17.0118 0.191
NP_440760.1_1 Forward -213 -194 -21.4367 0.237
NP_442797.1_7 Reverse -240 -258 2.57575 0.238
NP_441131.1_9 Forward -153 -134 10.7175 0.164
NP_440199.1_10 Reverse -201 -211 16.7946 0.0381
NP_440199.1_10 Forward -54 -44 15.5163 0.0861
NP_440199.1_10 Forward -216 -206 14.238 0.0861
NP_440199.1_10 Reverse -153 -163 7.35486 0.231
NP_440199.1_10 Reverse -45 -55 7.25653 0.231
NP_440578.1_10 Reverse -82 -101 11.7008 0.246
NP_442400.1_1 Reverse -323 -342 5.01433 0.126
NP_440713.1_4 Forward -349 -330 1.37609 0.287
NP_442489.1_7 Forward -213 -204 20.1576 0.000695
NP_442489.1_7 Reverse -204 -213 20.1576 0.000695
NP_442489.1_7 Reverse -326 -335 7.57121 0.057
NP_442489.1_7 Reverse -42 -51 7.47288 0.0613
NP_442489.1_7 Forward -51 -42 0.688044 0.152
NP_442489.1_7 Forward -335 -326 0.589713 0.17
NP_442489.1_7 Forward -165 -156 -1.77023 0.247
NP_442489.1_7 Reverse -150 -159 -1.77023 0.247
NP_440386.1_6 Reverse -176 -195 2.55527 0.258
NP_440559.1_1 Forward -212 -203 17.4043 0.00658
NP_440559.1_1 Forward -50 -41 13.3727 0.0401
NP_440559.1_1 Reverse -205 -214 8.65285 0.0586
NP_440559.1_1 Reverse -43 -52 7.76787 0.0918
NP_440559.1_1 Reverse -327 -336 7.66954 0.0999
NP_440559.1_1 Forward -334 -325 5.80125 0.136
NP_440559.1_1 Reverse -49 -58 4.12963 0.295
NP_442763.1_10 Reverse -91 -110 2.55606 0.26
NP_442763.1_10 Reverse -311 -330 -0.197208 0.299
NP_441659.2_8 Reverse -204 -214 20.9245 0.000805
NP_441659.2_8 Forward -213 -203 18.1713 0.00133
NP_441659.2_8 Reverse -326 -336 7.45319 0.0601
NP_441659.2_8 Forward -51 -41 6.46988 0.0744
NP_441659.2_8 Reverse -156 -166 5.78156 0.0979
NP_441022.1_1 Reverse -57 -66 13.2728 0.216
NP_441022.1_1 Forward -68 -59 13.2728 0.216
NP_442913.1_10 Reverse -195 -214 -2.85214 0.192
NP_442913.1_10 Forward -222 -203 -5.40875 0.264
NP_440708.1_6 Reverse -158 -177 -10.7186 0.287
NP_440779.1_5 Reverse -326 -343 -5.46769 0.149
NP_442346.1_1 Forward -158 -139 11.2092 0.27
NP_442346.1_5 Reverse -203 -213 16.6963 0.00248
NP_442346.1_5 Forward -214 -204 16.303 0.00248
NP_442346.1_5 Reverse -155 -165 10.8948 0.0813
NP_442346.1_5 Forward -336 -326 8.33817 0.14
NP_442346.1_5 Forward -52 -42 6.27322 0.208
NP_442346.1_5 Reverse -28 -38 6.27322 0.208
NP_440352.1_5 Reverse -44 -63 15.2838 0.13
NP_440352.1_5 Forward -80 -61 10.417 0.275
NP_440545.1_3 Reverse -92 -109 4.75873 0.0674
NP_440545.1_3 Forward -339 -322 -4.28772 0.223
NP_440545.1_3 Reverse -134 -151 -5.95935 0.265
NP_441856.1_3 Reverse -201 -220 7.96426 0.101
NP_440831.1_1 Reverse -205 -224 11.7992 0.277
NP_441923.1_6 Forward -348 -334 10.521 0.262
NP_441126.1_8 Reverse -275 -288 5.91914 0.296
NP_440459.1_2 Forward -215 -198 9.67528 0.224
NP_440459.1_2 Forward -222 -205 8.49531 0.259
NP_441653.1_2 Reverse -139 -158 2.17674 0.299
NP_440010.1_10 Reverse -169 -188 2.85105 0.27
NP_442603.1_7 Forward -213 -199 10.8154 0.125
NP_442603.1_7 Reverse -42 -56 9.43874 0.146
NP_441585.1_5 Reverse -140 -159 3.73524 0.255
NP_441888.1_7 Reverse -321 -335 3.14618 0.225
NP_441502.1_6 Forward -215 -196 14.0608 0.264
NP_441833.1_4 Forward -212 -205 15.9687 0.0124
NP_441833.1_4 Reverse -205 -212 15.9687 0.0124
NP_441833.1_4 Reverse -327 -334 6.52896 0.0924
NP_441833.1_4 Reverse -43 -50 6.52896 0.0924
NP_441833.1_4 Forward -334 -327 6.23397 0.163
NP_441833.1_4 Forward -50 -43 6.23397 0.163
NP_440751.1_3 Reverse -324 -343 6.29183 0.287
NP_442799.1_2 Forward -59 -40 5.99764 0.18
NP_441895.1_2 Forward -361 -342 -18.0934 0.234
NP_442162.1_9 Forward -212 -205 16.2637 0.0124
NP_442162.1_9 Reverse -205 -212 16.2637 0.0124
NP_442162.1_9 Forward -334 -327 6.62729 0.142
NP_442162.1_9 Forward -50 -43 6.62729 0.142
NP_442162.1_9 Reverse -327 -334 6.52896 0.178
NP_442162.1_9 Reverse -43 -50 6.52896 0.178
NP_440671.1_4 Forward -219 -205 15.4376 0.0442
NP_440671.1_4 Reverse -198 -212 8.94771 0.188
NP_440671.1_4 Forward -57 -43 5.99778 0.266
NP_440224.1_1 Forward -62 -43 -1.67217 0.181
NP_440224.1_1 Forward -224 -205 -2.0655 0.195
NP_440224.1_8 Reverse -230 -249 18.584 0.0545
NP_441915.1_4 Forward -160 -141 6.29183 0.293
NP_442140.1_3 Forward -50 -40 5.28991 0.216
NP_442140.1_3 Reverse -327 -337 5.28991 0.216
NP_442140.1_3 Forward -334 -324 4.69992 0.238
NP_442140.1_3 Forward -212 -202 4.40493 0.243
NP_440875.1_9 Forward -333 -323 9.63741 0.233
NP_440875.1_9 Reverse -328 -338 8.5667 0.233
NP_440875.1_9 Reverse -206 -216 7.59334 0.255
NP_440875.1_9 Reverse -98 -108 7.59334 0.255
NP_441813.1_5 Reverse -202 -212 15.9097 0.01
NP_441813.1_5 Forward -215 -205 15.9097 0.01
NP_441813.1_5 Reverse -324 -334 9.02648 0.0313
NP_441813.1_5 Forward -53 -43 6.17489 0.1
NP_441813.1_5 Forward -337 -327 -0.806614 0.285
NP_442089.1_1 Forward -111 -92 -1.86883 0.285
NP_440590.1_4 Reverse -205 -218 4.05085 0.0642
NP_440590.1_4 Reverse -43 -56 3.06754 0.0772
NP_440590.1_4 Forward -212 -199 2.67422 0.0835
NP_440590.1_4 Forward -334 -321 -3.32397 0.255
NP_440567.1_1 Reverse -205 -219 14.3559 0.0187
NP_440567.1_1 Reverse -43 -57 12.586 0.0225
NP_440567.1_1 Forward -212 -198 11.6026 0.0277
NP_440567.1_1 Reverse -327 -341 3.63784 0.139
NP_442497.1_10 Reverse -205 -214 17.601 0.00813
NP_442497.1_10 Forward -212 -203 10.4228 0.0087
NP_442497.1_10 Reverse -327 -336 10.0295 0.0222
NP_442497.1_10 Forward -50 -41 8.25953 0.047
NP_442497.1_10 Reverse -43 -52 0.589713 0.153
NP_442497.1_10 Forward -334 -325 -1.18024 0.256
NP_440821.1_4 Reverse -202 -212 18.2696 0.00448
NP_440821.1_4 Forward -215 -205 11.0914 0.0146
NP_440821.1_4 Forward -337 -327 9.81313 0.0246
NP_440821.1_4 Forward -53 -43 8.53483 0.0468
NP_440821.1_4 Reverse -40 -50 0.57002 0.169
NP_441239.1_9 Forward -215 -203 12.1337 0.0494
NP_441239.1_9 Forward -107 -95 8.20045 0.141
NP_441239.1_9 Reverse -324 -336 6.82381 0.175
NP_441239.1_9 Reverse -202 -214 4.36554 0.253
NP_441239.1_9 Forward -337 -325 3.18557 0.292
NP_441009.1_4 Forward -105 -86 9.73422 0.296
NP_441009.1_7 Forward -214 -195 13.1758 0.191
NP_441892.1_1 Reverse -195 -212 -0.256152 0.181
NP_441892.1_1 Forward -344 -327 -5.36936 0.279
NP_441892.1_1 Forward -222 -205 -5.86102 0.29
NP_442044.1_9 Reverse -204 -223 13.8641 0.128
NP_442193.1_1 Forward -159 -141 7.59063 0.288
NP_442193.1_3 Reverse -91 -110 17.332 0.211
NP_441017.1_6 Forward -55 -41 17.8952 0.0431
NP_441017.1_6 Forward -217 -203 16.1252 0.0771
NP_441769.1_1 Reverse -142 -161 7.57094 0.279
NP_442216.1_4 Reverse -317 -325 15.3586 0.255
NP_440212.1_5 Reverse -37 -56 20.8456 0.0532
NP_440212.1_6 Reverse -9 -28 19.8614 0.114
NP_442138.1_9 Forward -226 -207 12.3883 0.202
NP_442809.1_6 Forward -105 -86 6.88262 0.256
NP_440546.1_4 Reverse -204 -214 13.5365 0.0459
NP_440546.1_4 Forward -213 -203 10.046 0.109
NP_440546.1_4 Forward -152 -142 9.17338 0.151
NP_440462.1_6 Forward -215 -205 16.893 0.00853
NP_440462.1_6 Reverse -202 -212 7.74818 0.0699
NP_440462.1_6 Forward -337 -327 7.15819 0.089
NP_440462.1_6 Reverse -324 -334 6.96153 0.0932
NP_440462.1_6 Forward -53 -43 4.50326 0.197
NP_442592.1_3 Forward -155 -136 9.83255 0.255
NP_440868.1_4 Reverse -200 -212 8.20045 0.0602
NP_440868.1_4 Reverse -322 -334 1.02229 0.193
NP_440868.1_4 Forward -217 -205 -0.846001 0.282
NP_440868.1_4 Forward -55 -43 -0.846001 0.282
NP_441249.1_8 Reverse -278 -297 8.45592 0.19
NP_442787.1_5 Forward -343 -324 7.86593 0.27
NP_442402.1_4 Reverse -2 -21 -5.90115 0.249
NP_441848.1_4 Forward -76 -60 17.5773 0.151
NP_441084.1_6 Forward -215 -201 10.7985 0.228
NP_441084.1_6 Forward -249 -235 10.1198 0.254
NP_440696.1_3 Reverse -283 -301 2.67408 0.215
NP_440696.1_3 Reverse -38 -56 -1.16082 0.251
NP_440696.1_3 Forward -335 -317 -1.45582 0.259
NP_442039.1_4 Forward -212 -205 15.1821 0.0124
NP_442039.1_4 Reverse -205 -212 15.1821 0.0124
NP_442039.1_7 Reverse -131 -141 11.9764 0.257
NP_441811.1_8 Reverse -36 -50 10.816 0.219
NP_442679.1_1 Forward -383 -364 -4.52377 0.281
NP_441926.1_3 Reverse -204 -220 6.15506 0.17
NP_442837.1_3 Forward -212 -205 15.7721 0.0124
NP_442837.1_3 Reverse -205 -212 15.7721 0.0124
NP_442837.1_3 Reverse -327 -334 12.1338 0.0702
NP_442837.1_3 Reverse -43 -50 12.1338 0.0702
NP_442837.1_3 Forward -334 -327 6.0373 0.25
NP_442837.1_3 Forward -50 -43 6.0373 0.25
NP_442053.1_1 Forward -213 -204 18.3876 0.0007
NP_442053.1_1 Reverse -204 -213 18.3876 0.0007
NP_442053.1_1 Reverse -326 -335 6.8829 0.111
NP_442053.1_1 Reverse -42 -51 6.78456 0.115
NP_440505.1_3 Reverse -202 -212 16.303 0.00696
NP_440505.1_3 Forward -215 -205 15.123 0.014
NP_440505.1_3 Forward -315 -305 10.5014 0.105
NP_440505.1_3 Forward -87 -77 9.61647 0.122
NP_440505.1_3 Forward -53 -43 7.45319 0.154
NP_440505.1_7 Forward -151 -132 4.03102 0.207
NP_441701.1_3 Forward -108 -91 6.23369 0.294
NP_441959.1_10 Forward -336 -318 15.9593 0.178
NP_441102.1_1 Reverse -205 -224 7.57094 0.215
NP_441203.1_1 Reverse -205 -224 -12.2919 0.143
NP_441408.2_7 Forward -228 -209 -3.3438 0.272
NP_441408.2_7 Forward -107 -88 -4.52377 0.281
NP_440914.1_1 Forward -213 -203 17.5935 0.000537
NP_440914.1_1 Reverse -204 -214 16.3248 0.00196
NP_440914.1_1 Forward -99 -89 9.10306 0.186
NP_441011.1_8 Reverse -205 -214 16.6177 0.00602
NP_441011.1_8 Forward -334 -325 8.55452 0.144
NP_441011.1_8 Forward -212 -203 8.25953 0.144
NP_442101.1_10 Forward -221 -202 1.27776 0.0848
NP_442533.1_1 Forward -328 -309 -4.22878 0.14
NP_442533.1_1 Forward -322 -303 -15.4385 0.254
NP_442533.1_1 Forward -341 -322 -17.8968 0.297
NP_442533.1_6 Forward -213 -204 17.2076 0.00137
NP_442533.1_6 Reverse -204 -213 17.2076 0.00137
NP_442533.1_6 Reverse -96 -105 5.99792 0.121
NP_442533.1_6 Forward -159 -150 5.80125 0.128
NP_442533.1_6 Reverse -156 -165 5.60459 0.137
NP_442533.1_6 Forward -335 -326 5.40793 0.14
NP_442533.1_6 Forward -287 -278 4.42462 0.179
NP_442541.1_10 Reverse -95 -109 1.5723 0.283
NP_442232.1_9 Reverse -49 -68 17.5015 0.199
NP_441482.1_7 Forward -219 -205 -1.18038 0.0637
NP_441482.1_7 Forward -302 -288 -1.96703 0.0913
NP_439944.1_9 Forward -212 -202 19.0562 0.00329
NP_439944.1_9 Reverse -205 -215 17.6796 0.00347
NP_439944.1_9 Reverse -43 -53 9.22315 0.1
NP_439944.1_9 Reverse -327 -337 7.64985 0.134
NP_439944.1_9 Forward -164 -154 6.76487 0.168
NP_442269.1_10 Reverse -226 -245 4.42435 0.247
NP_441028.1_6 Reverse -337 -347 3.51951 0.292
NP_440116.1_8 Reverse -205 -224 -3.54046 0.154
NP_440116.1_8 Forward -212 -193 -7.67036 0.236
NP_441527.1_4 Forward -83 -64 -2.43547 0.156
NP_441527.1_4 Forward -90 -71 -4.05883 0.179
NP_441527.1_4 Forward -98 -79 -5.30023 0.198
NP_441527.1_4 Forward -91 -72 -11.2207 0.278
NP_440115.1_6 Forward -338 -328 10.1081 0.115
NP_440115.1_6 Forward -54 -44 8.4365 0.13
NP_440007.1_9 Forward -217 -203 12.291 0.163
NP_440007.1_9 Forward -136 -122 9.14437 0.171
NP_440007.1_9 Reverse -200 -214 7.66941 0.201
NP_440007.1_9 Reverse -194 -208 4.42448 0.267
NP_441602.1_3 Reverse -91 -110 5.40766 0.141
NP_441602.1_3 Forward -164 -145 0.687771 0.217
NP_441972.1_5 Forward -158 -139 2.85105 0.121
NP_441972.1_5 Forward -330 -311 -7.27704 0.247
NP_441106.1_1 Forward -214 -205 18.486 0.0028
NP_441106.1_1 Reverse -203 -212 9.63616 0.0311
NP_441106.1_1 Reverse -325 -334 7.66954 0.0776
NP_440429.1_2 Reverse -91 -110 9.73422 0.272
NP_439903.1_6 Forward -216 -197 11.3067 0.095
NP_439903.1_6 Forward -168 -149 6.1935 0.172
NP_440302.1_4 Reverse -172 -191 12.4875 0.283
NP_441286.1_1 Reverse -203 -215 14.3953 0.00424
NP_441286.1_1 Forward -214 -202 11.937 0.0108
NP_441286.1_1 Reverse -41 -53 0.825626 0.107
NP_441286.1_1 Forward -58 -46 -0.452677 0.133
NP_441286.1_1 Forward -52 -40 -3.10761 0.145
NP_441286.1_1 Reverse -325 -337 -4.28759 0.154
NP_442674.1_3 Reverse -196 -215 11.7983 0.174
NP_440670.1_8 Forward -213 -204 18.3876 0.000699
NP_440670.1_8 Reverse -204 -213 18.3876 0.000699
NP_440670.1_8 Forward -51 -42 7.47288 0.0773
NP_440670.1_8 Reverse -42 -51 5.89959 0.131
NP_440886.1_7 Forward -214 -204 8.04271 0.0805
NP_440886.1_7 Reverse -203 -213 7.94438 0.0805
NP_440886.1_7 Reverse -303 -313 5.09279 0.201
NP_442614.1_2 Forward -213 -199 15.0442 0.0835
NP_442614.1_2 Forward -313 -299 12.0943 0.171
NP_442382.1_9 Reverse -92 -111 9.24175 0.281
NP_442072.1_9 Reverse -203 -221 6.214 0.0132
NP_442072.1_9 Forward -160 -142 -14.9272 0.165
NP_442072.1_9 Forward -214 -196 -20.4337 0.204
NP_441753.1_10 Forward -222 -203 9.83255 0.166
NP_441753.1_10 Forward -358 -339 2.16274 0.244
NP_441753.1_10 Forward -311 -292 1.17943 0.274
NP_442022.1_4 Forward -123 -104 7.47261 0.268
NP_440907.2_8 Forward -50 -40 11.091 0.0969
NP_440907.2_8 Reverse -327 -337 10.0093 0.103
NP_440907.2_8 Reverse -205 -215 9.51767 0.103
NP_442264.1_2 Reverse -200 -217 8.69197 0.211
NP_442264.1_2 Reverse -38 -55 6.03703 0.267
NP_441021.1_1 Reverse -323 -342 -10.817 0.248
NP_441463.1_3 Reverse -194 -213 -2.16383 0.151
NP_441463.1_6 Forward -215 -201 6.8991 0.267
NP_442842.1_4 Reverse -205 -224 12.5858 0.185
NP_441626.1_2 Forward -212 -205 15.7721 0.0124
NP_441626.1_2 Reverse -205 -212 15.7721 0.0124
NP_441626.1_2 Forward -334 -327 6.13563 0.177
NP_441626.1_2 Forward -50 -43 6.13563 0.177
NP_441626.1_2 Reverse -327 -334 5.93897 0.231
NP_441626.1_2 Reverse -43 -50 5.93897 0.231
NP_442794.1_1 Reverse -194 -206 10.6587 0.0721
NP_442794.1_1 Forward -61 -49 3.48056 0.286
NP_442615.1_1 Reverse -195 -213 -4.70074 0.192
NP_441962.1_4 Reverse -133 -152 -3.54046 0.149
NP_441962.1_4 Forward -104 -85 -14.3569 0.286
NP_440387.1_1 Reverse -204 -220 -0.43312 0.138
NP_440387.1_1 Forward -213 -197 -3.57971 0.162
NP_441431.1_2 Reverse -323 -337 8.65209 0.209
NP_441488.1_7 Forward -341 -322 2.16274 0.274
NP_441488.1_8 Reverse -43 -57 9.34041 0.157
NP_441993.1_1 Forward -341 -322 4.48058 0.22
NP_441993.1_1 Forward -213 -194 3.99329 0.227
NP_440143.1_1 Forward -108 -89 12.8808 0.284
NP_441174.1_1 Forward -333 -318 12.4679 0.231
NP_440358.1_2 Forward -295 -278 8.29791 0.294
NP_440114.1_10 Reverse -204 -218 10.9143 0.13
NP_440114.1_10 Forward -213 -199 9.83269 0.16
NP_440114.1_10 Reverse -326 -340 7.17775 0.243
NP_442698.1_10 Forward -55 -36 -0.983855 0.297
NP_442323.1_7 Forward -218 -199 5.30853 0.207
NP_442323.1_7 Reverse -199 -218 5.01354 0.21
NP_441510.2_7 Reverse -198 -212 11.2087 0.28
NP_440293.1_3 Reverse -88 -107 -5.70374 0.281
NP_440766.1_4 Forward -217 -203 7.27608 0.0952
NP_440766.1_4 Forward -339 -325 2.5562 0.179
NP_440766.1_4 Forward -55 -41 0.982901 0.259
NP_441237.1_9 Forward -50 -40 14.6313 0.0285
NP_441237.1_9 Reverse -327 -337 14.533 0.0323
NP_441237.1_9 Reverse -49 -59 11.2881 0.189
NP_442743.1_4 Forward -158 -139 -7.86702 0.281
NP_442103.1_2 Reverse -141 -159 7.68819 0.28
NP_442930.1_1 Forward -66 -56 12.5659 0.239
NP_442930.1_1 Reverse -59 -69 12.5659 0.239
NP_439910.1_2 Forward -221 -204 -3.20608 0.0362
NP_439910.1_2 Reverse -318 -335 -12.9408 0.113
NP_440457.1_1 Forward -55 -43 8.59377 0.101
NP_440457.1_1 Forward -339 -327 7.90546 0.101
NP_440457.1_1 Forward -217 -205 7.11881 0.105
NP_440457.1_1 Forward -335 -323 0.923956 0.25
NP_440457.1_1 Reverse -200 -212 -0.0593532 0.25
NP_440801.1_10 Reverse -143 -162 16.4207 0.126
NP_440142.1_7 Forward -348 -329 8.55425 0.232
NP_441436.1_8 Forward -336 -317 9.93088 0.262
NP_440473.1_9 Forward -346 -327 4.03102 0.0985
NP_442509.1_9 Forward -213 -203 8.14104 0.192
NP_442509.1_9 Reverse -204 -214 8.04271 0.192
NP_442439.1_8 Forward -106 -87 10.5209 0.246
NP_442936.1_10 Reverse -56 -70 14.2405 0.216
NP_442936.1_10 Forward -69 -55 14.2405 0.216
NP_440554.1_4 Reverse -205 -215 16.1063 0.0189
NP_440554.1_4 Forward -334 -324 8.82982 0.0646
NP_440554.1_4 Forward -212 -202 7.05986 0.106
NP_440554.1_4 Reverse -157 -167 4.69992 0.181
NP_441845.1_6 Forward -347 -329 8.96727 0.12
NP_441885.1_5 Forward -213 -203 20.9245 0.000538
NP_441885.1_5 Reverse -204 -214 11.3864 0.00668
NP_441885.1_5 Reverse -42 -52 1.25834 0.11
NP_441885.1_5 Forward -335 -325 0.766681 0.123
NP_441885.1_5 Reverse -150 -160 0.0783647 0.183
NP_440478.1_9 Reverse -132 -151 10.0292 0.255
NP_441428.1_8 Reverse -196 -215 4.12936 0.243
NP_442341.1_7 Forward -160 -146 17.1092 0.0138
NP_442341.1_7 Reverse -203 -217 10.521 0.0625
NP_442341.1_7 Reverse -41 -55 7.27608 0.109
NP_442341.1_7 Forward -214 -200 5.89945 0.142
NP_442341.1_7 Reverse -7 -21 2.2612 0.263
NP_442341.1_7 Reverse -325 -339 1.27789 0.295
NP_442341.1_9 Forward -215 -201 16.4202 0.0364
NP_442341.1_9 Reverse -202 -216 4.8172 0.291
NP_440423.1_6 Forward -343 -324 9.0459 0.0273
NP_443000.1_7 Forward -215 -205 17.4829 0.00719
NP_443000.1_7 Reverse -202 -212 17.0896 0.00865
NP_443000.1_7 Forward -53 -43 7.35486 0.0859
NP_443000.1_7 Reverse -154 -164 4.40493 0.199
NP_443000.1_7 Reverse -324 -334 1.06167 0.274
NP_441842.1_10 Forward -58 -44 16.3225 0.0311
NP_441842.1_10 Forward -220 -206 7.66941 0.249
NP_440275.1_3 Forward -337 -327 10.0098 0.0454
NP_440275.1_3 Forward -215 -205 9.12481 0.055
NP_440275.1_3 Reverse -202 -212 8.1415 0.0602
NP_440091.1_1 Reverse -200 -212 8.88877 0.0567
NP_440091.1_1 Forward -217 -205 1.41561 0.197
NP_440091.1_1 Forward -339 -327 1.12062 0.212
NP_440679.1_10 Reverse -280 -299 -20.5517 0.286
NP_443010.1_10 Forward -216 -199 10.5015 0.122
NP_439962.1_4 Reverse -139 -158 -0.295539 0.199
NP_439962.1_6 Reverse -168 -186 7.68896 0.275
NP_440149.1_8 Forward -165 -146 5.50599 0.0746
NP_440149.1_8 Forward -213 -194 -1.7705 0.162
NP_441105.1_3 Forward -224 -205 2.55606 0.102
NP_441105.1_3 Reverse -85 -104 1.0811 0.117
NP_441105.1_3 Reverse -193 -212 -4.52377 0.201
NP_441105.1_3 Reverse -199 -218 -6.1954 0.23
NP_440216.1_1 Reverse -204 -218 7.9644 0.00737
NP_440216.1_1 Forward -213 -199 0.0979218 0.0284
NP_440216.1_1 Forward -335 -321 -11.8985 0.228
NP_440216.1_6 Forward -58 -42 4.0901 0.204
NP_440216.1_9 Forward -103 -94 13.9627 0.184
NP_440216.1_9 Reverse -50 -59 12.0944 0.252
NP_440216.1_9 Forward -97 -88 6.78456 0.289
NP_440216.1_9 Forward -347 -338 5.40793 0.294
NP_440172.1_1 Reverse -204 -214 17.5813 0.00421
NP_440172.1_1 Forward -213 -203 15.0247 0.00945
NP_442788.1_7 Forward -343 -324 8.35759 0.278
NP_442015.1_10 Reverse -322 -335 4.8375 0.159
NP_442015.1_10 Forward -217 -204 2.67422 0.187
NP_442015.1_10 Reverse -200 -213 0.510939 0.224
NP_442015.1_10 Reverse -92 -105 0.117615 0.241
NP_442015.1_10 Forward -55 -42 0.0192843 0.245
NP_441226.1_7 Forward -212 -205 14.4934 0.0123
NP_441226.1_7 Reverse -205 -212 14.4934 0.0123
NP_441226.1_7 Reverse -49 -56 12.4284 0.0404
NP_441485.1_2 Reverse -286 -305 12.8808 0.274
NP_441757.1_3 Forward -52 -33 -1.08219 0.245
NP_441111.1_7 Forward -212 -204 18.7023 0.00294
NP_441111.1_7 Reverse -205 -213 18.7023 0.00294
NP_441111.1_7 Reverse -327 -335 8.86921 0.0589
NP_441111.1_7 Reverse -43 -51 8.86921 0.0589
NP_442379.1_10 Reverse -197 -214 5.54538 0.129
NP_442379.1_10 Forward -220 -203 -2.22277 0.226
NP_441766.1_2 Forward -213 -204 17.5026 0.00297
NP_441766.1_2 Reverse -204 -213 17.5026 0.00297
NP_441766.1_2 Forward -335 -326 8.1612 0.0645
NP_441766.1_2 Reverse -42 -51 6.48957 0.096
NP_442417.1_5 Reverse -204 -218 9.04604 0.138
NP_442417.1_5 Forward -335 -321 7.17775 0.195
NP_442417.1_5 Reverse -138 -152 5.30946 0.267
NP_440416.1_9 Reverse -89 -108 -0.4922 0.0598
NP_440416.1_9 Reverse -209 -228 -18.8801 0.266
NP_443052.1_8 Forward -223 -204 -3.24547 0.1
NP_440591.1_9 Forward -342 -324 15.8504 0.0814
NP_442154.1_1 Reverse -276 -294 -15.5171 0.22
NP_442154.1_1 Reverse -270 -288 -15.5171 0.22
NP_442154.1_1 Reverse -285 -303 -15.6155 0.222
NP_442154.1_1 Forward -158 -140 -18.9587 0.288
NP_440261.1_5 Forward -212 -199 -1.06236 0.0655
NP_440261.1_5 Forward -146 -133 -4.60227 0.158
NP_440261.1_5 Reverse -205 -218 -10.6005 0.201
NP_440261.1_5 Reverse -327 -340 -10.6988 0.203
NP_440261.1_5 Forward -50 -37 -12.4687 0.297
NP_440261.1_5 Reverse -43 -56 -12.4687 0.297
NP_440988.1_10 Reverse -46 -60 8.4809 0.205
NP_440988.1_10 Forward -209 -195 3.25301 0.298
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GTAGCAGCCAACTGCCTAGATACAATAAACGCAAAATCGTACCAATCAAAAAGCCGTGGGAAAGGGGCGATCGATGGGGAATGAAGTGGCGGTAGGGAAGCCAGACCCATCTCAGCCAGCCCCACCTTTTATATTGACAGGAATGGATGTCCAGATCCGGGCCAAACATCAACCCGCTAAATCCAAAGGCGATCGCCATTAGCAGGGTTAGTCGGGCACTACCAGTGCCAATAAATGTGATGGCCATAACCGCTGGGGTGGCTCCCAGGGTAATGCGGTCATGGATTTTACCGGCGGGCATGGCAAAGGCAAAAAGGGAATAGGTAACTAGGAAAAAATTTTTTCCGATGGCGATCGAACAAAACGATAACCTATGATATAGTGGTTAAGCACGAGTAAA

CDS

No sequence available

Protein

No sequence available