Your browser is old and dusty. Try Google Chrome!

Details for 6803t04

ORF 6803t04
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -191 -205 12.291 0.222
NP_441061.1_2 Forward -199 -185 5.30946 0.138
NP_441061.1_2 Reverse -192 -206 2.75286 0.172
NP_441061.1_2 Reverse -56 -70 -0.590395 0.234
NP_440795.1_7 Forward -199 -192 14.6904 0.0123
NP_440795.1_7 Reverse -192 -199 14.6904 0.0123
NP_441418.1_6 Reverse -191 -210 -3.04881 0.0218
NP_441418.1_6 Forward -200 -181 -28.0249 0.203
NP_442291.1_5 Forward -201 -185 -0.236458 0.18
NP_441453.1_1 Forward -207 -189 6.70489 0.227
NP_441453.1_4 Reverse -191 -199 16.539 0.00633
NP_441453.1_4 Forward -200 -192 16.539 0.00633
NP_441453.1_4 Forward -64 -56 5.42762 0.135
NP_441453.1_4 Reverse -55 -63 3.95266 0.275
NP_441623.1_1 Reverse -380 -398 -2.24246 0.241
NP_442151.1_6 Forward -200 -186 11.406 0.101
NP_442151.1_6 Reverse -191 -205 10.0294 0.133
NP_441818.1_1 Forward -199 -188 18.446 0.0046
NP_440226.1_1 Reverse -191 -210 12.1925 0.0465
NP_440150.1_6 Forward -203 -184 3.53937 0.248
NP_440996.1_3 Reverse -190 -208 10.9339 0.245
NP_442173.1_1 Forward -199 -191 15.4574 0.00633
NP_442173.1_1 Reverse -192 -200 15.4574 0.00633
NP_442752.1_4 Forward -200 -193 13.8055 0.0199
NP_442752.1_4 Reverse -191 -198 13.8055 0.0199
NP_443027.1_4 Forward -202 -192 15.3197 0.0437
NP_443027.1_4 Reverse -189 -199 11.0914 0.107
NP_441812.1_3 Reverse -190 -204 8.06273 0.254
NP_442975.1_10 Forward -204 -190 12.0937 0.0477
NP_442975.1_10 Reverse -187 -201 4.62054 0.241
NP_440784.1_7 Forward -199 -192 15.9687 0.0123
NP_440784.1_7 Reverse -192 -199 15.9687 0.0123
NP_440061.1_9 Reverse -189 -203 12.192 0.0999
NP_442062.1_8 Forward -200 -190 17.3846 0.00193
NP_442062.1_8 Reverse -191 -201 10.3048 0.0493
NP_442062.1_8 Reverse -270 -280 2.92996 0.292
NP_440761.1_3 Forward -111 -92 13.9214 0.221
NP_440761.1_4 Reverse -186 -205 -14.1602 0.257
NP_441859.1_3 Reverse -190 -209 14.9449 0.0704
NP_440304.1_4 Forward -202 -192 18.9579 0.00406
NP_440304.1_4 Forward -66 -56 6.46988 0.155
NP_440304.1_4 Forward -38 -28 6.27322 0.167
NP_440304.1_4 Reverse -183 -193 2.24165 0.299
NP_440304.1_4 Reverse -189 -199 1.84832 0.299
NP_442242.1_4 Forward -199 -192 14.3954 0.0124
NP_442242.1_4 Reverse -192 -199 14.3954 0.0124
NP_440044.1_8 Reverse -192 -211 -0.787193 0.228
NP_440908.1_5 Reverse -57 -74 12.8219 0.175
NP_441208.1_9 Forward -203 -189 7.76774 0.219
NP_441208.1_9 Reverse -188 -202 6.78443 0.229
NP_441594.1_6 Forward -338 -319 12.0942 0.116
NP_441594.1_6 Forward -98 -79 2.45773 0.251
NP_441594.1_6 Forward -209 -190 0.786102 0.281
NP_441594.1_6 Reverse -182 -201 0.687771 0.282
NP_440132.1_1 Reverse -189 -207 9.55725 0.234
NP_442110.1_7 Reverse -191 -205 11.0127 0.0644
NP_442110.1_7 Forward -200 -186 1.08123 0.239
NP_440856.1_4 Forward -207 -188 -1.86883 0.205
NP_441083.1_5 Forward -200 -190 20.3345 0.00053
NP_441083.1_5 Reverse -191 -201 11.2881 0.0159
NP_441083.1_5 Forward -64 -54 -0.511621 0.269
NP_439957.1_6 Forward -238 -219 13.4708 0.152
NP_439957.1_10 Forward -82 -72 18.1713 0.171
NP_442827.1_8 Reverse -183 -202 4.03023 0.14
NP_442841.1_10 Forward -280 -261 8.65258 0.298
NP_441738.1_2 Forward -198 -191 15.28 0.0102
NP_441738.1_2 Reverse -193 -200 15.28 0.0102
NP_441558.1_5 Forward -202 -183 20.5506 0.00455
NP_441558.1_5 Forward -66 -47 11.6025 0.0789
NP_441558.1_5 Reverse -189 -208 3.93269 0.294
NP_440209.1_1 Reverse -191 -199 18.1123 0.00295
NP_440209.1_1 Forward -200 -192 18.1123 0.00295
NP_442889.1_8 Forward -67 -53 3.24392 0.284
NP_440410.1_4 Forward -400 -381 18.1898 0.142
NP_441713.1_1 Forward -206 -187 -6.98204 0.125
NP_441770.1_4 Reverse -65 -84 -11.3086 0.29
NP_441792.1_5 Forward -205 -189 9.10498 0.242
NP_441716.1_1 Forward -200 -186 13.0776 0.0689
NP_441716.1_1 Reverse -191 -205 7.86607 0.156
NP_441327.1_1 Reverse -358 -377 7.5772 0.232
NP_442111.1_4 Reverse -190 -204 22.2224 0.0011
NP_442111.1_4 Forward -201 -187 2.65453 0.268
NP_440906.1_5 Forward -199 -192 15.8704 0.0124
NP_440906.1_5 Reverse -192 -199 15.8704 0.0124
NP_440747.1_10 Reverse -188 -200 16.8536 0.00143
NP_440747.1_10 Forward -203 -191 7.80712 0.00223
NP_441130.1_10 Forward -202 -188 9.93102 0.118
NP_441130.1_10 Reverse -189 -203 5.1128 0.247
NP_441486.1_1 Reverse -188 -202 -2.55701 0.175
NP_442634.1_4 Reverse -189 -203 15.9292 0.0115
NP_442634.1_4 Forward -202 -188 -3.54032 0.161
NP_441265.1_3 Forward -206 -192 3.93283 0.181
NP_440842.1_10 Forward -67 -53 4.71948 0.254
NP_442848.1_1 Reverse -185 -199 -1.8687 0.263
NP_442848.1_1 Forward -206 -192 -2.16369 0.263
NP_443018.1_3 Forward -199 -192 14.8871 0.0123
NP_443018.1_3 Reverse -192 -199 14.8871 0.0123
NP_443018.1_3 Forward -63 -56 10.6589 0.0967
NP_443018.1_3 Reverse -56 -63 4.16902 0.278
NP_441316.1_7 Reverse -189 -204 -1.39674 0.234
NP_441634.1_8 Reverse -189 -203 6.48943 0.114
NP_440376.1_1 Forward -200 -191 19.4693 0.000692
NP_440376.1_1 Reverse -191 -200 19.4693 0.000692
NP_441588.1_4 Forward -62 -52 15.6147 0.0404
NP_441588.1_4 Forward -198 -188 8.73149 0.14
NP_442687.1_7 Forward -201 -191 9.02648 0.0994
NP_442687.1_7 Reverse -190 -200 8.92815 0.0994
NP_442485.1_3 Forward -334 -315 -2.85214 0.268
NP_442958.1_3 Reverse -180 -199 -0.197208 0.267
NP_440642.1_10 Reverse -232 -246 3.53891 0.271
NP_441422.1_7 Reverse -189 -206 -1.92778 0.199
NP_442658.1_1 Forward -202 -192 15.9091 0.00966
NP_442658.1_1 Reverse -189 -199 7.94438 0.199
NP_442658.1_1 Forward -66 -56 7.15773 0.214
NP_440141.1_8 Forward -350 -331 5.89931 0.271
NP_442496.1_5 Forward -105 -87 4.44404 0.289
NP_442544.1_6 Forward -207 -188 -7.08038 0.298
NP_441414.1_9 Reverse -55 -74 -6.29373 0.192
NP_442937.1_5 Reverse -186 -205 8.06259 0.234
NP_441958.1_5 Forward -201 -191 21.2195 0.000805
NP_441958.1_5 Reverse -190 -200 12.2714 0.00183
NP_441958.1_5 Forward -65 -55 -0.314959 0.198
NP_440203.1_5 Reverse -194 -204 12.7626 0.138
NP_440984.1_7 Forward -69 -55 8.45605 0.144
NP_439990.1_5 Reverse -186 -199 22.0454 0.00173
NP_439990.1_5 Forward -205 -192 9.95071 0.128
NP_442376.1_2 Forward -205 -186 -12.4886 0.286
NP_442911.1_2 Forward -210 -191 14.3558 0.0112
NP_442911.1_2 Forward -74 -55 -10.1286 0.27
NP_440153.1_5 Reverse -192 -206 2.06454 0.239
NP_440153.1_5 Forward -199 -185 1.67122 0.245
NP_440993.1_2 Forward -205 -189 11.2683 0.0821
NP_440993.1_3 Forward -210 -191 9.24175 0.124
NP_441099.1_5 Reverse -181 -200 15.4374 0.0157
NP_441099.1_5 Forward -210 -191 -8.16202 0.189
NP_440809.1_9 Forward -209 -191 -7.749 0.225
NP_441294.1_7 Reverse -187 -201 12.3223 0.103
NP_441646.1_1 Reverse -81 -100 0.58944 0.247
NP_441646.1_1 Forward -207 -188 -0.885524 0.273
NP_442438.1_10 Forward -205 -191 2.85119 0.168
NP_441000.1_5 Forward -294 -275 4.81688 0.284
NP_441000.1_6 Forward -201 -187 -3.24533 0.221
NP_440605.1_4 Forward -210 -191 14.3475 0.225
NP_440147.1_4 Reverse -189 -202 17.5222 0.00641
NP_440147.1_4 Reverse -53 -66 14.9656 0.0205
NP_440147.1_4 Forward -202 -189 11.3273 0.0326
NP_440147.1_4 Reverse -384 -397 5.82081 0.112
NP_441550.1_8 Forward -202 -192 17.4824 0.00754
NP_441550.1_8 Reverse -189 -199 15.1225 0.0132
NP_441550.1_8 Forward -66 -56 9.12434 0.106
NP_441550.1_8 Reverse -53 -63 5.38779 0.252
NP_441916.1_7 Reverse -191 -201 18.9579 0.00144
NP_441916.1_7 Forward -200 -190 10.3048 0.0261
NP_441041.1_4 Forward -64 -45 -10.7186 0.236
NP_441041.1_7 Forward -203 -191 14.9975 0.0309
NP_441041.1_7 Reverse -188 -200 10.8188 0.0864
NP_442642.1_9 Forward -207 -190 8.10198 0.192
NP_441547.1_2 Reverse -180 -198 7.29564 0.215
NP_442004.1_6 Reverse -191 -205 4.03116 0.227
NP_441725.1_4 Forward -205 -191 12.9786 0.0693
NP_441725.1_5 Reverse -192 -202 8.92815 0.0553
NP_441725.1_5 Reverse -56 -66 6.46988 0.114
NP_441725.1_5 Forward -199 -189 2.04498 0.115
NP_439966.1_7 Reverse -189 -199 15.3192 0.0152
NP_439966.1_7 Forward -202 -192 13.8442 0.0234
NP_439966.1_9 Forward -202 -193 0.983037 0.253
NP_442941.1_3 Forward -199 -189 19.2529 0.00262
NP_442941.1_3 Reverse -192 -202 10.9931 0.0116
NP_440289.1_2 Reverse -188 -201 5.82081 0.0605
NP_440289.1_2 Forward -203 -190 2.18257 0.102
NP_440260.1_8 Reverse -46 -64 -7.55234 0.295
NP_441514.1_6 Forward -98 -91 14.2971 0.248
NP_442281.1_1 Forward -205 -191 15.6336 0.0113
NP_442281.1_1 Reverse -186 -200 8.3571 0.0823
NP_442281.1_1 Reverse -22 -36 4.32555 0.199
NP_442281.1_1 Forward -165 -151 1.5723 0.296
NP_442256.1_2 Reverse -189 -207 -9.42063 0.268
NP_442012.1_1 Forward -206 -187 2.26107 0.202
NP_442012.1_1 Reverse -326 -345 -0.4922 0.259
NP_442982.1_5 Forward -210 -191 -3.3438 0.297
NP_441644.1_6 Reverse -191 -201 19.0557 0.000803
NP_441644.1_6 Forward -200 -190 17.3841 0.00127
NP_441644.1_6 Forward -64 -54 5.97777 0.172
NP_440867.1_3 Forward -269 -250 8.45592 0.262
NP_442215.1_2 Forward -202 -186 -3.77637 0.222
NP_442215.1_2 Reverse -182 -198 -7.11963 0.286
NP_440253.1_2 Forward -200 -182 11.5239 0.031
NP_440253.1_2 Reverse -191 -209 3.26407 0.12
NP_440929.1_8 Forward -200 -191 19.2726 0.000701
NP_440929.1_8 Reverse -191 -200 19.2726 0.000701
NP_442933.1_10 Forward -200 -191 17.601 0.00325
NP_442933.1_10 Reverse -191 -200 17.601 0.00325
NP_442933.1_10 Forward -64 -55 4.71961 0.22
NP_441751.2_8 Forward -199 -185 12.4876 0.0193
NP_441751.2_8 Reverse -192 -206 6.58777 0.0348
NP_442554.1_8 Reverse -192 -202 19.1546 0.00369
NP_442554.1_8 Forward -199 -189 16.2046 0.0065
NP_442554.1_8 Reverse -56 -66 13.5497 0.018
NP_442554.1_8 Reverse -28 -38 3.42162 0.226
NP_442554.1_8 Forward -35 -25 2.83163 0.253
NP_442075.1_5 Forward -279 -260 23.2544 0.0366
NP_441762.1_7 Reverse -190 -202 2.59558 0.0676
NP_441762.1_7 Forward -201 -189 -6.64753 0.284
NP_442142.1_4 Forward -203 -190 12.9 0.0406
NP_442142.1_4 Reverse -188 -201 12.8017 0.0409
NP_442292.1_1 Forward -199 -190 18.486 0.00229
NP_442292.1_1 Reverse -192 -201 17.5026 0.00435
NP_442292.1_1 Reverse -28 -37 2.65466 0.219
NP_442292.1_5 Forward -204 -185 0.294447 0.257
NP_442476.1_3 Reverse -153 -172 10.4225 0.214
NP_442476.1_6 Reverse -192 -206 2.75286 0.174
NP_440895.1_6 Reverse -185 -198 9.16406 0.228
NP_441523.1_6 Forward -204 -185 15.4374 0.161
NP_443009.1_5 Reverse -190 -201 14.5128 0.02
NP_443009.1_5 Forward -201 -190 10.1862 0.0792
NP_441371.1_3 Reverse -198 -216 6.41066 0.277
NP_441715.1_4 Forward -199 -189 17.3846 0.0106
NP_441715.1_4 Reverse -192 -202 7.25653 0.108
NP_441198.1_8 Forward -202 -192 15.4199 0.0427
NP_441468.1_1 Forward -199 -192 15.8704 0.0124
NP_441468.1_1 Reverse -192 -199 15.8704 0.0124
NP_441468.1_1 Forward -63 -56 3.97235 0.277
NP_441015.1_10 Forward -205 -186 -6.09707 0.241
NP_441673.1_1 Forward -200 -191 20.8459 0.000698
NP_441673.1_1 Reverse -191 -200 20.8459 0.000698
NP_442253.1_5 Forward -99 -82 -2.02611 0.276
NP_441826.1_2 Reverse -185 -199 6.88276 0.0899
NP_441826.1_2 Forward -206 -192 4.03116 0.105
NP_441826.1_5 Forward -271 -252 6.29264 0.225
NP_442868.1_6 Reverse -189 -199 19.2529 0.00563
NP_442868.1_6 Forward -202 -192 8.63316 0.0555
NP_441251.1_2 Reverse -196 -214 9.55725 0.262
NP_441056.1_1 Forward -200 -181 -7.17871 0.271
NP_442677.1_3 Reverse -70 -89 -8.94866 0.288
NP_441612.1_2 Forward -82 -72 15.0357 0.21
NP_441612.1_2 Forward -200 -190 8.54929 0.21
NP_443058.1_7 Reverse -190 -209 8.65258 0.206
NP_442427.1_3 Reverse -22 -40 5.42735 0.171
NP_441911.1_10 Forward -236 -217 7.78774 0.274
NP_442808.1_1 Forward -201 -191 8.73102 0.0481
NP_442808.1_1 Reverse -190 -200 8.63269 0.0481
NP_441101.1_10 Reverse -187 -206 -7.96535 0.295
NP_440145.1_3 Forward -210 -191 1.96607 0.122
NP_440145.1_3 Reverse -181 -200 -3.24547 0.192
NP_442542.1_2 Forward -202 -189 11.3273 0.114
NP_442542.1_2 Forward -66 -53 6.90245 0.201
NP_442050.1_5 Forward -202 -192 17.1874 0.00812
NP_442050.1_5 Reverse -189 -199 14.3359 0.0206
NP_441114.1_3 Reverse -272 -281 6.5879 0.262
NP_440558.1_2 Forward -203 -184 -6.09707 0.271
NP_440558.1_2 Forward -209 -190 -7.67036 0.298
NP_441518.1_3 Reverse -136 -155 -15.4385 0.293
NP_441878.1_6 Forward -201 -191 10.5014 0.0176
NP_441878.1_6 Reverse -190 -200 10.4031 0.0176
NP_441878.1_6 Forward -65 -55 1.55333 0.0937
NP_441878.1_6 Forward -280 -270 -7.0998 0.204
NP_441878.1_6 Reverse -86 -96 -7.78811 0.266
NP_441036.1_8 Forward -201 -191 15.713 0.00724
NP_441036.1_8 Reverse -190 -200 8.33817 0.174
NP_441557.1_5 Forward -200 -191 19.9609 0.000699
NP_441557.1_5 Reverse -191 -200 19.9609 0.000699
NP_441557.1_5 Forward -64 -55 -0.885252 0.26
NP_442066.2_9 Reverse -187 -200 8.37742 0.185
NP_441433.1_8 Forward -394 -375 -1.37718 0.258
NP_440744.1_2 Reverse -184 -203 14.916 0.276
NP_440084.1_5 Reverse -159 -178 12.2908 0.178
NP_440084.1_8 Forward -78 -64 9.27434 0.29
NP_441308.1_8 Forward -202 -192 12.4681 0.218
NP_442183.1_1 Reverse -191 -205 17.6992 0.00989
NP_442183.1_1 Reverse -55 -69 6.58777 0.168
NP_441574.1_1 Reverse -191 -210 -1.96717 0.222
NP_441574.1_1 Reverse -43 -62 -5.11376 0.26
NP_441549.1_9 Reverse -187 -205 -5.68405 0.198
NP_441467.1_5 Forward -399 -389 15.0247 0.275
NP_442347.1_2 Forward -199 -190 12.4878 0.056
NP_442347.1_2 Reverse -192 -201 3.34298 0.284
NP_442645.1_2 Forward -202 -183 -21.6334 0.29
NP_442888.1_8 Reverse -259 -278 14.3558 0.175
NP_441037.1_4 Forward -202 -192 16.5761 0.0168
NP_441037.1_4 Forward -66 -56 13.6524 0.0561
NP_442594.1_9 Forward -370 -351 7.57013 0.242
NP_442317.1_6 Reverse -348 -367 9.83255 0.211
NP_441633.1_3 Reverse -189 -202 13.0973 0.018
NP_441633.1_3 Reverse -53 -66 -5.88057 0.236
NP_440136.1_2 Forward -199 -192 15.9687 0.0123
NP_440136.1_2 Reverse -192 -199 15.9687 0.0123
NP_442998.1_5 Forward -274 -264 11.4848 0.184
NP_442998.1_10 Forward -198 -191 15.5754 0.0102
NP_442998.1_10 Reverse -193 -200 15.5754 0.0102
NP_440899.1_8 Reverse -208 -227 -9.73531 0.268
NP_440299.1_1 Forward -204 -191 12.7034 0.0356
NP_440299.1_1 Reverse -187 -200 12.0151 0.0427
NP_440299.1_1 Reverse -51 -64 4.73861 0.201
NP_441799.1_1 Forward -204 -190 6.78381 0.162
NP_441799.1_1 Reverse -187 -201 5.70218 0.197
NP_440640.1_6 Forward -347 -328 1.17943 0.266
NP_441007.1_10 Forward -205 -192 10.8357 0.0646
NP_441007.1_10 Forward -69 -56 7.59077 0.136
NP_441435.1_4 Reverse -241 -260 9.43923 0.255
NP_440256.1_1 Reverse -188 -207 5.211 0.0381
NP_440256.1_1 Reverse -24 -43 -8.65367 0.264
NP_441559.1_8 Reverse -186 -200 3.73617 0.143
NP_441559.1_8 Forward -205 -191 1.27789 0.156
NP_441270.1_5 Forward -266 -247 15.8244 0.191
NP_440915.1_6 Reverse -187 -201 20.3541 0.00676
NP_440915.1_6 Forward -204 -190 13.3726 0.0187
NP_440915.1_6 Reverse -51 -65 -3.24533 0.292
NP_441464.1_1 Forward -204 -185 10.7175 0.24
NP_441464.1_8 Reverse -55 -69 4.22782 0.28
NP_440702.1_2 Reverse -68 -87 -7.86702 0.286
NP_441939.1_3 Reverse -56 -75 5.50599 0.273
NP_441199.1_6 Forward -204 -185 4.81767 0.159
NP_441494.1_6 Forward -205 -192 9.06573 0.227
NP_442993.1_1 Forward -200 -184 2.51681 0.0502
NP_440677.1_1 Forward -209 -190 11.4058 0.163
NP_440677.1_6 Reverse -289 -308 8.94757 0.27
NP_442386.1_5 Forward -400 -381 13.7649 0.111
NP_442386.1_9 Reverse -190 -199 13.8639 0.0289
NP_442386.1_9 Forward -201 -192 6.39082 0.219
NP_441340.1_5 Forward -199 -192 15.6737 0.0124
NP_441340.1_5 Reverse -192 -199 15.6737 0.0124
NP_441340.1_5 Reverse -56 -63 11.3472 0.0526
NP_441947.1_10 Reverse -318 -336 0.805796 0.276
NP_440168.1_8 Forward -206 -187 6.09597 0.203
NP_440168.1_9 Reverse -189 -208 -4.91709 0.296
NP_442240.1_2 Reverse -192 -211 -12.8819 0.163
NP_442714.1_5 Forward -337 -318 2.75272 0.238
NP_442714.1_5 Forward -229 -210 0.196116 0.258
NP_440586.1_8 Forward -199 -192 13.2151 0.026
NP_440586.1_8 Reverse -192 -199 13.2151 0.026
NP_440586.1_8 Forward -63 -56 5.74197 0.283
NP_441861.1_7 Forward -205 -186 16.9124 0.103
NP_442251.1_6 Forward -199 -192 15.2804 0.0124
NP_442251.1_6 Reverse -192 -199 15.2804 0.0124
NP_441262.1_3 Reverse -191 -198 14.7888 0.0223
NP_441262.1_3 Forward -200 -193 14.7888 0.0223
NP_443051.1_1 Forward -201 -192 19.5676 0.00335
NP_443051.1_1 Reverse -190 -199 10.4228 0.00754
NP_439996.1_9 Reverse -118 -137 18.7798 0.152
NP_439937.1_9 Reverse -190 -207 -6.74666 0.157
NP_440439.1_1 Forward -203 -190 10.344 0.0369
NP_440439.1_1 Reverse -188 -201 1.69091 0.147
NP_440372.1_2 Forward -199 -192 16.3621 0.0124
NP_440372.1_2 Reverse -192 -199 16.3621 0.0124
NP_440316.1_10 Reverse -184 -194 7.55152 0.246
NP_441803.1_2 Forward -205 -186 10.8159 0.0809
NP_439977.1_5 Reverse -185 -204 6.78429 0.128
NP_439977.1_5 Forward -206 -187 5.11266 0.15
NP_440210.1_10 Reverse -217 -236 12.9783 0.237
NP_441572.1_7 Forward -206 -187 -1.7705 0.19
NP_442384.1_10 Forward -200 -187 13.4906 0.0197
NP_442384.1_10 Reverse -191 -204 9.36073 0.054
NP_442384.1_10 Forward -64 -51 2.96921 0.206
NP_442085.1_3 Forward -117 -98 13.6072 0.208
NP_442790.1_4 Reverse -182 -201 -6.1954 0.144
NP_442262.1_10 Forward -199 -192 14.1988 0.0123
NP_442262.1_10 Reverse -192 -199 14.1988 0.0123
NP_442262.1_10 Forward -63 -56 12.0355 0.062
NP_441689.1_5 Forward -202 -192 8.43603 0.132
NP_441689.1_5 Reverse -189 -199 5.78111 0.197
NP_440163.1_10 Forward -338 -328 16.4013 0.0762
NP_440344.1_10 Forward -207 -190 9.87194 0.00789
NP_442910.1_1 Forward -207 -188 -4.91709 0.254
NP_440562.1_3 Forward -199 -182 14.4935 0.0567
NP_441640.1_8 Forward -199 -180 -1.86883 0.225
NP_440297.1_9 Reverse -56 -66 0.0783647 0.282
NP_440297.1_9 Forward -199 -189 -0.118297 0.282
NP_440297.1_9 Reverse -192 -202 -0.314959 0.282
NP_440350.1_5 Reverse -214 -233 -1.86883 0.212
NP_440350.1_5 Reverse -377 -396 -1.96717 0.215
NP_441592.1_4 Forward -200 -181 7.66927 0.124
NP_441592.1_4 Forward -279 -260 -0.983855 0.247
NP_441896.1_3 Reverse -182 -201 7.07928 0.0974
NP_441103.1_9 Reverse -90 -100 14.931 0.192
NP_440894.1_10 Reverse -186 -205 7.7676 0.194
NP_440999.1_9 Forward -204 -190 12.9793 0.0339
NP_440999.1_9 Reverse -187 -201 8.55439 0.074
NP_440999.1_9 Forward -194 -180 -1.67204 0.246
NP_440888.1_2 Forward -200 -186 18.3868 0.00256
NP_440888.1_2 Reverse -191 -205 15.0436 0.013
NP_440888.1_2 Reverse -27 -41 9.04542 0.139
NP_442948.1_2 Reverse -190 -209 11.7992 0.128
NP_442277.1_4 Reverse -182 -201 5.2102 0.175
NP_442033.1_10 Forward -202 -183 -4.32711 0.179
NP_442033.1_10 Reverse -189 -208 -11.4069 0.253
NP_442077.1_5 Forward -60 -41 13.1758 0.0676
NP_441543.1_2 Forward -199 -190 16.9127 0.00359
NP_441543.1_2 Reverse -192 -201 15.9293 0.00518
NP_442845.1_2 Forward -206 -192 10.226 0.156
NP_442845.1_2 Reverse -185 -199 5.21113 0.24
NP_442845.1_2 Reverse -49 -63 5.21113 0.24
NP_441469.1_8 Forward -201 -192 6.5879 0.227
NP_441469.1_8 Reverse -190 -199 6.48957 0.227
NP_443064.1_6 Forward -200 -190 12.5669 0.0796
NP_443064.1_6 Reverse -191 -201 10.8217 0.13
NP_442578.1_7 Forward -199 -192 14.5921 0.026
NP_442578.1_7 Reverse -192 -199 14.5921 0.026
NP_441462.1_2 Reverse -191 -201 20.2362 0.000805
NP_441462.1_2 Forward -200 -190 11.5831 0.00406
NP_441462.1_2 Reverse -55 -65 -1.19994 0.291
NP_441621.1_7 Reverse -189 -203 4.52282 0.0934
NP_443062.1_1 Reverse -191 -209 8.2534 0.157
NP_442204.1_1 Forward -204 -193 11.9567 0.0565
NP_442204.1_1 Reverse -187 -198 2.22195 0.266
NP_441560.1_8 Forward -205 -186 13.3631 0.217
NP_441351.1_8 Forward -202 -183 5.11266 0.204
NP_440516.1_8 Forward -200 -191 16.9127 0.00442
NP_440516.1_8 Reverse -191 -200 16.9127 0.00442
NP_442428.1_5 Forward -199 -192 15.8704 0.0124
NP_442428.1_5 Reverse -192 -199 15.8704 0.0124
NP_442428.1_5 Forward -63 -56 4.36568 0.271
NP_441443.1_10 Reverse -51 -69 0.510066 0.293
NP_442120.1_10 Reverse -185 -204 -6.88371 0.217
NP_442120.1_10 Reverse -296 -315 -13.9635 0.288
NP_440673.1_3 Forward -198 -191 12.4288 0.0426
NP_440673.1_3 Reverse -193 -200 12.4288 0.0426
NP_440865.1_1 Forward -239 -220 18.584 0.263
NP_441052.1_2 Forward -200 -190 19.9412 0.00106
NP_441052.1_2 Reverse -191 -201 10.4031 0.0285
NP_442219.1_8 Forward -254 -235 7.49067 0.267
NP_442219.1_8 Reverse -240 -259 6.42771 0.298
NP_442219.1_9 Forward -199 -190 17.7976 0.00718
NP_442219.1_9 Reverse -192 -201 8.25953 0.0681
NP_440436.1_4 Forward -199 -190 17.2072 0.00233
NP_440436.1_4 Reverse -192 -201 9.24241 0.0871
NP_440436.1_4 Reverse -271 -280 5.80084 0.182
NP_441884.1_9 Reverse -188 -207 -23.895 0.284
NP_442086.1_6 Forward -212 -193 12.3892 0.255
NP_440314.1_9 Reverse -192 -211 -7.76869 0.243
NP_440314.1_9 Forward -199 -180 -8.35868 0.247
NP_441719.1_4 Forward -199 -192 16.3621 0.0124
NP_441719.1_4 Reverse -192 -199 16.3621 0.0124
NP_441733.1_10 Forward -203 -190 6.31247 0.192
NP_441733.1_10 Reverse -259 -272 4.24752 0.27
NP_440746.1_3 Forward -364 -345 11.7992 0.239
NP_441004.1_1 Forward -347 -328 6.09597 0.103
NP_441004.1_4 Forward -67 -57 15.123 0.167
NP_442366.1_3 Forward -201 -183 -3.81576 0.258
NP_442366.1_5 Forward -304 -294 10.9926 0.223
NP_441115.1_4 Forward -201 -183 15.8496 0.0339
NP_442206.1_10 Reverse -191 -206 12.2713 0.0889
NP_440328.1_4 Reverse -185 -204 9.93088 0.092
NP_443054.1_2 Forward -98 -84 5.99778 0.212
NP_443054.1_2 Reverse -189 -203 0.786239 0.254
NP_442430.1_10 Reverse -181 -200 15.6332 0.115
NP_441851.1_10 Reverse -190 -200 15.8113 0.00552
NP_441851.1_10 Forward -201 -191 8.53483 0.114
NP_441851.1_10 Forward -65 -55 7.35486 0.142
NP_441668.1_4 Forward -74 -55 11.5042 0.0929
NP_441668.1_4 Forward -289 -270 -1.47551 0.274
NP_442515.1_1 Reverse -190 -204 -2.36035 0.273
NP_442515.1_1 Reverse -54 -68 -3.63866 0.295
NP_440165.1_5 Forward -201 -182 -6.39206 0.234
NP_441349.1_10 Reverse -181 -200 -2.55715 0.121
NP_441409.1_6 Forward -206 -187 0.392778 0.0649
NP_441409.1_6 Reverse -185 -204 -9.73531 0.191
NP_440432.1_9 Reverse -56 -71 3.32315 0.0935
NP_440432.1_9 Reverse -192 -207 -2.28172 0.169
NP_442843.1_1 Forward -220 -201 -7.86702 0.252
NP_440431.1_3 Reverse -190 -209 -11.5053 0.286
NP_440588.1_2 Reverse -182 -201 -2.16383 0.161
NP_442006.1_2 Forward -389 -372 -7.23765 0.171
NP_442243.1_1 Forward -206 -188 1.88669 0.21
NP_441570.1_1 Reverse -191 -209 -17.6804 0.287
NP_441078.1_4 Forward -200 -191 19.6659 0.0007
NP_441078.1_4 Reverse -191 -200 19.6659 0.0007
NP_441078.1_4 Forward -36 -27 -1.96689 0.282
NP_440793.1_1 Reverse -68 -82 16.4202 0.21
NP_441094.1_5 Forward -50 -31 19.0673 0.29
NP_440526.1_3 Forward -199 -188 10.2846 0.0646
NP_440526.1_3 Reverse -192 -203 9.3996 0.0876
NP_440526.1_3 Reverse -13 -24 4.38475 0.267
NP_440526.1_3 Reverse -56 -67 2.22148 0.267
NP_441432.1_8 Reverse -190 -199 16.8143 0.00595
NP_441432.1_8 Forward -201 -192 16.8143 0.00595
NP_442320.1_8 Forward -206 -192 6.29277 0.029
NP_442320.1_8 Reverse -185 -199 -2.95034 0.1
NP_441732.1_2 Forward -204 -188 3.00846 0.0141
NP_441732.1_2 Reverse -187 -203 -15.0844 0.145
NP_440760.1_1 Reverse -55 -74 -12.4886 0.0931
NP_440760.1_1 Forward -200 -181 -23.1083 0.283
NP_442797.1_6 Reverse -82 -101 7.54634 0.283
NP_440199.1_10 Reverse -188 -198 7.25653 0.231
NP_442489.1_7 Forward -200 -191 20.1576 0.000695
NP_442489.1_7 Reverse -191 -200 20.1576 0.000695
NP_442489.1_7 Forward -64 -55 -1.57357 0.213
NP_442489.1_7 Forward -36 -27 -1.6719 0.235
NP_440565.1_3 Reverse -113 -132 14.1291 0.287
NP_442079.1_7 Reverse -192 -211 11.0125 0.107
NP_440559.1_1 Forward -199 -190 17.4043 0.00658
NP_440559.1_1 Reverse -192 -201 8.65285 0.0586
NP_440559.1_1 Reverse -56 -65 4.91628 0.175
NP_441659.2_8 Reverse -191 -201 20.9245 0.000805
NP_441659.2_8 Forward -200 -190 18.1713 0.00133
NP_441659.2_8 Reverse -55 -65 5.48657 0.106
NP_441040.1_2 Reverse -324 -343 -9.83364 0.24
NP_442346.1_5 Reverse -190 -200 16.6963 0.00248
NP_442346.1_5 Forward -201 -191 16.303 0.00248
NP_442346.1_5 Forward -65 -55 6.8632 0.188
NP_442346.1_5 Reverse -54 -64 4.20827 0.296
NP_440352.1_5 Forward -393 -374 11.0983 0.267
NP_440545.1_3 Forward -204 -187 8.39697 0.0444
NP_440545.1_3 Reverse -187 -204 7.80699 0.0482
NP_441856.1_3 Reverse -188 -207 -1.37718 0.237
NP_440459.1_2 Forward -288 -271 9.67528 0.224
NP_440010.1_3 Forward -271 -252 -2.26216 0.25
NP_442603.1_7 Forward -200 -186 11.7003 0.113
NP_442603.1_7 Reverse -191 -205 7.76712 0.195
NP_442603.1_7 Reverse -55 -69 5.89884 0.269
NP_441888.1_7 Forward -205 -191 3.63784 0.225
NP_441888.1_7 Reverse -186 -200 2.45787 0.225
NP_441502.1_3 Reverse -189 -208 15.9291 0.209
NP_441502.1_9 Forward -159 -145 15.7491 0.289
NP_441833.1_4 Forward -199 -192 15.9687 0.0124
NP_441833.1_4 Reverse -192 -199 15.9687 0.0124
NP_442162.1_9 Forward -199 -192 16.2637 0.0124
NP_442162.1_9 Reverse -192 -199 16.2637 0.0124
NP_442796.1_10 Forward -110 -91 7.47261 0.278
NP_440671.1_4 Forward -206 -192 9.2427 0.184
NP_440671.1_4 Reverse -185 -199 8.45605 0.198
NP_442404.1_9 Reverse -323 -337 17.7968 0.208
NP_440224.1_1 Reverse -180 -199 -0.885524 0.152
NP_440772.1_8 Reverse -185 -204 9.43923 0.253
NP_440772.1_10 Forward -21 -2 11.6469 0.261
NP_442073.1_6 Forward -209 -190 1.57275 0.25
NP_442199.1_5 Forward -208 -189 -3.93378 0.216
NP_442199.1_5 Forward -325 -306 -5.9004 0.255
NP_442140.1_3 Forward -199 -189 10.3048 0.0902
NP_442140.1_3 Forward -63 -53 8.92815 0.117
NP_442140.1_3 Reverse -192 -202 7.94484 0.124
NP_442021.1_3 Reverse -185 -204 -5.40875 0.257
NP_440875.1_9 Reverse -193 -203 17.5217 0.0116
NP_440875.1_9 Forward -198 -188 7.69067 0.255
NP_441813.1_5 Reverse -189 -199 18.1713 0.00743
NP_441813.1_5 Forward -202 -192 8.73149 0.0367
NP_440590.1_4 Forward -199 -186 23.0287 0.00377
NP_440590.1_4 Reverse -192 -205 -2.63565 0.247
NP_440567.1_1 Reverse -192 -206 16.0275 0.0166
NP_442497.1_4 Forward -224 -205 15.4215 0.271
NP_442497.1_10 Reverse -192 -201 17.601 0.00813
NP_442497.1_10 Forward -199 -190 10.4228 0.0087
NP_442497.1_10 Reverse -56 -65 0.29472 0.199
NP_440821.1_4 Forward -202 -192 10.7964 0.0146
NP_440821.1_4 Reverse -189 -199 9.41981 0.0286
NP_440821.1_4 Forward -66 -56 -0.0199663 0.217
NP_441239.1_9 Forward -202 -190 14.887 0.0247
NP_441239.1_9 Forward -66 -54 8.59377 0.128
NP_441239.1_9 Reverse -189 -201 5.25052 0.223
NP_441009.1_4 Reverse -251 -270 13.4708 0.212
NP_442897.1_3 Reverse -69 -88 19.3707 0.059
NP_442568.1_5 Forward -394 -375 12.6841 0.181
NP_441727.1_3 Forward -207 -188 5.211 0.256
NP_441892.1_1 Forward -209 -192 0.0388413 0.176
NP_441892.1_1 Reverse -18 -35 -3.40274 0.239
NP_442044.1_1 Forward -205 -186 -12.0953 0.271
NP_442270.1_9 Reverse -180 -199 -10.227 0.253
NP_440833.1_6 Forward -397 -383 9.24208 0.265
NP_441567.1_1 Forward -109 -90 2.55606 0.227
NP_442138.1_10 Forward -200 -181 -2.85214 0.22
NP_442052.1_8 Forward -281 -271 14.7297 0.253
NP_442052.1_8 Forward -343 -333 13.0581 0.253
NP_440546.1_4 Reverse -191 -201 13.5365 0.0459
NP_440546.1_4 Reverse -55 -65 12.9547 0.0572
NP_440546.1_4 Forward -200 -190 10.046 0.109
NP_440546.1_4 Forward -64 -54 8.49468 0.186
NP_440462.1_6 Forward -202 -192 19.4496 0.00371
NP_440462.1_6 Reverse -189 -199 9.61647 0.0429
NP_442899.1_3 Reverse -70 -89 16.7157 0.126
NP_440868.1_4 Forward -204 -192 7.4138 0.0691
NP_440868.1_4 Reverse -187 -199 1.02229 0.193
NP_442499.1_1 Forward -154 -135 2.3594 0.289
NP_442499.1_3 Reverse -190 -208 6.70565 0.282
NP_441868.1_1 Reverse -206 -225 12.2703 0.261
NP_442402.1_4 Forward -208 -189 -8.26108 0.278
NP_442402.1_4 Reverse -305 -324 -9.44104 0.29
NP_441848.1_4 Reverse -346 -362 7.83714 0.288
NP_441848.1_4 Forward -219 -203 7.83714 0.288
NP_441084.1_6 Forward -202 -188 10.2167 0.25
NP_439942.1_2 Forward -225 -206 12.2108 0.271
NP_442039.1_4 Forward -199 -192 15.1821 0.0124
NP_442039.1_4 Reverse -192 -199 15.1821 0.0124
NP_442679.1_1 Forward -228 -209 5.11266 0.147
NP_442679.1_1 Forward -111 -92 -4.52377 0.281
NP_441926.1_3 Forward -200 -184 6.9417 0.17
NP_442786.1_3 Forward -72 -53 14.3558 0.267
NP_442837.1_3 Forward -199 -192 15.7721 0.0124
NP_442837.1_3 Reverse -192 -199 15.7721 0.0124
NP_439994.1_3 Forward -201 -182 11.17 0.188
NP_442053.1_1 Forward -200 -191 18.3876 0.0007
NP_442053.1_1 Reverse -191 -200 18.3876 0.0007
NP_440505.1_3 Reverse -189 -199 18.3679 0.00213
NP_440505.1_3 Forward -202 -192 15.418 0.0114
NP_441102.1_1 Reverse -192 -211 11.4058 0.13
NP_441203.1_1 Reverse -192 -211 -12.3902 0.143
NP_442532.1_7 Reverse -191 -205 5.40779 0.171
NP_442174.1_9 Reverse -189 -208 5.80098 0.298
NP_440914.1_1 Forward -200 -190 17.5935 0.000537
NP_440914.1_1 Reverse -191 -201 16.3248 0.00196
NP_441011.1_8 Reverse -192 -201 16.6177 0.00602
NP_441011.1_8 Forward -199 -190 8.25953 0.144
NP_442533.1_6 Forward -200 -191 17.2076 0.00137
NP_442533.1_6 Reverse -191 -200 17.2076 0.00137
NP_442533.1_6 Forward -64 -55 11.2095 0.046
NP_443016.1_1 Reverse -49 -68 -6.98204 0.265
NP_441482.1_7 Forward -206 -192 6.6861 0.0269
NP_441482.1_7 Forward -70 -56 -4.91696 0.162
NP_441482.1_7 Reverse -185 -199 -9.93184 0.209
NP_439944.1_8 Forward -99 -80 10.4225 0.298
NP_439944.1_9 Reverse -192 -202 17.7779 0.00341
NP_439944.1_9 Forward -199 -189 10.5014 0.0887
NP_441028.1_6 Reverse -75 -85 5.19112 0.265
NP_440116.1_5 Reverse -188 -205 7.61033 0.155
NP_440116.1_8 Forward -199 -180 -2.0655 0.125
NP_441527.1_4 Forward -234 -215 3.867 0.111
NP_441527.1_4 Forward -240 -221 -2.91293 0.162
NP_441527.1_4 Forward -393 -374 -12.1756 0.285
NP_441527.1_4 Forward -227 -208 -12.9396 0.296
NP_440115.1_6 Forward -203 -193 16.9913 0.0288
NP_440115.1_6 Reverse -188 -198 6.8632 0.167
NP_440007.1_9 Reverse -187 -201 9.14437 0.171
NP_440007.1_9 Forward -204 -190 2.85119 0.277
NP_441602.1_3 Reverse -186 -205 3.34271 0.175
NP_441972.1_5 Reverse -192 -211 -1.67217 0.178
NP_441972.1_5 Forward -211 -192 -7.57203 0.25
NP_441106.1_1 Forward -201 -192 18.486 0.0028
NP_441106.1_1 Reverse -190 -199 9.63616 0.0311
NP_439903.1_6 Forward -203 -184 2.9486 0.216
NP_439903.1_6 Forward -39 -20 -0.787962 0.285
NP_441286.1_1 Reverse -190 -202 14.6903 0.00418
NP_441286.1_1 Forward -201 -189 3.48056 0.0467
NP_441286.1_1 Reverse -54 -66 -4.18925 0.152
NP_440670.1_8 Forward -200 -191 18.3876 0.000699
NP_440670.1_8 Reverse -191 -200 18.3876 0.000699
NP_440886.1_7 Forward -201 -191 8.04271 0.0805
NP_440886.1_7 Reverse -190 -200 7.94438 0.0805
NP_442614.1_2 Forward -200 -186 5.89945 0.296
NP_442072.1_9 Forward -201 -183 -12.5672 0.0852
NP_442072.1_9 Reverse -190 -208 -12.6655 0.0877
NP_442072.1_9 Reverse -295 -313 -15.6155 0.184
NP_441753.1_10 Forward -209 -190 3.14605 0.221
NP_440907.2_8 Reverse -192 -202 19.1541 0.00362
NP_441021.1_1 Forward -199 -180 15.0441 0.0264
NP_441463.1_3 Forward -210 -191 -1.7705 0.146
NP_441463.1_3 Forward -141 -122 -10.227 0.291
NP_442842.1_8 Reverse -338 -357 23.5194 0.0184
NP_441626.1_2 Forward -199 -192 15.7721 0.0124
NP_441626.1_2 Reverse -192 -199 15.7721 0.0124
NP_442211.1_3 Reverse -251 -270 11.168 0.257
NP_442912.1_1 Forward -250 -231 16.6174 0.119
NP_442794.1_1 Reverse -187 -199 10.4621 0.0721
NP_442794.1_1 Forward -204 -192 3.57889 0.286
NP_441401.1_5 Forward -256 -237 11.6973 0.297
NP_442615.1_1 Reverse -182 -200 1.49411 0.0841
NP_442615.1_1 Forward -209 -191 0.117479 0.107
NP_442615.1_1 Reverse -46 -64 -6.76569 0.26
NP_441962.1_4 Reverse -186 -205 -1.08219 0.118
NP_441962.1_4 Forward -346 -327 -7.96535 0.195
NP_441962.1_4 Reverse -50 -69 -12.0953 0.252
NP_441962.1_4 Forward -205 -186 -12.9802 0.268
NP_441962.1_9 Forward -310 -291 8.35759 0.258
NP_440387.1_1 Reverse -191 -207 8.22001 0.0282
NP_440387.1_1 Forward -200 -184 -0.43312 0.138
NP_441431.1_2 Forward -203 -189 7.27547 0.244
NP_441488.1_7 Forward -206 -187 0.294447 0.298
NP_441488.1_8 Reverse -186 -200 7.86545 0.221
NP_441836.1_2 Reverse -49 -68 0.884433 0.197
NP_441836.1_2 Reverse -185 -204 -3.63879 0.242
NP_441993.1_1 Reverse -185 -204 4.96787 0.21
NP_441993.1_1 Forward -206 -187 2.43397 0.259
NP_440358.1_8 Forward -255 -236 4.71934 0.208
NP_440467.1_3 Reverse -192 -211 14.1861 0.178
NP_440114.1_10 Reverse -55 -69 8.65272 0.198
NP_442437.1_8 Reverse -192 -211 5.40766 0.252
NP_440287.1_6 Reverse -182 -201 8.65258 0.151
NP_440293.1_10 Forward -344 -325 -2.75381 0.274
NP_440766.1_4 Forward -204 -190 6.88276 0.097
NP_439988.1_3 Reverse -51 -65 3.93283 0.298
NP_441237.1_9 Reverse -56 -66 14.238 0.0429
NP_439910.1_2 Reverse -183 -200 -21.594 0.183
NP_440457.1_1 Forward -204 -192 6.72548 0.113
NP_440457.1_1 Reverse -187 -199 6.33216 0.123
NP_440987.1_4 Forward -223 -204 7.37428 0.18
NP_442680.1_5 Forward -400 -381 3.29601 0.236
NP_442680.1_5 Forward -121 -102 3.29601 0.236
NP_442297.1_4 Reverse -187 -206 18.6573 0.128
NP_442509.1_9 Forward -200 -190 8.14104 0.192
NP_442509.1_9 Reverse -191 -201 8.04271 0.192
NP_442582.1_3 Forward -220 -206 12.712 0.284
NP_440554.1_4 Reverse -192 -202 15.418 0.0199
NP_440554.1_4 Forward -199 -189 8.92815 0.0646
NP_442737.1_7 Reverse -71 -90 19.6656 0.138
NP_441885.1_5 Forward -200 -190 20.9245 0.000538
NP_441885.1_5 Reverse -191 -201 11.3864 0.00668
NP_441885.1_5 Forward -64 -54 0.0783647 0.183
NP_442703.1_9 Reverse -342 -360 5.13236 0.244
NP_442341.1_7 Reverse -190 -204 10.816 0.0596
NP_442341.1_7 Forward -201 -187 2.75286 0.247
NP_442341.1_7 Reverse -319 -333 1.27789 0.295
NP_442341.1_7 Reverse -54 -68 1.17956 0.297
NP_441756.1_5 Forward -204 -185 11.9958 0.112
NP_442395.2_4 Reverse -190 -209 4.22689 0.186
NP_443000.1_7 Reverse -189 -199 19.9412 0.00223
NP_443000.1_7 Forward -202 -192 10.7964 0.0345
NP_441842.1_3 Reverse -154 -172 13.6872 0.276
NP_441842.1_10 Forward -207 -193 9.73436 0.182
NP_440275.1_3 Forward -202 -192 18.6629 0.0082
NP_440275.1_3 Reverse -189 -199 15.123 0.0182
NP_440091.1_1 Reverse -187 -199 1.31728 0.198
NP_442354.1_8 Reverse -377 -396 8.55425 0.266
NP_441902.1_3 Reverse -350 -360 11.6212 0.293
NP_440679.1_10 Forward -336 -317 -13.1769 0.221
NP_443010.1_10 Forward -203 -186 5.28327 0.207
NP_442451.1_2 Reverse -183 -202 -10.7186 0.278
NP_442638.1_3 Forward -226 -207 10.5514 0.298
NP_441122.1_1 Reverse -51 -66 4.1098 0.28
NP_441105.1_3 Forward -211 -192 7.27595 0.0557
NP_441105.1_3 Reverse -259 -278 -6.98204 0.243
NP_441105.1_3 Reverse -180 -199 -8.85033 0.279
NP_440216.1_1 Forward -200 -186 0.196253 0.0284
NP_440216.1_1 Reverse -191 -205 -2.55701 0.0521
NP_440216.1_9 Forward -84 -75 6.29291 0.289
NP_440172.1_1 Reverse -191 -201 17.5813 0.00421
NP_440172.1_1 Forward -200 -190 15.0247 0.00945
NP_440172.1_1 Forward -64 -54 11.5831 0.0368
NP_440172.1_1 Forward -36 -26 3.22496 0.238
NP_442371.1_1 Forward -385 -375 15.1225 0.176
NP_442371.1_1 Forward -225 -215 11.7793 0.281
NP_442015.1_10 Reverse -187 -200 12.6056 0.0365
NP_442015.1_10 Forward -204 -191 4.54251 0.167
NP_441226.1_7 Forward -199 -192 14.4934 0.0123
NP_441226.1_7 Reverse -192 -199 14.4934 0.0123
NP_441226.1_7 Reverse -56 -63 12.4284 0.0404
NP_440198.1_2 Forward -397 -378 22.7805 0.047
NP_441111.1_7 Forward -199 -191 18.7023 0.00294
NP_441111.1_7 Reverse -192 -200 18.7023 0.00294
NP_441766.1_2 Forward -200 -191 17.5026 0.00297
NP_441766.1_2 Reverse -191 -200 17.5026 0.00297
NP_441766.1_2 Forward -64 -55 4.62128 0.172
NP_442417.1_5 Reverse -191 -205 9.83269 0.126
NP_440416.1_9 Forward -207 -188 -20.5517 0.286
NP_443052.1_8 Forward -153 -134 -12.6852 0.259
NP_440591.1_9 Reverse -184 -202 13.5888 0.0931
NP_440261.1_5 Reverse -192 -205 -1.16069 0.0662
NP_440261.1_5 Forward -199 -186 -4.50394 0.151
NP_440261.1_5 Reverse -56 -69 -10.7971 0.21
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GAGGAGCAAATAGCCCAGGAGGAAATAGTAGTAGATGAAGTTATTGCTCCAATGTCTGGAACAACGGCGGCGGTAATTGAGGTAACCATGCCAGAACTTGTCGACCCTGAAACCAACATTGAGCAAGGGCCAGATTCCAGCGGCGTTGATGAAGTTTATGAAAGGGAAACAGAGACAGAAGAAATTGGAGAAATTACCGAGGCGATCGCCAGTGACCTAGAAGAGGTTCCAGAGCCAAGGACTGATGTCAACGAAACTACGGTCAATACAGACATTGCAGAGGAAGAAGAGACCCAAAATGAAGGGGAAGAGCCCACCGAGGAAAAACAAAATTGGGCCGATGGCTAAACAGTTAACTCTGAAAGGAGATGTCCTATGTTAGGATCGTAAAGCTTCATTG

CDS

No sequence available

Protein

No sequence available